KR100786637B1 - Kit for Diagnosing HPV Genotypes - Google Patents

Kit for Diagnosing HPV Genotypes Download PDF

Info

Publication number
KR100786637B1
KR100786637B1 KR1020060004165A KR20060004165A KR100786637B1 KR 100786637 B1 KR100786637 B1 KR 100786637B1 KR 1020060004165 A KR1020060004165 A KR 1020060004165A KR 20060004165 A KR20060004165 A KR 20060004165A KR 100786637 B1 KR100786637 B1 KR 100786637B1
Authority
KR
South Korea
Prior art keywords
hpv
dna
type
probe
seq
Prior art date
Application number
KR1020060004165A
Other languages
Korean (ko)
Other versions
KR20060015669A (en
Inventor
김연수
Original Assignee
김연수
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 김연수 filed Critical 김연수
Priority to KR1020060004165A priority Critical patent/KR100786637B1/en
Publication of KR20060015669A publication Critical patent/KR20060015669A/en
Application granted granted Critical
Publication of KR100786637B1 publication Critical patent/KR100786637B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • C12Q1/708Specific hybridization probes for papilloma
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/107Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence

Abstract

본 발명에서는 유형 특이적 인유두종바이러스 검출을 위한 프로브 및 이를 이용한 인유두종바이러스 유형 동정용 올리고 DNA 칩과 상기 DNA 칩을 포함하는 인유두종바이러스 유형 진단용 키트가 제공된다. 본 발명에 따른 인유두종바이러스 유형 진단 키트는 여성의 자궁경부암 생성 및 진행에 있어 밀접한 관련이 있는 종양원성 인유두종바이러스의 E6/E7 영역과 상보적으로 결합할 수 있는 프라이머와 상기 증폭산물과 결합할 수 있는 프로브 및 이를 이용하여 샘플 내에 HPV의 존재여부 및 유형동정을 위한 검출 방법 및 검출 키트에 관한 것이다. In the present invention, there is provided a probe for detecting a type-specific human papillomavirus, an oligo DNA chip for identifying a type of HPV using the same, and a kit for diagnosing a HPV type comprising the DNA chip. The HPV type diagnosis kit according to the present invention is capable of binding to the amplification product and a primer capable of complementarily binding to the E6 / E7 region of oncogenic human papillomavirus, which is closely related to the generation and progression of cervical cancer in women. A probe and a detection method and detection kit for identifying the presence and type of HPV in a sample using the same.

인유두종바이러스(Human Papillomavirus, HPV), 마이크로어레이(microarray) Human Papillomavirus (HPV), microarray

Description

인유두종바이러스 유형 진단 키트{Kit for Diagnosing HPV Genotypes}       Kit for Diagnosing HPV Genotypes}

도 1a 내지 도 1c는 각각 본 발명의 일 실시예에 따라 본 발명에서 합성한 총 27조의 프로브를 사용하여 HPV-16 감염 세포주인 Caski, HPV-18 감염 세포주인 HeLa 및 HPV 비감염 세포주인 K562를 대상으로 하여 DNA 칩 분석을 실시한 사진 및 그 해석 도면이다. Figures 1a to 1c respectively targets a total of 27 sets of probes synthesized in the present invention according to an embodiment of the present invention using the HPV-16 infected cell line Caski, HPV-18 infected cell line HeLa and HPV non-infected cell line K562 It is the photograph which analyzed DNA chip, and its analysis figure.

도 2a 내지 도 2j는 각각 본 발명의 다른 실시예에 따라 본 발명에서 합성한 총 27조의 프로브를 사용하여 다양한 HPV 유형의 DNA 서열을 함유하는 HPV 플라스미드를 표적 DNA로 하여 DNA 칩 분석을 실시한 사진 및 그 해석 도면이다. 2A to 2J are DNA chip analysis using HPV plasmids containing DNA sequences of various HPV types as target DNA, respectively, using a total of 27 sets of probes synthesized in the present invention according to another embodiment of the present invention. It is an analysis drawing.

본 발명은 인유두종바이러스(Human Papillomavirus, 이하 "HPV"라 한다.)의 유형을 검출할 수 있는 진단 키트 및 그 키트의 제조 방법에 관한 것으로, 보다 상세하게는 자궁경부암과 밀접한 관련이 있는 HPV 유형에 특이적으로 결합될 수 있는 올리고 뉴클레오티드 프로브와 상기 프로브를 이용하여 HPV 유형을 신속 정확하게 검출, 진단할 수 있는 DNA 마이크로어레이 기술을 이용한 HPV 유형 진단 키트 및 키트 제조 방법에 관한 것이다. The present invention relates to a diagnostic kit capable of detecting a type of human papillomavirus (hereinafter referred to as "HPV") and a method of manufacturing the kit, and more particularly to a type of HPV closely related to cervical cancer. The present invention relates to oligonucleotide probes that can be specifically bound, and methods for producing HPV type diagnostic kits and kits using DNA microarray technology capable of quickly and accurately detecting and diagnosing HPV types using the probes.

기존의 DNA 칩들이 그러하듯이, 현재 FDA 승인을 받은 두 종류의 HPV DNA Chip(바이오메드랩사, 마이진사)은 프로브의 말단을 아민기로 변형시킨 뒤 글라스 상의 알데히드기와의 시프염기반응에 따라 고정된 것을 특징으로 하고 있는데 비해 본 발명의 HPV DNA Chip은 다른 작용기에 의하여 프로브를 변형할 필요가 없기 때문에 9개의 구아닌 염기를 포함한 올리고 DNA가 녹아있는 용액을 칩 base위에 도포하면 구아닌 염기가 자발적으로 칩 위에 고정화되는 것을 특징으로 한다. 이처럼 기존의 칩 base를 변형시킨 본 HPV DNA 칩의 특징은 다음과 같다. 1) 본 발명의 HPV DNA 칩은 guanine을 인식하여 생체분자를 표면에 고정화 하는 기술로 다른 작용기가 필요 없기 때문에 저 비용으로 probe DNA 제조 가능. 2) 종전의 DNA Chip에 비해 10-30분 정도의 짧은 hybridization 시간과 간단한 세척과정만 필요하기 때문에 30단계에 이르는 SNP 판별과정을 5단계로 조정할 수 있음. 3) 기존의 칩에서는 결합과 세척과정에서 정해진 온도를 1℃ 정도만 벗어나도 염기서열이 맞지 않는 DNA는 잘 떨어지지 않아 에러를 얻는데 비해, 본 HPV DNA 칩은 5℃ 이상의 온도차에서도 SNP(single nucleotide polymorphism)를 쉽게 확인 할 수 있음. 4) 기존의 칩에서는 결과의 판독을 위해 수십 ng/ml이상의 cDNA를 사용하여 왔지만 BMT Guanine Chip™ 에서는 수십 pg/ml~수십 ng/ml 의 농도에서도 SNP 판독이 가능. 5) 측정점 주변에 배경 형광이 많이 존재하면 판독에 많은 문제가 있지만 BMT Guanine Chip™은 특수한 표면처리 과정과 blocking solution을 제공하여 cDNA가 표면에 부착될 수 없게 하여 배경 형광을 최대한 제거하여 선명한 측정점의 형광만을 관찰할 수 있다.       As with conventional DNA chips, two types of FDA-approved HPV DNA Chips (BioMedLab, Maijin, Inc.) have been modified by immobilizing the ends of the probes with amine groups and then reacting with the sifbase reaction with aldehyde groups on the glass. In contrast, the HPV DNA Chip of the present invention does not need to modify the probe by other functional groups. Thus, when a solution containing oligo DNA containing nine guanine bases is applied onto the chip base, the guanine base spontaneously It is characterized in that it is fixed. The characteristics of this HPV DNA chip modified from the existing chip base are as follows. 1) The HPV DNA chip of the present invention recognizes guanine and immobilizes biomolecules on the surface. Therefore, it is possible to manufacture probe DNA at low cost since no other functional group is required. 2) Because of the short hybridization time of 10-30 minutes and simple washing process compared to the previous DNA chips, the SNP discrimination process of 30 steps can be adjusted to 5 steps. 3) In the conventional chip, the DNA that does not match the nucleotide sequence does not fall well even if the temperature is separated by only 1 ℃ from the process of binding and washing, but the error is obtained. You can easily check. 4) Conventional chips have used more than a few tens of ng / ml cDNA to read the results, but BMT Guanine Chip ™ can read SNPs at concentrations of tens of pg / ml to tens of ng / ml. 5) If there is a lot of background fluorescence around the measurement point, there will be many problems in reading, but BMT Guanine Chip ™ provides a special surface treatment process and blocking solution to prevent cDNA from attaching to the surface, eliminating background fluorescence as much as possible, resulting in a clear measurement point. Only fluorescence can be observed.

자궁경부암(cervical cancer)은 자궁경부에서 발생하는 악성종양으로 전체 자궁암 발생빈도의 95% 이상을 차지하고 있으며, 전세계 여성 암 가운데 유방암 다음으로 발생빈도가 높아 해마다 약 44만 건 정도가 신규로 보고되고 있으며, 개발도상국에서는 가장 흔한 여성암으로 연간 약 30만 명이 자궁경부암으로 사망한다. 우리나라의 경우 2000년도 보건복지부 암 등록 조사통계를 보면 1년에 약 5,000여명의 새로운 환자들이 발생하는 것으로 보고되고 있다. 이는 여성의 경우 자궁경부암(10.6%)은 3803건으로 10대 암의 장기별 발생 빈도 상 위암(15.8%)과 유방암(15.1%)에 이어 3위를 차지하고 있으며 특히 최근엔 20-30대 젊은 여성의 감염율이 크게 늘어 전체 환자의 32%를 차지하는 등 국민보건상 심각한 문제로 대두되고 있다. Cervical cancer is a malignant tumor occurring in the cervix, accounting for more than 95% of all uterine cancers, and the highest incidence of cancer among women in the world after breast cancer. In the developing world, the most common female cancer is about 300,000 people die of cervical cancer each year. In Korea, the Ministry of Health and Welfare Cancer Registration Survey 2000 reported that about 5,000 new cases occur every year. For women, cervical cancer (10.6%) was 3803 cases, which ranked third after gastric cancer (15.8%) and breast cancer (15.1%). The number has risen sharply, accounting for 32% of all patients, making it a serious health problem.

자궁경부암은 일반적으로 HPV가 자궁경부 상피 기저 세포에 감염한 후 저급 상피 이형성증(low squamous intraepithelial lesion, LSIL), 고급 상피 이형성증(high squamous intraepithelial lesion, HSIL) 및 상피내암 등의 오랜 전구 단계를 거쳐 최종 침윤암으로 발전하게 되는데, 이처럼 암으로 발생하기 전 단계인 전암 단계 병변이 존재하기 때문에, 조기에 이들 병변을 조기에 효과적으로 진단, 치 료함으로써, 자궁경부암을 예방할 수 있다. Cervical cancer usually develops after HPV infections in cervical epithelial basal cells, followed by prolonged prognostic stages such as low squamous intraepithelial lesions (LSIL), high squamous intraepithelial lesions (HSIL), and epithelial cancer. It develops into invasive cancer, and since there are precancerous stages before the cancer development, it is possible to prevent cervical cancer by early diagnosis and treatment of these lesions early and effectively.

현재까지의 연구에 따르면, 자궁경부암의 발병원은 성 접촉으로 인해 감염되는 HPV(약 8kb의 이중쇄 환상 DNA 바이러스)가 주요 인자인 것으로 밝혀지고 있다. HPV의 게놈에는 숙주세포에 감염한 후 초기 과정에 관여하는 E1 ~ E7 유전자와 후기 과정에 관연하는 L1, L2 유전자가 존재하며, 특히 HPV의 바이러스성 발암유전자 산물인 E6와 E7 단백질이 각각 세포내의 종양억제 단백질인 p53과 pRb와 결합하여 이들 종양억제 단백질의 기능을 폐기함으로써, 암을 유발시키는 것으로 확인되고 있다. To date, studies of cervical cancer have revealed that HPV (about 8 kb of double-stranded circular DNA virus), which is infected by sexual contact, is a major factor. In the genome of HPV, there are E1 to E7 genes involved in the initial process after infection with the host cell, and L1 and L2 genes involved in the late process, and in particular, the E6 and E7 proteins, the viral carcinogen products of HPV, respectively. It is confirmed that cancer is caused by binding the tumor suppressor proteins p53 and pRb to discard the functions of these tumor suppressor proteins.

HPV 게놈 염기서열 중 E6, E7 및 L1 유전자의 열린 해독틀(open reading frame)의 차이를 근거로 하여 현재까지 120 가지 이상의 다른 유형이 발견되었다. 이들 HPV 유형 가운데 생식기(Genital)에 감염하는 HPV 유형으로는 HPV-16, -31, -33, -35, -52, -58, -67, -40, -43, -7, -32, -42, -6, -11, -74, -44, -55, -13, -61, -72, -62, -2, -27, -57, -3, -28, -29, -10, -54, -18, -39, -45, -59, -68, -70, -26, -69, -51, -30, -53, -56, -66, -34, -64 및 -73등의 45 유형으로 이 가운데 자궁경부암과 밀접한 관련이 있는 HPV 유형으로는 고위험군(high-risk group)에 속하는 HPV-16, -18, -26, -30, -31, -33, -35, -39, -45, -51, -52, -53, -56, -57, -58, -59, -61, -67, -68, -70 및 -73, -74의 22 유형과 저위험군(low-risk group)에 속하는 HPV-2a, -3, -6, -10, -11, -32, -34, -40, -42, -43, -44. -54, -55, -66 및 -69의 15유형 등이 자궁경부암으로의 진행과 밀접한 관련이 있다.More than 120 different types have been discovered to date based on differences in the open reading frame of the E6, E7 and L1 genes in the HPV genome sequences. Among these HPV types, HPV types that infect the genitals include HPV-16, -31, -33, -35, -52, -58, -67, -40, -43, -7, -32,- 42, -6, -11, -74, -44, -55, -13, -61, -72, -62, -2, -27, -57, -3, -28, -29, -10, -54, -18, -39, -45, -59, -68, -70, -26, -69, -51, -30, -53, -56, -66, -34, -64 and -73 Among these, HPV-16, -18, -26, -30, -31, -33, -35,-belonging to the high-risk group are among the HPV types that are closely related to cervical cancer. 22 types of low risk groups (39, -45, -51, -52, -53, -56, -57, -58, -59, -61, -67, -68, -70, and -73, -74) low-risk group), HPV-2a, -3, -6, -10, -11, -32, -34, -40, -42, -43, -44. Types 15 of -54, -55, -66 and -69 are closely related to the progression of cervical cancer.

이와 같이, 감염된 HPV 유형의 종류에 따라 암의 향후 진행에 막대한 영향을 초래할 수 있으므로 샘플 내에서 HPV의 존재 여부 및 존재하는 HPV 유형을 정확하게 동정함으로서, 자궁경부암 환자의 예후 및 진단에 중요한 의미를 가질 수 있다.As such, the type of infected HPV may have a significant impact on the future progression of cancer, and thus, by accurately identifying the presence and type of HPV in the sample, it may have important significance in the prognosis and diagnosis of cervical cancer patients. Can be.

현재 자궁경부암과 전구 병변의 일차 선별을 위해 자궁경부 세포진의 세포학적 형태에 근거하는 세포진 검사(Papanicolaou(Pap) smear)가 1940년대부터 표준 검사법으로 시행되어 자궁경부암으로 인한 사망률을 크게 감소시키는데 일익을 담당해 왔으나 여전히 30~40%의 높은 위음성율을 나타내는 것으로 보고되고 있다. Currently, Pappanicolaou (Pap) smear based on the cytological morphology of cervical papules for the primary screening of cervical cancer and progenitor lesions has been performed as a standard test since the 1940s, greatly reducing mortality from cervical cancer. Although he has been in charge, it is still reported to have a high false negative rate of 30-40%.

한편, 분자 생물학적인 수단을 통하여 HPV의 존재 및 유형을 분석하기 위한 방법은 크게 HPV DNA를 직접적으로 확인하는 방법과 HPV DNA의 증폭을 이용하는 방법이 있을 수 있는데, HPV DNA의 직접 확인방법으로는 서던블롯, 도트 블롯 및 필터 인 시튜 등의 방법이 사용되고 있다. 특히, 미합중국 특허 제 6,221,581호에서는 대상 DNA와 RNA 프로브 사이의 액상 상보 결합을 항체 효소 발색 반응을 통하여 검출하는 액상 하이브리디제이션(liquid hybridization, Hybrid Capture Ⅱ) 방법이 개시되어 있다. 하이브리드 캡처 Ⅱ 방법을 통하여 자궁경부암과 그 전구 병변의 보조적 선별 또는 추적 검사가 가능하다. 그러나 상기 방법은 RNA 프로브를 이용하므로 안정성이 낮고 오염 가능성을 배제할 수 없는 문제점을 안고 있다.On the other hand, the method for analyzing the presence and type of HPV through molecular biological means can be largely the method of directly identifying the HPV DNA and the method using amplification of HPV DNA, Southern direct method of HPV DNA Blots, dot blots and filter in situ methods are used. In particular, US Pat. No. 6,221,581 discloses a liquid hybridization method (Hybrid Hybridization II) which detects a liquid complementary bond between a target DNA and an RNA probe through an antibody enzymatic color reaction. The Hybrid Capture II method allows for adjuvant screening or follow-up of cervical cancer and its precursor lesions. However, since the method uses an RNA probe, there is a problem that the stability is low and the possibility of contamination cannot be excluded.

DNA 증폭을 이용하는 방법으로서, PCR 기법은 다양한 HPV 유형의 감염 여부 및 그 유형 동정을 위해 많이 이용되고 있는데 이를 이용한 방법으로는 유형 특이적 PCR(type-specific polymerase chain reaction)과 제너럴 프라이머 PCR (general-primer PCR)등이 있다. 그러나 상기 분석 방법들은 탐지감도와 데이터 해석상에 다소 문제점을 내포하고 있다. As a method using DNA amplification, PCR techniques are widely used to identify various types of HPV infections and to identify their types. The methods using these methods include type-specific polymerase chain reaction and general primer PCR. primer PCR). However, these analytical methods have some problems in detection sensitivity and data interpretation.

최근 분자생물학과 전자공학 기술의 접목을 통해 한 장의 현미경용 슬라이드 위에서 수십에서 수만 종류의 유전자를 동시에 검사할 수 있는 유전자 칩(DNA chip, DNA microarray)이 개발되었다. 이러한 DNA 칩은 유전자 발현 해석, 유전자 진단, 유전자 돌연변이, 의약품 스크린 및 질환 진단용 등에 널리 응용될 수 있는 새로운 차원의 분석 시스템이다. 따라서 이를 이용한 HPV 유형 동정은 자궁경부암과 관련된 HPV 유형을 신속하게 검출할 수 있는 HPV DNA 칩의 개발을 가능하게 하였다. Recently, a combination of molecular biology and electronics technology has led to the development of DNA chips (DNA chips, DNA microarrays) that can simultaneously test tens to tens of thousands of genes on a single microscope slide. This DNA chip is a new level of analysis system that can be widely applied for gene expression analysis, gene diagnosis, gene mutation, pharmaceutical screen and disease diagnosis. Therefore, the identification of HPV type using this has enabled the development of HPV DNA chip that can quickly detect HPV type related to cervical cancer.

본 발명은 상기와 같은 문제점을 해결하기 위하여 제안된 것으로, 본 발명의 목적은 자궁경부암과 밀접한 관련이 있는 종양원성 인유두종바이러스를 신속하고 간단하게 검출할 수 있는 올리고 뉴클레오티드로 구성되는 프로브를 제공하는 데 있다. The present invention has been proposed to solve the above problems, and an object of the present invention is to provide a probe consisting of oligonucleotides that can quickly and simply detect oncogenic human papillomavirus that is closely related to cervical cancer have.

본 발명의 다른 목적은 상기 프로브를 이용하여 종양원성 인유두종바이러스를 선택적으로 검출할 수 있는 올리고 뉴클레오티드 DNA 칩(마이크로 어레이) 및 상기 DNA 칩을 포함하는 인유두종바이러스 유형 진단 키트를 제공하는 것이다.  Another object of the present invention is to provide an oligonucleotide DNA chip (micro array) capable of selectively detecting tumorigenic human papillomavirus using the probe and a human papillomavirus type diagnostic kit comprising the DNA chip.

본 발명의 또 다를 목적은 인유두종바이러스의 존재 및 그 유형을 신속하게 진단할 수 있는 상기 진단 키트를 제조하는 방법을 제공하는 데 있다. It is another object of the present invention to provide a method for producing the diagnostic kit that can quickly diagnose the presence and type of human papillomavirus.

상기한 목적을 달성하기 위하여, 본 발명의 일 관점에서는 서열번호 1 내지 서열번호 27로 구성되는 군으로부터 선택되는 올리고 뉴클레오티드로 구성되는 종양원성 인유두종바이러스 유형을 검출하기 위한 프로브가 제공된다. 상기 프로브는 인유두종바이러스의 발암에 중요한 영향을 미칠 뿐만 아니라 유형 분류의 기준이 되는 E6/E7 영역의 DNA 서열과 특이적으로 결합할 수 있는 것을 특징으로 한다.         In order to achieve the above object, in one aspect of the present invention there is provided a probe for detecting oncogenic human papillomavirus type consisting of oligonucleotides selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 27. The probe not only has an important effect on the carcinogenesis of human papillomavirus, but is also characterized in that it can specifically bind to the DNA sequence of the E6 / E7 region, which is the standard of classification.

또한, 본 발명의 다른 관점에 따르면 글라스와 공유 결합을 통하여 결합되어 있는 아미노캘릭스아렌 유도체가 배열되어 있는 올리고 뉴클레오티드 DNA 칩으로서, 제 1항 내지 제 4항 중 어느 하나의 항에 기재되어 있는 프로브의 5‘ 말단에 구아닌 염기가 추가되어 변형된 프로브가 상기 아미노캘릭스아렌 유도체와 수소 결합을 통하여 결합되어 있는 올리고 뉴클레오티드 DNA 칩과; 상기 프로브와 시료 DNA의 교잡 반응을 탐지할 수 있는 표지수단을 포함하는 인유두종바이러스 유형 진단 키트를 제공한다.According to another aspect of the present invention, an oligonucleotide DNA chip in which aminocalixarene derivatives are bonded to a glass via a covalent bond is arranged, the probe according to any one of claims 1 to 4. An oligonucleotide DNA chip in which a probe modified by adding a guanine base at a 5 'end of the amino acid is bonded to the aminocalixarene derivative through hydrogen bonding; It provides a human papillomavirus type diagnostic kit comprising a label means for detecting the hybridization reaction of the probe and the sample DNA.

본 발명에 따르는 상기 키트의 구성을 통하여 자궁경부암과 관련이 있는 종양원성 인유두종바이러스의 감염 여부를 조기에 정확, 신속하게 진단할 수 있다. Through the configuration of the kit according to the present invention, it is possible to diagnose early and accurately an infection of tumorigenic human papilloma virus associated with cervical cancer.

또한, 본 발명의 또 다른 관점에서는 글라스와 공유 결합을 통하여 결합되어 있는 아미노캘릭스아렌 유도체가 배열되어 있는 올리고 뉴클레오티드 DNA 칩을 포함하는 인유두종바이러스 유형 진단 키트의 제조 방법으로서, 상기 인유두종바이러스 검출을 위한 프로브의 5‘ 말단에 구아닌 염기를 결합시켜 상기 프로브를 변형시키는 단계와; 상기 구아닌 염기에 의하여 변형된 상기 프로브를 상기 아미노캘릭스아렌 유도체와 수소 결합을 통하여 상기 DNA 칩의 글라스 상에 고정시켜 인유두종바이러스 검출을 위한 DNA 칩을 제조하는 단계를 포함하는 인유두종바이러스 유형 진단 키트의 제조 방법을 제공한다.In still another aspect of the present invention, there is provided a method for producing a human papillomavirus type diagnostic kit comprising an oligonucleotide DNA chip in which an aminocalixarene derivative is bonded to a glass via covalent bonds. Binding the guanine base to the 5 'end of the probe to modify the probe; Fixing the probe modified by the guanine base on the glass of the DNA chip through the hydrogen bond with the aminocalixarene derivative to prepare a DNA chip for human papillomavirus detection comprising It provides a manufacturing method.

더욱이 본 발명의 또 다른 관점에서는 글라스와 공유 결합을 통하여 결합되어 있는 아미노캘릭스아렌 유도체가 배열되어 있는 올리고 뉴클레오티드 DNA 칩으로서, 상기 인유두종바이러스 검출을 위한 프로브의 5‘ 말단에 구아닌 염기가 추가되어 변형된 프로브가 상기 아미노캘릭스아렌 유도체와 수소 결합을 통하여 상기 DNA 칩 상에 고정되어 있는 인유두종바이러스 유형 분석용 올리고 뉴클레오티드 DNA 칩을 제공한다.Furthermore, in another aspect of the present invention, an oligonucleotide DNA chip in which aminocalixarene derivatives are bonded to a glass and covalently bound is arranged, wherein a guanine base is added to the 5 'end of the probe for detecting the HPV. The prepared probe provides an oligonucleotide DNA chip for human papillomavirus type analysis, which is immobilized on the DNA chip through hydrogen bonding with the aminocalixarene derivative.

이하, 본 발명에 대하여 보다 상세하게 설명한다. EMBODIMENT OF THE INVENTION Hereinafter, this invention is demonstrated in detail.

상기에서 설명한 바와 같이, HPV는 현재까지 120여개의 유형이 밝혀졌으며, 특히 자궁경부암의 관련성에 따라서 고위험군 HPV 유형과 저위험군 HPV 유형으로 구분된다. 고위험군 HPV 유형으로는 HPV -16, -18, -26, -30, -31, -33, -34, -35, -39, -45, -51, -52, -53, -56, -58, -59, -61, -66, -67, -68, -69, -70, -73, -74 등이 있으며, 저위험군 HPV 유형으로는 HPV -2, -3, -6, -7, -10, -11, -13, -32, -40, -42, -43, -44, -55, -54 및 -57 등이 있다.As described above, about 120 types of HPV have been identified to date, and are classified into high-risk HPV type and low-risk HPV type according to the relevance of cervical cancer. High-risk HPV types include HPV -16, -18, -26, -30, -31, -33, -34, -35, -39, -45, -51, -52, -53, -56, and -58 , -59, -61, -66, -67, -68, -69, -70, -73, -74, etc. Low risk HPV types include HPV -2, -3, -6, -7, -10, -11, -13, -32, -40, -42, -43, -44, -55, -54 and -57.

우선, 본 발명에서는 자궁경부암과 관련이 있는 다양한 HPV 유형을 탐지할 수 있는 프로브를 설계하고, 상기 프로브를 이용하여 자궁경부 내 존재하고 있는 다수의 HPV 유형을 검출할 수 있도록 하였다. 이를 위하여 본 발명에서는 총 72가지 HPV 유형의 전 서열 중 자궁경부암과 관련이 높은 HPV DNA 서열을 기준으로 컴 퓨터 프로그램을 이용하여 유형 특이적 프로브를 설계하였다. 상기 설계된 프로브는 다른 컴퓨터 프로그램을 사용하여 다양한 HPV 유형에 대한 결합능을 확인한 후 최종적으로 27조의 프로브를 선별하였다. First, in the present invention, a probe capable of detecting various types of HPV associated with cervical cancer was designed, and the probe was used to detect a plurality of HPV types existing in the cervix. To this end, in the present invention, a type-specific probe was designed using a computer program based on HPV DNA sequences highly related to cervical cancer among a total of 72 HPV types. The designed probes were then screened for 27 sets of probes after confirming their binding to various HPV types using different computer programs.

상기에서 선별된 프로브는 핵산자동합성기(ExpediteTM 8909 합성기, ABI 사)를 사용하여 합성되었다. 이와 같이 합성된 총 27조의 프로브 5' 말단에 다수의 구아닌 염기를 추가하는 변형을 실시하여 상기 프로브에 첨가된 구아닌과, 공유결합을 통하여 글라스 상부에 배열되어 있는 아미노캘릭스아렌 유도체가 수소 결합함으로써, 구아닌에 의하여 변형된 프로브가 DNA 칩의 표면에 글라스 슬라이드에 자발적으로 고정될 수 있도록 하였다. 이와 관련하여 상기 DNA 프로브는 바람직하게는 50 ~ 150 ㎍/㎖의 농도로 포함될 수 있으며, 보다 바람직하게는 약 100 pmol/㎕의 농도로 첨가된다.The probes selected above were synthesized using a nucleic acid autosynthesizer (Expedite ™ 8909 synthesizer, ABI). By modifying the addition of a plurality of guanine bases to the total 5 trillion probe 5 'terminal synthesized in this way, the guanine added to the probe and the aminocalixarene derivatives arranged on the glass through covalent bonds are hydrogen-bonded. The probe modified by guanine was spontaneously fixed to the glass slide on the surface of the DNA chip. In this regard, the DNA probe may preferably be included at a concentration of 50 to 150 μg / ml, more preferably at a concentration of about 100 pmol / μl.

상기와 같이 변형된 HPV 유형 특이적 프로브가 고정된 DNA 칩에 HPV 감염 여부를 검출할 수 있도록 상기 프로브와 교잡 반응할 수 있는 총괄 프라이머(general primer)에 의하여 증폭된 HPV PCR 산물에 적절한 물질이 표지되어 있는 표지수단을 더욱 포함하는 구성을 취할 수 있다. 본 발명과 관련하여 HPV DNA 증폭 산물에 부착되는 표지 물질은 바람직하게는 형광 물질로서 Cy3와 Cy5가 사용될 수 있다. Labels suitable for HPV PCR products amplified by general primers capable of hybridizing with the probes to detect HPV infection on the immobilized DNA chip is modified HPV type specific probes as described above It is possible to take the configuration further comprising the label means. As the labeling substance attached to the HPV DNA amplification product in connection with the present invention, Cy3 and Cy5 may be preferably used as the fluorescent substance.

상기와 같이 구성되는 DNA 마이크로어레이 기술을 이용한 진단 키트를 이용하여 우선 대표적인 HPV 감염세포주인 CaSki(HPV-16)와 HeLa(HPV-18) 및 HPV 비감염세포주인 K562 DNA를 표적 DNA로 하여 본 발명에서 사용된 프라이머를 이용하여 PCR을 실시한 후 본 발명에서 확인한 27조의 HPV 유형 특이적 프로브와의 하이브리디제이션 실험을 실시하였다.Using a diagnostic kit using the DNA microarray technology as described above, the target DNA of the first HPV infected cell lines CaSki (HPV-16) and HeLa (HPV-18) and HPV non-infected cell lines K562 DNA in the present invention PCR was performed using the primers used, and then hybridization experiments with 27 sets of HPV type specific probes identified in the present invention were performed.

한편, 본 발명에서 합성한 27조의 HPV 유형 특이적 프로브를 사용하여 다양 한 유형의 HPV 플라스미드 DNA를 표적으로 하여 하이브리디제이션을 수행한 결과 모두 이에 상응하는 특정 유형의 HPV DNA와 선택적으로 결합한다는 사실을 확인하였다. On the other hand, using hybridization of 27 types of HPV type specific probes synthesized in the present invention to target various types of HPV plasmid DNA, the fact that all of them selectively bind to the corresponding specific type of HPV DNA It was confirmed.

이하, 본 발명을 실시 예를 통하여 보다 자세하게 설명한다. 그러나, 하기 실시예는 본 발명의 구성 및 효과를 입증하기 위한 실시예 일 뿐 본 발명이 하기 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are only examples for demonstrating the constitution and effects of the present invention, and the present invention is not limited to the following examples.

실시예 1 : HPV 올리고 뉴클레오티드 DNA 칩의 제작Example 1 Preparation of HPV Oligonucleotide DNA Chips

본 발명에 따른 올리고 뉴클레오티드 DNA 칩(마이크로어레이)은 올리고 뉴클레오티드 프로브의 합성과 상기 프로브를 슬라이드 상에 고정하는 단계로 구성된다. The oligonucleotide DNA chip (microarray) according to the present invention consists of synthesizing oligonucleotide probes and fixing the probes on a slide.

(1) HPV 올리고 뉴클레오티드 프로브의 설계(1) Design of HPV Oligonucleotide Probes

자궁경부암과 밀접한 관련이 있는 종양원성(oncogenic) HPV DNA에 선택적으로 결합될 수 있는 유형 특이적 프로브로 사용될 수 있는 올리고 뉴클레오티드를 설계하였다. Oligonucleotides have been designed that can be used as type specific probes that can selectively bind to oncogenic HPV DNA closely related to cervical cancer.

우선, 미국 NCBI(National Center for Biotechnology Information)와 미국립 로스 알라모스 HPV 데이터베이스로부터 HPV-1a, -2a, -3, -4, -5, -6b, -7, -8, -9, -10, -11, -12, -13, -15, -16, -16r, -17, -18, -19, -20, -21, -22, -23, -24, -25, -26, -27, -28, -29, -30, -31, -32, -33, -34, -35, -35h, -36, -37, -38, -39, -40, -41, -42, -44, -45, -47, -48, -49, -50, -51, -52, -53, -54, -55, -56, -57, -58, -59, -60, -61, -63, -65, -66, -67, -68, -70, -72, -73, -74, -76, -77, -80 의 총 72가지 HPV 유형의 전 DNA 염기서열을 확보하였다. 확보한 DNA 서열을 컴퓨터 프로그램 'DNASTAR(MegAlignTM 5, DNASTAR Inc.)'를 활용하여 ClustalW 방법으로 쌍정렬(pairwise alignment) 및 다중서열정렬(multiple sequence alignment)을 실행한 후 분류계통도(Phylogenetic tree)를 작성하고 각 그룹별 유형 특이적 염기서열을 선별한 다음, 다시 컴퓨터 프로그램 프라이머 프리미어 5(primer premier 5, PREMIER Biosoft International Co.)를 활용하여 유형 특이 프로브를 설계하였다. 이때 프로브의 길이는 30±3 및 40±2의 올리고 뉴클레오티드로 설정하여 100조의 유형 특이적 프로브를 설계하였다. First, HPV-1a, -2a, -3, -4, -5, -6b, -7, -8, -9, -10 from the National Center for Biotechnology Information (NCBI) and the US Los Angeles Alamos HPV database. , -11, -12, -13, -15, -16, -16r, -17, -18, -19, -20, -21, -22, -23, -24, -25, -26,- 27, -28, -29, -30, -31, -32, -33, -34, -35, -35h, -36, -37, -38, -39, -40, -41, -42, -44, -45, -47, -48, -49, -50, -51, -52, -53, -54, -55, -56, -57, -58, -59, -60, -61 A total of 72 HPV types were obtained: -63, -65, -66, -67, -68, -70, -72, -73, -74, -76, -77, and -80. . The obtained DNA sequence is performed using the computer program 'DNASTAR (MegAlignTM 5, DNASTAR Inc.)' to perform pairwise alignment and multiple sequence alignment using the ClustalW method, and then use the Phylogenetic tree. After typing and selecting the type-specific sequences of each group, the type-specific probe was designed using the computer program primer premier 5 (PreMIER Biosoft International Co.). At this time, the length of the probe was set to 30 ± 3 and 40 ± 2 oligonucleotides to design 100 trillion type specific probes.

(2) 설계한 프로브의 하이브리디제이션 및 프로브 선별(2) Hybridization and Probe Selection of Designed Probes

상기 과정에서 설계한 총 100조의 프로브를 대상으로 컴퓨터 프로그램(Amplify 1.2, University of Wisconsin)을 사용하여 설계 과정에서 이미 확보한 총 72가지의 다른 HPV 유형을 대상으로 가상 결합능을 분석하였다. 본 실시예에서는 자궁경부암과 관련된 HPV-16, -18, -31, -33, -35, -39, -45, -51, -52, -53, -56, -58, -59, -61, -66, -67, -68, -70, -73, -6, -11, -32, -34, -40, -42, -43 및 -44의 종양원성 HPV 유형과 특이적으로 결합할 수 있는 것에 우선순위를 두고 선택하였으며 프로브의 명칭과 서열번호 및 유형은 하기 표 1에 제시하였다. 설명의 편의를 위하여 본 발명에서 사용되는 총 27조의 프로브는 각각 HOP-1 내지 HOP- 27로 명명하였으며, 이들 프로브는 서열번호 1 내지 서열번호 27로 구성된다. A total of 100 sets of probes designed in the above process were analyzed using a computer program (Amplify 1.2, University of Wisconsin) to analyze virtual binding capacity of 72 different HPV types already acquired during the design process. In this embodiment, HPV-16, -18, -31, -33, -35, -39, -45, -51, -52, -53, -56, -58, -59, -61 associated with cervical cancer To specifically bind to oncogenic HPV types of -66, -67, -68, -70, -73, -6, -11, -32, -34, -40, -42, -43 and -44 The choices were given with priority, and the names, sequence numbers and types of probes are given in Table 1 below. For convenience of explanation, a total of 27 sets of probes used in the present invention were named HOP-1 to HOP-27, respectively, and these probes were composed of SEQ ID NO: 1 to SEQ ID NO: 27.

표 1. 다양한 유형의 HPV DNA와 결합할 수 있는 유형 특이적 프로브Table 1. Type specific probes that can bind to various types of HPV DNA

프로브Probe 서열 (5'→3')Sequence (5 '→ 3') 서열번호SEQ ID NO: HPV 유형HPV Type HOP1HOP1 CGGATGCATGGAGATACACCTACATTGCAT CGGATGCATGGAGATACACCTACATTGCAT 서열번호 1SEQ ID NO: 1 HPV-16HPV-16 HOP2HOP2 CAACATTGCAAGACATTGTATTGCATTTAGAGCAACATTGCAAGACATTGTATTGCATTTAGAG 서열번호 2SEQ ID NO: 2 HPV-18HPV-18 HOP3HOP3 CTGACCTCCACTGTTATGAGCAATTACCCCTGACCTCCACTGTTATGAGCAATTACCC 서열번호 3SEQ ID NO: 3 HPV-31HPV-31 HOP4HOP4 ACGTAGAGAAACTGCACTGTGACGTGTAAAACGTAGAGAAACTGCACTGTGACGTGTAAA 서열번호 4SEQ ID NO: 4 HPV-33HPV-33 HOP5HOP5 TGTATTACATGTCAAAAACCGCTGTGTCCAGTTTGTATTACATGTCAAAAACCGCTGTGTCCAGTT 서열번호 5SEQ ID NO: 5 HPV-35HPV-35 HOP6HOP6 AAGAGAAACCCAAGTATAACATCAGATATGCGAAGAGAAACCCAAGTATAACATCAGATATGCG 서열번호 6SEQ ID NO: 6 HPV-39HPV-39 HOP7HOP7 TGCATTTGGAACCTCAGAATGAATTAGATCCTTGCATTTGGAACCTCAGAATGAATTAGATCCT 서열번호 7SEQ ID NO: 7 HPV-45HPV-45 HOP8HOP8 ATGTACCACAATTAAAAGATGTAGTATTGCATATGTACCACAATTAAAAGATGTAGTATTGCAT 서열번호 8SEQ ID NO: 8 HPV-51HPV-51 HOP9HOP9 ACCCCGACCTGTGACCCAAGTGTAACACCCCGACCTGTGACCCAAGTGTAAC 서열번호 9SEQ ID NO: 9 HPV-52HPV-52 HOP10HOP10 CACTTCCACAATATATTATAGAACTTATACCACACTTCCACAATATATTATAGAACTTATACCA 서열번호 10SEQ ID NO: 10 HPV-53HPV-53 HOP11HOP11 CTGCAAGACGTTGTATTAGAACTAACACCTCTGCAAGACGTTGTATTAGAACTAACACCT 서열번호 11SEQ ID NO: 11 HPV-56HPV-56 HOP12HOP12 CCATGAGAGGAAACAACCCAACGCTAAGCCATGAGAGGAAACAACCCAACGCTAAG 서열번호 12SEQ ID NO: 12 HPV-58HPV-58 HOP13HOP13 AACAATGCATGGACCAAAAGCAACACTTTGAACAATGCATGGACCAAAAGCAACACTTTG 서열번호 13SEQ ID NO: 13 HPV-59HPV-59 HOP14HOP14 AACCATAAAGGACATAGTCCTTGAAGAGCGAACCATAAAGGACATAGTCCTTGAAGAGCG 서열번호 14SEQ ID NO: 14 HPV-61HPV-61 HOP15HOP15 CAACGTTGCAAGAGGTTATATTAGAACTTGCCAACGTTGCAAGAGGTTATATTAGAACTTGC 서열번호 15SEQ ID NO: 15 HPV-66HPV-66 HOP16HOP16 AGTGTGTTGGAGACCTCAACGAACGCAAGTGTGTTGGAGACCTCAACGAACGCA 서열번호 16SEQ ID NO: 16 HPV-67HPV-67 HOP17HOP17 ACTAACTATGCATGGACCAAAGCCCACCGACTAACTATGCATGGACCAAAGCCCACCG 서열번호 17SEQ ID NO: 17 HPV-68HPV-68 HOP18HOP18 CGGTCGACCTTGTATGTCACGAGCAATTAGACGGTCGACCTTGTATGTCACGAGCAATTAGA 서열번호 18SEQ ID NO: 18 HPV-70HPV-70 HOP19HOP19 AGGCGATATAGACAATCAGTATATGGCACTAGGCGATATAGACAATCAGTATATGGCACT 서열번호 19SEQ ID NO: 19 HPV-73HPV-73 HOP20HOP20 AGGTAAAACATATACTAACCAAGGCGCGGAGGTAAAACATATACTAACCAAGGCGCGG 서열번호 20SEQ ID NO: 20 HPV-6b HPV-6b HOP21HOP21 TTACCTGTGTCACAAGCCGTTGTGTGAAATTACCTGTGTCACAAGCCGTTGTGTGAAA 서열번호 21SEQ ID NO: 21 HPV-11HPV-11 HOP22HOP22 CGACAACGTGCGACACACCGCCGGTTCGACAACGTGCGACACACCGCCGGTT 서열번호 22SEQ ID NO: 22 HPV-32HPV-32 HOP23HOP23 TAGAAGATATAACCAATCAGTGTATGGACGGTAGAAGATATAACCAATCAGTGTATGGACGG 서열번호 23SEQ ID NO: 23 HPV-34HPV-34 HOP24HOP24 CTGCACCCTGAACCTGTATGTCTAAACTCTGCACCCTGAACCTGTATGTCTAAACT 서열번호 24SEQ ID NO: 24 HPV-40HPV-40 HOP25HOP25 CTACCCTAAAGGACATTGTTTTGTTTGACATACTACCCTAAAGGACATTGTTTTGTTTGACATA 서열번호 25SEQ ID NO: 25 HPV-42HPV-42 HOP26HOP26 CATGGAAAAAAGCCGACGATCAGAGACTATGCATGGAAAAAAGCCGACGATCAGAGACTATG 서열번호 26SEQ ID NO: 26 HPV-43HPV-43 HOP27HOP27 GAAACAAATAAGTCAATTCTGGACGTGCTGGAAACAAATAAGTCAATTCTGGACGTGCTG 서열번호 27SEQ ID NO: 27 HPV-44HPV-44 PCPC AACCTGCCAATATGATAACATCAAGAAGGAACCTGCCAATATGATAACATCAAGAAGG 서열번호 28SEQ ID NO: 28 GAPDHGAPDH

(3) 선별된 유형 특이적 프로브 합성(3) Selected Type Specific Probe Synthesis

상기 과정에서 선별된 27조의 유형 특이적 프로브들은 5` 말단에 9개의 구아닌기를 포함하여 하기와 같은 과정을 통하여 합성되었다. Twenty-seven sets of type-specific probes selected in the above process were synthesized by the following process including nine guanine groups at the 5 ′ end.

상기 프로브는 올리고 뉴클레오티드 포스포르아미다이트 합성화학에 근거한 고체상 합성기법을 탑재하고 있는 ExpediteTM 8909 핵산 합성기(ABI 사)를 이용하여 합성하였다. 우선, 합성반응은 올리고뉴클레오티드 3' 말단에 위치한 뉴클레오사이드를 고정시킨 CPG 컬럼에서 수행하였으며, 기본적으로 디트리틸레이션(detritylation), 커플링(coupling), 캡핑(capping) 및 산화(oxidation) 반응을 반복주기로 하여 선별된 프라이머의 올리고뉴클레오티드 중합반응을 행하였다. 합성 종료 후 30% 암모니아수를 CPG 컬럼에 가하여 상기 올리고머를 격리시킨 다음 55℃에서 12시간 이상 탈보호(deprotection)시켜 고속진공(Speed Vac.)으로 농축 건조하였으며 다시 역상액체크로마토그래피 및 음이온교환 크로마토그래피를 행하여 순수 정제하였다. 최종 정제된 올리고머는 260nm에서 흡광도를 측정하여 정량하였다.The probe was synthesized using an Expedite ™ 8909 nucleic acid synthesizer (ABI) equipped with a solid phase synthesis technique based on oligonucleotide phosphoramidite synthesis chemistry. First, the synthesis reaction was carried out on a CPG column immobilized with nucleosides located at the 3 'end of the oligonucleotide, and basically detritylation, coupling, capping and oxidation reactions. The oligonucleotide polymerization reaction of the selected primers was carried out in a repeating cycle. After completion of the synthesis, 30% ammonia water was added to the CPG column to isolate the oligomer, and then deprotected at 55 ° C. for at least 12 hours, concentrated to dryness by Speed Vac., And then reversed phase liquid chromatography and anion exchange chromatography. Pure water purification was carried out. The final purified oligomer was quantified by measuring absorbance at 260 nm.

(4) HPV 올리고뉴클레오티드의 고정(4) fixation of HPV oligonucleotides

상기에서 합성된 올리고뉴클레오티드 프로브는 하기 방법을 이용하여 DNA 칩 상에 고정하였다. 우선, 5' 말단이 다수의 구아닌 염기로 변형된 채로 합성된 올리고 뉴클레오티드 프로브를 2X SSC(0.05M sodium citrate, 0.45M NaCl)에 100pmol/ul이 되도록 녹인 후 5' 말단에 첨가된 구아닌 염기와 반응되는 DNA 칩의 글라스 상에 1ul (54ug/ml)씩 스포팅(spotting)하였다. 이를 위하여 글라스 기판 위에 공유결합을 통하여 아미노캘릭스아렌 유도체가 자기배열되어 있는 BMT Guanine chip™(바이오메트릭스 테크놀로지)를 이용하여 제조사의 지시에 따라 상기 변형된 프로브를 칩 상에 고정하고, 세척 및 건조 작업을 수행하였다. 우선, 상기에서 합성된 27조의 프로브를 각각 60.8ul씩 1.5ml 튜브에 나누어 놓고, BMT Immo mix A-1 119.2 ul씩 혼합한 후 4초간 vortexing하고, 지시 프로브 36.5 ul와 BMT Immo mix A-2 143.5 ul를 1.5ml 튜브에 넣고 혼합한 후 5초간 vortexig 한 다음 384-well plate (Genetix 384-7072)에 6핀용으로 나눠서 30ul씩 넣은 다음, 미리 짜여진 프로그램(HPV-050105)을 실행하여 프로브를 칩 상에 스포팅하였다(온도 23±5℃, 습도 60±5%). 스포팅 완료 후 잘못된 스포팅을 판별하기 위하여 현미경으로 육안검사를 실시한 후 BMT Wa-A-1 용액(500ml)을 사용하여 칩 슬라이드를 스테인 락에 20장씩 끼우고 4회 정도 좌우로 흔든 후, 23±5℃에서 1분간 방치하는 1차 세척하고, 스테인 락을 BMT Wa-A-2 용액(500ml)으로 옮겨 4회 좌우로 흔든 후 1분간 방치하는 2차 세척과, 칩 슬라이드를 wash bottle에 넣고 거품이 완전히 제거될 때까지 칩 유리판을 세척하는 3차 세척 작업이 수행되었다. 세척이 끝난 슬라이드는 blocking을 위한 BMT D-Bsa™ 용액에 넣고 좌우로 4회 흔든 후 상온(23±5℃)에서 30분간 방치하고, 표면 처리를 위하여 3회의 세척 작업을 반복하였다. 세척 작업이 완료된 후 air-compressor(air maker NCC035CC)를 이용하여 10-15 psi로 자동 건조시킨 후 건조된 슬라이드에 실리콘 well-sealer를 부착하고 최종 품질관리를 거쳐 플라스틱 케이스에 넣고 진공 포장하여 보관하였다.The oligonucleotide probe synthesized above was immobilized on a DNA chip using the following method. First, the oligonucleotide probe synthesized with the 5 'end modified with a plurality of guanine bases was dissolved in 2X SSC (0.05 M sodium citrate, 0.45 M NaCl) to 100 pmol / ul and then reacted with the guanine base added at the 5' end. 1 ul (54 ug / ml) was spotted on the glass of the DNA chip. To this end, using the BMT Guanine chip ™ (Biometrics Technology) in which aminocalixarene derivatives are self-aligned through covalent bonds on a glass substrate, the modified probes are fixed on the chip according to the manufacturer's instructions, washed and dried. Work was performed. First, each of the 27 sets of probes synthesized above was divided into 1.5 ml tubes of 60.8 ul each, mixed with 119.2 ul of BMT Immo mix A-1 and vortexed for 4 seconds, and 36.5 ul of the indicated probes and BMT Immo mix A-2 143.5 Put the ul into a 1.5 ml tube, mix, vortexig for 5 seconds, divide the 6-pin into 384-well plates (Genetix 384-7072) for 6 pins, and run the pre-woven program (HPV-050105) to place the probe on the chip. Spotted (temperature 23 ± 5 ° C., humidity 60 ± 5%). After spotting was completed, visual inspection was performed under a microscope to determine the spotting, and then 20 chip slides were placed in a stain lock using BMT Wa-A-1 solution (500ml) and shaken from side to side about 4 times. After washing for 1 minute at 1 ℃, transfer the stain lock to BMT Wa-A-2 solution (500ml) and shake it from side to side 4 times. A third wash operation was performed to clean the chip glass plate until it was completely removed. The washed slides were placed in a BMT D-Bsa ™ solution for blocking, shaken from side to side four times, left at room temperature (23 ± 5 ° C.) for 30 minutes, and repeated three washing operations for surface treatment. After cleaning, air-compressor (air maker NCC035CC) was used to automatically dry to 10-15 psi, and then the silicone well-sealer was attached to the dried slides, and finally placed in a plastic case and vacuum-packed after the final quality control. .

한편, 본 실시예에서는 상기 프로브와 대상 DNA의 증폭 산물과의 위치를 확인할 수 있도록 포지티브 컨트롤(positive control)로서, 서열번호 28(5'-AACCTGCCAATATGATAACA TCAAGAAGG-3')로 구성되는 올리고 뉴클레오티드를 기술한 것과 같이 5' 말단에 구아닌 염기를 첨가하여 변형시킨 후에 동일한 절차에 따라 글라스 상에 스포팅 하였다. 이어서, 상기 스포팅한 것을 습식 반응용기 (humid chamber)에 넣고 상온에서 2시간동안 반응시켜 고정하였다.Meanwhile, in the present embodiment, oligonucleotide consisting of SEQ ID NO: 28 (5'-AACCTGCCAATATGATAACA TCAAGAAGG-3 ') is described as a positive control so that the position of the probe and the amplification product of the target DNA can be identified. As modified by the addition of guanine base at the 5 'end as spotted on the glass following the same procedure. Then, the spotted was placed in a wet chamber (humid chamber) and the reaction was fixed at room temperature for 2 hours.

상기 반응종료 후 슬라이드를 0.2% 소디움 도데실설페이트(sodium dodecyl sulfate, SDS) 용액에서 1분간 힘차게 세척한 후 3차 증류수로 옮겨 1분간 세척하고 NaBH4 용액(0.1g NaBH4, 30ml phosphate buffered saline (PBS), 10ml ethanol)에서 5분간 환원시킨 후 다시 3차 증류수에 1분간 세척하고 건조 후 사용할 때까지 상온의 암실에 보관하였다. After completion of the reaction, the slides were washed vigorously in 0.2% sodium dodecyl sulfate (SDS) solution for 1 minute, transferred to tertiary distilled water for 1 minute, and washed with NaBH 4 solution (0.1 g NaBH4, 30ml phosphate buffered saline (PBS). ), 10ml ethanol) was reduced for 5 minutes, washed again in distilled water 3 minutes for 1 minute, dried and stored in a dark room at room temperature until use.

실시예 2Example 2

본 실시예에서는 상기 실시예 1에서 제조된 키트를 사용하여 HPV-16 감염 세포주인 CaSki(ATCC CRL-1550), HPV-18 감염 세포주인 HeLa(ATCC CCL-2) 및 HPV 비감염 세포주인 K562(KCLB-10243, Korean Cell Line Bank)를 대상으로 하이브리디제이션 여부를 실시하였다. In the present example, the kit prepared in Example 1 was used to make HPS-16 infected cell line CaSki (ATCC CRL-1550), HPV-18 infected cell line HeLa (ATCC CCL-2) and HPV uninfected cell line K562 (KCLB). -10243, Korean Cell Line Bank).

(1) 세포주 정제(1) cell line purification

Caski와 HeLa는 제조사의 지시에 따라 배양한 다음 Dulbecco's phosphate-buffered saline(Gibco 사)로 1회 세척한 후, 현미경상에서 세포수를 계측한 다음 2×106 세포를 게놈 DNA 분리 키트(Genomic DNA isolation Kit, Cat. No. K-3032, Bioneer 사)를 이용하여 분리 정제하고 최종적으로 200 ㎕의 증류수(DW)에 녹여 주형 DNA 용액으로 활용하였다. Caski and HeLa were incubated according to the manufacturer's instructions and washed once with Dulbecco's phosphate-buffered saline (Gibco), followed by cell count under a microscope, and 2 × 10 6 cells isolated from the genomic DNA isolation kit (Genomic DNA isolation). Kit, Cat.No. K-3032, Bioneer Co., Ltd.) was isolated and purified and finally dissolved in 200 μl of distilled water (DW) was used as a template DNA solution.

(2) 중합효소연쇄반응(2) polymerase chain reaction

HPV 감염 여부를 검출하기 위한 PCR 반응 용액의 조성은 슈퍼바이오(SuperBio) 사로부터 구입한 10×버퍼 2.5 ㎕, 10 mM MgCl2 3.75 ㎕, 10 mM dNTP 0.5 ㎕, Taq 중합효소 0.5 ㎕(1 unti)를 사용하였으며, 사용되는 프라이머는 Cy3가 결합되어 있는 하기 프라이머 세트를 각각 1 ㎕(40 pmoles), 증류수 5.2 ㎕, 및 상기에서 정제된 Caski, HeLa 및 K562 세포주의 주형 DNA 각각 8.0 ㎕로 구성된 반응액을 총 50 ㎕로 조정하였다. The composition of the PCR reaction solution for detecting HPV infection was 10 μl buffer, 2.5 μl, 10 mM MgCl 2, 3.75 μl, 10 mM dNTP 0.5 μl, Taq polymerase 0.5 μl (1 unti) purchased from SuperBio. The primer used was a reaction solution consisting of 1 μl (40 pmoles) of Cy3 bound primers, 5.2 μl of distilled water, and 8.0 μl of template DNA of the Caski, HeLa, and K562 cell lines purified above. Was adjusted to 50 μl total.

표 1. 설계된 프라이머 서열Table 1. Designed Primer Sequences

프라이머primer 서열order 서열번호SEQ ID NO: HPC-F1* HPC-F1 * 5'- TAA GGG AGT AAC CGA AAA CGG -3'5'- TAA GGG AGT AAC CGA AAA CGG -3 ' 서열번호 29SEQ ID NO: 29 HPC-F2* HPC-F2 * 5'- AGA CTG TAC GAC CGA AAA CGG -3'5'- AGA CTG TAC GAC CGA AAA CGG -3 ' 서열번호 30SEQ ID NO: 30 HPC-F3* HPC-F3 * 5'- GTA GGG TAA GAC CGA AAA CGG -3'5'- GTA GGG TAA GAC CGA AAA CGG -3 ' 서열번호 31SEQ ID NO: 31 HPC-R1** HPC-R1 ** 5'- TCC TCC TCA TCC TCT GAG CTG T -3'5'- TCC TCC TCA TCC TCT GAG CTG T -3 ' 서열번호 32SEQ ID NO: 32 HPC-R2** HPC-R2 ** 5'- TCA CAA CAT TGT GTG ACG CTG T -3'5'- TCA CAA CAT TGT GTG ACG CTG T -3 ' 서열번호 33SEQ ID NO: 33 HPC-R3** HPC-R3 ** 5'- TCA TCA TCT TCA TCT GAG GTG T -3'5'- TCA TCA TCT TCA TCT GAG GTG T -3 ' 서열번호 34SEQ ID NO: 34

*: 정방향 프라이머 * : Forward primer

**: 역방향 프라이머 ** : reverse primer

PCR 사이클은 최초 94℃에서 5분간 예비 가열한 후 94℃에서 1분, 53℃에서 1분, 그리고 72℃에서 1분간의 사이클을 총 40회 반복한 후 최종적으로 72℃에서 5분간 가열한 후 종료하였으며, 최종 반응액 5 ㎕를 DNA 사이즈 스탠더드 마커와 합게 2% 아가로스 겔에 부과하여 전기영동하였다.The PCR cycle was preheated at 94 ° C. for 5 minutes, followed by 40 cycles of 1 minute at 94 ° C., 1 minute at 53 ° C., and 1 minute at 72 ° C., followed by heating at 72 ° C. for 5 minutes. 5 μl of the final reaction solution was added to a 2% agarose gel in combination with a DNA size standard marker, followed by electrophoresis.

(3) 하이브리디제이션(Hybridization)(3) Hybridization

본 실시예에서 사용된 세포주 DNA와 합성된 총 27조의 올리고 뉴클레오티드 프로브를 고정시킨 슬라이드 기판에 PCR에 의하여 증폭된 PCR 증폭 산물을 이용하여 교잡반응을 실시하였다. 교잡 반응실(Hybridization reaction chamber)은 100 ㎕ 용량의 커버슬립(GRACE Bio-Labs, USA)을 사용하였다. A hybridization reaction was carried out using a PCR amplification product amplified by PCR on a slide substrate on which a total of 27 sets of oligonucleotide probes synthesized with the cell line DNA used in this example were immobilized. A hybridization reaction chamber (Hybridization reaction chamber) was used for 100 μl capslips (GRACE Bio-Labs, USA).

상기에서 얻어진 5 ㎕의 증폭산물을 95℃에서 5분간 변성시킨 후 즉시 얼음에 3분간 방치한 다음 교잡 반응 용액으로 20X SSC 18 ㎕, 90% 글리세롤 50 ㎕, 50 mM 인산 버퍼 15.65 ㎕, 0.1% SDS 1.35 ㎕를 첨가하여 최종 용량을 90 ㎕로 조정한 후에 51℃에서 슬라이드 상에 고정된 프로브와 10분간 반응시켰다.5 μl of the amplified product obtained above was denatured at 95 ° C. for 5 minutes and immediately left for 3 minutes on ice. Then, 18 μl of 20X SSC, 50 μl of 90% glycerol, 15.65 μl of 50 mM phosphate buffer, 0.1% SDS as a hybridization reaction solution. The final dose was adjusted to 90 μl by addition of 1.35 μl followed by reaction for 10 minutes with the probe immobilized on the slide at 51 ° C.

교잡반응 종료 후 chip을 2X SSC/0.1% SDS 용액에 담근 후 30℃에서 2분간 세척한 후 4X SSC 용액으로 상온에서 1분간 세척한 다음 well을 제거하고 EtOH로 상온에서 짧게 세척한 다음 0.1X SSC 용액으로 한번 더 세척 후 건조시켰다. 건조된 슬라이드는 콘포칼 레이저 스캐너(confocal laser scanner, GMS 418 Array Scanner TaKaRa)를 이용하여 형광신호를 분석하였다.After the completion of the hybridization reaction, the chip was immersed in 2X SSC / 0.1% SDS solution, washed for 2 minutes at 30 ℃, and then washed for 1 minute at room temperature with 4X SSC solution, then wells were removed and washed briefly at room temperature with EtOH, and then 0.1X SSC. The solution was washed once more and dried. The dried slides were analyzed for fluorescent signals using a confocal laser scanner (GMS 418 Array Scanner TaKaRa).

도 1a 내지 도 1c는 각각 본 실시예에 따라 HPV-16 감염 세포주인 Caski, HPV-18 감염 세포주인 HeLa 및 HPV 비감염 세포주인 K562를 대상으로 본 발명에서 합성된 총 27조의 프로브를 이용하여 DNA 칩 분석을 실시한 사진 및 그 해석 결과이다. 각각의 도면에서 원은 프로브의 종류에 따른 위치를 나타내며, 각각의 숫자는 본 발명에서 사용된 5' 말단에 구아닌 염기가 추가된 프로브의 종류에 따라 증폭되는 HPV 유형을 표시한 것이다. 즉, 16은 HOP1 프로브, 18은 HOP2 프로브, 31은 HOP3 프로브, 33은 HOP4 프로브, 35는 HOP5 프로브, 39는 HOP6 프로브, 45는 HOP7 프로브, 51은 HOP8 프로브의 각 5' 말단을 구아닌으로 변형시킨 프로브를 사용하였음을 표시한 것이다. 한편, PC는 각각의 변형된 프로브의 위치를 확인하기 위하여 사용된 포지티브 컨트롤(positive control)이다. 1A to 1C show DNA chips using a total of 27 trillion probes synthesized in the present invention targeting the HPV-16 infected cell line Caski, HPV-18 infected cell line HeLa, and HPV uninfected cell line K562, respectively. It is the photograph which analyzed and the analysis result. Circles in each figure indicate the position according to the type of probe, and each number indicates the type of HPV amplified according to the type of probe to which the guanine base is added at the 5 'end used in the present invention. That is, 16 is a HOP1 probe, 18 is a HOP2 probe, 31 is a HOP3 probe, 33 is a HOP4 probe, 35 is a HOP5 probe, 39 is a HOP6 probe, 45 is a HOP7 probe, and 51 is a 5'-end of each HOP8 probe. This indicates that the probe was used. On the other hand, the PC is a positive control used to confirm the position of each modified probe.

도면에서 알 수 있는 바와 같이, HPV-16 감염 세포주인 CaSki를 표적 DNA로 사용하면 본 발명에서 합성된 HOP1 프로브가 스포팅 된 영역에서만 특이적으로 교차-하이브리디제이션 반응이 일어났고(도 1a), HPV-18 감염 세포주인 HeLa를 표적 DNA로 사용하면 본 발명에서 합성된 HOP2 프로브가 스포팅 된 영역에 대해서만 특이적으로 교차-하이브리디제이션 반응이 일어났으며(도 1b), HPV 비감염 세포주인 K-562에 대해서는 본 발명에서 합성된 프로브와 아무런 교차-하이브리디제이션 반응이 일어나지 않았음을 확인하였다. 즉, HPV-16 감염 세포주와 HPV-18 감염 세포주에 대해서 특이적으로 결합하는 것으로 확인된 프로브의 5' 말단을 변형시킨 프로브에 대해서만 하이브리디제이션 반응이 일어났다. As can be seen in the figure, using the HPV-16 infected cell line CaSki as the target DNA, the specific cross-hybridization reaction occurred only in the region where the HOP1 probe synthesized in the present invention was spotted (FIG. 1A). When using HeLa, an HPV-18 infected cell line, as a target DNA, a cross-hybridization reaction was specifically generated only for the region where the HOP2 probe synthesized in the present invention was spotted (FIG. 1B). For 562, no cross-hybridization reaction with the probe synthesized in the present invention was confirmed. That is, hybridization reactions occurred only to the probes modified at the 5 'end of the probes found to specifically bind to the HPV-16 infected cell line and the HPV-18 infected cell line.

실시예 3Example 3

본 실시예에서는 상기 실시예 2를 통하여 확인된 HPV 특이적 프로브가 고정된 진단 키트를 사용하여 보다 다양한 유형의 HPV 세포주를 대상으로 하이브리디제이션 여부를 확인하였다. 즉, 본 실시에에서는 종양원성 HPV 유형의 플라스미드를 포함하고 있는 E.coli 균주는 물론이고 비종양원성 HPV 유형의 플라스미드 DNA를 함유하고 있는 E.coli 균주를 대상으로 DNA 칩을 이용한 키트에서의 하이브리디제이션 여부를 확인하였다. In this example, using a diagnostic kit in which the HPV-specific probe identified in Example 2 was immobilized, it was confirmed whether hybridization was performed on more various types of HPV cell lines. In other words, in the present embodiment, a hive in a kit using a DNA chip may be used for E. coli strains containing non-tumorogenic HPV type plasmid DNA as well as E. coli strains containing oncogenic HPV type plasmids. It was checked whether or not re-edification.

본 실시예에서 사용된 E.coli 균주는 다음과 같다. E. coli strains used in this example are as follows.

HPV-2a (ATCC 45022);HPV-2a (ATCC 45022);

HPV-6b (ATCC 45150);HPV-6b (ATCC 45150);

HPV-11 (ATCC 45151);HPV-11 (ATCC 45151);

HPV-16 (ATCC 45113);HPV-16 (ATCC 45113);

HPV-18 (ATCC 45152);HPV-18 (ATCC 45152);

HPV-31 (ATCC 65446);HPV-31 (ATCC 65446);

HPV-35 (ATCC 40331);HPV-35 (ATCC 40331);

HPV-43 (ATCC 40338);HPV-43 (ATCC 40338);

HPV-44 (ATCC 40353);HPV-44 (ATCC 40353);

HPV-56 (ATCC 40549)HPV-56 (ATCC 40549)

각각의 E. coli 균주는 37℃ LB 액체 배지에서 16 시간 동안 진탕 배양한 후 Qiafilter Plasmid Maxi Kit(Cat. No. 12263, QIAGEN 사)로 분리 정제하여 10 ng/㎕로 농도 조정하여 주형 DNA 용액으로 활용하였다. 이어서, 상기 실시예 2에서와 동일한 절차에 따라 본 실시예에서 사용된 균주의 DNA를 PCR 증폭한 뒤, 하이브리디제이션 여부를 확인하였다. Each strain of E. coli was shaken for 16 hours in 37 ° C. LB liquid medium, separated and purified with Qiafilter Plasmid Maxi Kit (Cat. No. 12263, QIAGEN), and adjusted to 10 ng / μl. Utilized. Subsequently, PCR amplification of the DNA of the strain used in this example was carried out according to the same procedure as in Example 2, and then hybridization was confirmed.

도 2a 내지 도 2j는 각각 본 실시예에서 사용된 HPV 감염 플라스미드 DNA를 주형 DNA를 대상으로 본 발명에서 합성한 27조의 변형된 프로브를 사용하여 하이브리디제이션 반응을 실시한 사진 및 그 해석 결과이다. 각각의 도면에서 원은 프로브의 종류에 따른 위치를 나타내며, 각각의 숫자는 본 발명에서 사용된 5' 말단에 구아닌 염기가 추가된 프로브의 종류에 따라 증폭되는 HPV 유형을 표시한 것이고, PC는 변형된 프로브의 위치를 확인하기 위하여 사용된 포지티브 컨트롤(positive control)이다. 2A to 2J are photographs and analysis results of hybridization reactions using the HPV infected plasmid DNA used in this example using a set of 27 modified probes synthesized in the present invention on template DNA. In each figure, the circle indicates the position according to the type of probe, and each number indicates the type of HPV amplified according to the type of probe to which the guanine base is added at the 5 'end used in the present invention, and the PC is modified. Positive control used to identify the position of the probe.

도 2a는 HPV-16 DNA를 함유하고 있는 ATCC 45113 균주, 도 2b는 HPV-18 DNA를 함유하고 있는 ATCC 45152 균주, 도 2c는 HPV-31 DNA를 함유하고 있는 ATCC 65446 균주, 도 2d는 HPV-35 DNA를 함유하고 있는 ATCC 40331 균주, 도 2e는 HPV-43 DNA를 함유하고 있는 ATCC 40338 균주, 도 2f는 HPV-44 DNA를 함유하고 있는 ATCC 40353 균주, 도 2g는 HPV-56 DNA를 함유하고 있는 ATCC 40549 균주, 도 2h는 HPV-6b DNA를 함유하고 있는 ATCC 45150 균주, 도 2i는 HPV 11 DNA를 함유하고 있는 ATCC 45151 균주, 도 2j는 HPV 2a DNA를 함유하고 있는 ATCC 45022 균주로부터 얻어진 DNA를 대상 DNA로 한 것이다.Figure 2a shows the ATCC 45113 strain containing HPV-16 DNA, Figure 2b shows the ATCC 45152 strain containing HPV-18 DNA, Figure 2c shows the ATCC 65446 strain containing HPV-31 DNA, Figure 2d shows the HPV- ATCC 40331 strain containing 35 DNA, FIG. 2E shows ATCC 40338 strain containing HPV-43 DNA, FIG. 2F shows ATCC 40353 strain containing HPV-44 DNA, FIG. 2G contains HPV-56 DNA ATCC 40549 strain, FIG. 2H shows ATCC 45150 strain containing HPV-6b DNA, FIG. 2I shows ATCC 45151 strain containing HPV 11 DNA, FIG. 2J shows DNA obtained from ATCC 45022 strain containing HPV 2a DNA Is the target DNA.

도면에서 분명히 알 수 있는 것과 같이, HPV-16 DNA를 함유하고 있는 ATCC 45113 균주에 대해서는 HPV-16 DNA와 특이적으로 결합하는 HOP1 프로브가 스포팅된 영역에서만 하이브리디제이션이 일어났으며(도 2a), HPV-18 DNA를 함유하고 있는 ATCC 45152 균주에 대해서는 HPV-18 DNA와 특이적으로 결합하는 HOP2 프로브가 스포팅된 영역에서만 하이브리디제이션이 일어났으며(도 2b), HPV-31 DNA를 함유하고 있는 ATCC 65446 균주에 대해서는 HPV-31 DNA와 특이적으로 결합하는 HOP3 프로브가 스포팅된 영역에서만 하이브리디제이션이 일어났으며(도 2c), HPV-35 DNA를 함유하고 있는 ATCC 40331 균주에 대해서는 HPV-35 DNA와 특이적으로 결합하는 HOP5 프로브가 스포팅된 영역에 대해서만 하이브리디제이션이 일어났으며(도 2d), HPV-43 DNA를 함유하고 있는 ATCC 40338 균주에 대해서는 HPV-43 DNA와 특이적으로 결합하는 HOP26 프로브가 스포팅된 영역에 대해서만 하이브리디제이션이 일어났으며(도 2e), HPV-44 DNA를 함유하고 있는 ATCC 40353 균주에 대해서는 HPV-44 DNA와 특이적으로 결합하는 HOP27 프로브가 스포팅된 영역에 대해서만 하이브리디제이션이 일어났으며(도 2f), HPV-56 DNA를 함유하고 있는 ATCC 40549 균주에 대해서는 HPV-56 DNA와 특이적으로 결합하는 HOP11 프로브가 스포팅된 영역에 대해서만 하이브리디제이션 반응이 일어났으며(도 2g), HPV-6b DNA를 함유하고 있는 ATCC 45150 균주에 대해서는 HPV-6b DNA와 특이적으로 결합하는 HOP20 프로브가 스포팅된 영역에 대해서만 하이브리디제이션 반응이 일어났고(도 2h), HPV-11 DNA를 함유하고 있는 ATCC 45151 균주에 대해서는 HPV-11 DNA와 특이적으로 결합하는 HOP21 프로브가 스포팅된 영역에 대해서만 하이브리디제이션이 일어났고(도 2i), HPV-2a DNA를 함유하고 있는 ATCC 45022 균주에 대해서는 아무런 교차-하이브리디제이션이 일어나지 않았음을 확인하였다(도 2j).As can be clearly seen in the figure, hybridization occurred only in the region where the HOP1 probe specifically bound to HPV-16 DNA was spotted on the ATCC 45113 strain containing HPV-16 DNA (FIG. 2A). For the ATCC 45152 strain containing HPV-18 DNA, hybridization occurred only in the region where the HOP2 probe specifically binding to HPV-18 DNA was spotted (FIG. 2B), and it contained HPV-31 DNA. Hybridization occurred only in the region where the HOP3 probe specifically binding to HPV-31 DNA was spotted for the ATCC 65446 strain (FIG. 2C), and HPV- for strain ATCC 40331 containing HPV-35 DNA. Hybridization occurred only in the region where the HOP5 probe specifically bound to 35 DNA was spotted (FIG. 2D), and specific to HPV-43 DNA for ATCC 40338 strain containing HPV-43 DNA. Hybridization occurred only in the region to which the binding HOP26 probe was spotted (FIG. 2E), and for the ATCC 40353 strain containing HPV-44 DNA, the HOP27 probe specifically binding to HPV-44 DNA was spotted. Hybridization occurred only for the region (FIG. 2F), and for ATCC 40549 strains containing HPV-56 DNA, hybridization reaction only for the region spotted with HOP11 probe that specifically binds HPV-56 DNA (FIG. 2g), the ATCC 45150 strain containing HPV-6b DNA had hybridization reaction only to the spotted region of the HOP20 probe that specifically binds to HPV-6b DNA (FIG. 2H). ), ATCC 45151 strains containing HPV-11 DNA only hybridized to the region where the HOP21 probe specifically bound to HPV-11 DNA was spotted ( 2i), for the strain ATCC 45022, which contains the HPV-2a DNA no cross was confirmed that no hybridization occurs (Figure 2j).

이러한 결과는 상기 실시예 1에 제시된 표 1의 결과와 일치하는 것임을 확인할 수 있었으며, 본 실시예에서 확인하지 못한 다른 많은 종양원성 HPV 유형에 대해서도 표 1에서와 동일한 결과가 도출될 수 있을 것으로 기대되었다. This result was confirmed to be in agreement with the results of Table 1 presented in Example 1, it was expected that the same results as in Table 1 can be derived for many other oncogenic HPV types not confirmed in this Example .

상기에서는 본 발명의 바람직한 실시예에 대하여 기술하였으나, 본 발명의 정신을 훼손하지 않는 범위 내에서 다양한 변형과 변경이 가능하다는 점은 본 발명이 속하는 분야의 당업자에게는 자명한 사실이라 할 것이다. 또한 그와 같은 변형과 변경은 모두 본 발명의 권리범위에 속한다는 점은 첨부된 청구의 범위를 통하여 보다 분명해질 것이다. In the above description of the preferred embodiment of the present invention, it will be apparent to those skilled in the art that various modifications and changes can be made without departing from the spirit of the present invention. It will also be apparent from the appended claims that such modifications and variations are all within the scope of the present invention.

본 발명에서는 자궁경부암과 밀접한 관련이 있는 종양원성 인유두종바이러스 유형에 특이적으로 결합할 수 있는 유형 특이적 올리고 뉴클레오티드를 변형시킨 프로브를 포함하고 있는 DNA 칩, 즉 올리고 뉴클레오티드 마이크로어레이와 증폭산물에 형광물질이 표지되어 있는 표지수단으로 구성되는 진단키트를 통하여 종양원성 HPV 유형에 감염 여부를 정확하고 신속하게 다량으로 진단할 수 있다. In the present invention, a fluorescent substance in a DNA chip, ie, oligonucleotide microarrays and amplification products, comprising a probe modified with a type-specific oligonucleotide capable of specifically binding to oncogenic human papillomavirus types closely related to cervical cancer. Through the diagnostic kit consisting of the labeled means, it is possible to accurately and quickly diagnose a large amount of tumorigenic HPV types.

더불어, 프로브와 슬라이드 글래스의 결합 및 결합과정을 개선함하여 제조공 정을 단축하고 에러발생을 줄임으로서 HPV 존재여부를 정확하게 검출하고 자궁경부암과의 관련성을 신속하게 예측하여 진단할 수 있는 효과가 있다.In addition, by improving the coupling and bonding process of the probe and the slide glass to reduce the manufacturing process and reduce the occurrence of errors, it is possible to accurately detect the presence of HPV and to quickly predict and diagnose the relationship with cervical cancer.

서열목록 전자파일 첨부 Attach sequence list electronic file

Claims (16)

인유두종바이러스의 유형을 검출하기 위한 올리고 뉴클레오티드로 구성되는 프로브로서, 서열번호 1 내지 2 및 서열번호 4 내지 27로 구성되는 군에서 하나 이상 선택되는 올리고 뉴클레오티드로 구성되는 프로브. A probe consisting of oligonucleotides for detecting the type of human papillomavirus, the probe consisting of at least one oligonucleotide selected from the group consisting of SEQ ID NOs: 1-2 and SEQ ID NOs: 4-27. 제 1항에 있어서,The method of claim 1, 상기 프로브는 자궁경부암의 발병에 관련성이 있는 종양원성 인유두종바이러스의 유형의 DNA와 특이적으로 교잡(Hybridization)되는 것을 특징으로 하는 프로브. Wherein said probe is specifically hybridized with DNA of the type of oncogenic human papillomavirus associated with the development of cervical cancer. 제 1항에 있어서,The method of claim 1, 상기 프로브는 인유두종바이러스의 게놈 서열 중 E6/E7 영역의 DNA 서열에 특이적으로 교잡되는 것을 특징으로 하는 프로브. The probe is specifically hybridized to a DNA sequence of an E6 / E7 region of the genome sequence of human papillomavirus. 제 1항에 있어서, The method of claim 1, 상기 서열번호 1 내지 서열번호 2의 프로브 및 서열번호 4 내지 서열번호 27의 프로브는 각각 HPV-16 유형의 DNA, HPV-18 유형의 DNA, HPV-33 유형의 DNA, HPV-35 유형의 DNA, HPV-39 유형의 DNA, HPV-45 유형의 DNA, HPV-51 유형의 DNA, HPV-52 유형의 DNA, HPV-53 유형의 DNA, HPV-56 유형의 DNA, HPV-58 유형의 DNA, HPV-59 유형의 DNA, HPV-61 유형의 DNA, HPV-66 유형의 DNA, HPV-67 유형의 DNA, HPV-68 유형의 DNA, HPV-70 유형의 DNA, HPV-73 유형의 DNA, HPV-6b 유형의 DNA, HPV-11 유형의 DNA, HPV-32 유형의 DNA, HPV-34 유형의 DNA, HPV-40 유형의 DNA, HPV-42 유형의 DNA, HPV-43 유형의 DNA, HPV-44 유형의 DNA와 특이적으로 결합되는 것을 특징으로 하는 프로브. The probes of SEQ ID NO: 1 to SEQ ID NO: 2 and probes of SEQ ID NO: 4 to SEQ ID NO: 27 are HPV-16 type DNA, HPV-18 type DNA, HPV-33 type DNA, HPV-35 type DNA, HPV-39 type DNA, HPV-45 type DNA, HPV-51 type DNA, HPV-52 type DNA, HPV-53 type DNA, HPV-56 type DNA, HPV-58 type DNA, HPV -59 type DNA, HPV-61 type DNA, HPV-66 type DNA, HPV-67 type DNA, HPV-68 type DNA, HPV-70 type DNA, HPV-73 type DNA, HPV- 6b type DNA, HPV-11 type DNA, HPV-32 type DNA, HPV-34 type DNA, HPV-40 type DNA, HPV-42 type DNA, HPV-43 type DNA, HPV-44 A probe characterized by specifically binding to a type of DNA. 글라스와 공유 결합을 통하여 결합되어 있는 아미노캘릭스아렌 유도체가 배열되어 있는 올리고 뉴클레오티드 DNA 칩으로서, 제 1항 내지 제 4항 중 어느 하나의 항에 기재되어 있는 프로브의 5‘ 말단에 9개의 구아닌 염기가 추가되어 변형된 프로브가 상기 아미노캘릭스아렌 유도체와 수소 결합을 통하여 고정되어 있는 올리고 뉴클레오티드 DNA 칩과; An oligonucleotide DNA chip in which aminocalixarene derivatives are covalently bound to a glass and are arranged, wherein nine guanine bases are located at the 5 'end of the probe according to any one of claims 1 to 4. An oligonucleotide DNA chip in which a modified probe is added and fixed to the aminocalixarene derivative by hydrogen bonding; 상기 프로브와 시료 DNA의 교잡 반응을 탐지할 수 있는 표지수단을 포함하는 인유두종바이러스 유형 진단 키트. Human papillomavirus type diagnostic kit comprising a label means for detecting the hybridization reaction between the probe and the sample DNA. 제 5항에 있어서, The method of claim 5, 상기 표지수단은 형광물질인 것을 특징으로 하는 인유두종바이러스 유형 진단 키트. Human papillomavirus type diagnostic kit, characterized in that the label means is a fluorescent material. 제 5항에 있어서, The method of claim 5, 상기 시료 DNA를 증폭시킬 수 있는 증폭수단을 더욱 포함하는 것을 특징으로 하는 인유두종바이러스 유형 진단 키트. Human papillomavirus type diagnostic kit, characterized in that it further comprises amplification means for amplifying the sample DNA. 제 7항에 있어서, The method of claim 7, wherein 상기 증폭수단은 서열번호 29 내지 서열번호 34로 구성되는 프라이머 세트를 포함하는 인유두종바이러스 유형 진단 키트. The amplification means human papillomavirus type diagnostic kit comprising a primer set consisting of SEQ ID NO: 29 to SEQ ID NO: 34. 제 8항에 있어서,The method of claim 8, 상기 증폭수단은 Cy3 또는 Cy5가 결합된 형광물질을 포함하는 것을 특징으로 하는 인유두종바이러스 유형 진단 키트. The amplification means is human papillomavirus type diagnostic kit, characterized in that it comprises a fluorescent substance bound to Cy3 or Cy5. 제 5항에 있어서, The method of claim 5, 상기 DNA 칩 상의 상기 프로브가 고정되는 영역과 독립적으로 상기 프로브의 위치를 알려주는 포지트브 컨트롤(Positive control)을 더욱 포함하는 것을 특징으로 하는 인유두종바이러스 유형 진단 키트. Human papillomavirus type diagnostic kit, characterized in that it further comprises a positive control (Positive control) to inform the position of the probe independent of the region on which the probe is fixed on the DNA chip. 제 10항에 있어서, The method of claim 10, 상기 포지티브 컨트롤은 5' 말단에 9개의 구아닌 염기가 첨가되어 변형된 서열번호 28로 구성되는 올리고 뉴클레오티드를 포함하는 인유두종바이러스 유형 진단 키트. The positive control is HPV type diagnosis kit comprising an oligonucleotide consisting of SEQ ID NO: 28 modified by the addition of nine guanine bases at the 5 'end. 글라스와 공유결합을 통하여 결합되어 있는 아미노캘릭스아렌 유도체가 배열되어 있는 올리고 뉴클레오티드 DNA 칩을 포함하는 인유두종바이러스 유형 진단 키트의 제조 방법으로서, A method for preparing a human papillomavirus type diagnostic kit comprising an oligonucleotide DNA chip in which aminocalixarene derivatives are covalently bonded to a glass, 제 1항 내지 제 4항 중 어느 하나의 항에 기재되어 있는 프로브의 5' 말단에 9개의 구아닌 염기를 결합시켜 상기 프로브를 변형시키는 단계와;Modifying the probe by binding nine guanine bases to the 5 'end of the probe as described in any one of claims 1 to 4; 상기 구아닌 염기에 의하여 변형된 상기 프로브를 상기 아미노캘릭스아렌 유도체와 수소 결합을 통하여 상기 DNA 칩의 글라스 상에 고정시켜 인유두종바이러스 검출을 위한 DNA 칩을 제조하는 단계를 포함하는 인유두종바이러스 유형 진단 키트의 제조 방법. Fixing the probe modified by the guanine base on the glass of the DNA chip through the hydrogen bond with the aminocalix arene derivative to prepare a DNA chip for the detection of human papillomavirus type of kit Manufacturing method. 제 12항에 있어서, The method of claim 12, 상기 인유두종바이러스 유형 진단 키트는 상기 DNA 칩의 상기 프로브와 시료 DNA의 교잡 반응을 탐지할 수 있는 표지수단을 포함하는 인유두종바이러스 유형 진단 키트의 제조 방법. The human papillomavirus type diagnostic kit comprises a labeling means for detecting a hybridization reaction between the probe of the DNA chip and the sample DNA. 글라스와 공유결합을 통하여 결합되어 있는 아미노캘릭스아렌 유도체가 배열되어 있는 올리고 뉴클레오티드 DNA 칩으로서, An oligonucleotide DNA chip in which aminocalixarene derivatives are covalently bonded to glass is arranged. 제 1항 내지 제 4항 중 어느 하나의 항에 기재되어 있는 프로브의 5' 말단에 9개의 구아닌 염기가 추가되어 변형된 프로브가 상기 아미노캘릭스아렌 유도체와 수소 결합을 통하여 상기 DNA 칩의 글라스 상에 고정되어 있는 인유두종바이러스 유형 분석용 올리고 뉴클레오티드 DNA 칩. 9 guanine base is added to the 5 'end of the probe described in any one of claims 1 to 4 modified by the hydrogen bond with the aminocalixarene derivatives on the glass of the DNA chip Oligonucleotide DNA chip for analysis of human papilloma virus type immobilized on. 제 14항에 있어서,The method of claim 14, 상기 DNA 칩 상의 상기 프로브가 고정되는 영역과 독립되는 영역에 상기 프로브의 위치를 알려주는 포지티브 컨트롤(positive control)을 더욱 포함하는 것을 특징으로 하는 DNA 칩. And a positive control for indicating the position of the probe in a region independent of the region to which the probe is fixed on the DNA chip. 제 15항에 있어서, The method of claim 15, 상기 포지티브 컨트롤은 5' 말단에 9개의 구아닌 염기가 첨가되어 변형된 서열번호 28로 구성되는 올리고 뉴클레오티드를 포함하는 DNA 칩.The positive control is a DNA chip comprising an oligonucleotide consisting of SEQ ID NO: 28 modified by the addition of nine guanine bases at the 5 'end.
KR1020060004165A 2006-01-14 2006-01-14 Kit for Diagnosing HPV Genotypes KR100786637B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020060004165A KR100786637B1 (en) 2006-01-14 2006-01-14 Kit for Diagnosing HPV Genotypes

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020060004165A KR100786637B1 (en) 2006-01-14 2006-01-14 Kit for Diagnosing HPV Genotypes

Publications (2)

Publication Number Publication Date
KR20060015669A KR20060015669A (en) 2006-02-17
KR100786637B1 true KR100786637B1 (en) 2007-12-21

Family

ID=37124172

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020060004165A KR100786637B1 (en) 2006-01-14 2006-01-14 Kit for Diagnosing HPV Genotypes

Country Status (1)

Country Link
KR (1) KR100786637B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100914911B1 (en) * 2007-07-10 2009-08-31 의료법인제일의료재단 Method and kit for detecting human papillomavirus quantitatively and qualitatively using real-time pcr and hpv dna chip

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100818275B1 (en) * 2006-09-26 2008-03-31 삼성전자주식회사 Primer set for amplifying target sequences of Norovirus probe set specifically hybridizable with the target sequences of Norovirus microarray having the immobilized probe set and method for detecting the presence of Norovirus using the probe set
KR100819634B1 (en) * 2006-11-23 2008-04-04 김연수 Novel Oligonucleotide Probes DNA Chip and Detection Kit for Diagnosing Sexual Transmitted Disease and Method of Manufacturing Thereof
KR101462643B1 (en) * 2012-08-27 2014-12-04 (주)다이오진 Dna chip for determining genomic types of human papillomavirus, kit comprising the same and determining method of genomic types of human papillomavirus using the same
KR101951172B1 (en) 2014-11-07 2019-02-22 주식회사 파나진 Pna probes, kits and methods for detecting genotypes of human papillomavirus

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003020976A2 (en) 2001-08-29 2003-03-13 Norchip A/S Oligonucleotides for use in detection of human papillomavirus e7 mrna
KR20050045319A (en) * 2003-11-11 2005-05-17 (주)차웰빙스 Microarray and kit for diagnosing hvp genotypes and method of manufacturing the same

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003020976A2 (en) 2001-08-29 2003-03-13 Norchip A/S Oligonucleotides for use in detection of human papillomavirus e7 mrna
KR20050045319A (en) * 2003-11-11 2005-05-17 (주)차웰빙스 Microarray and kit for diagnosing hvp genotypes and method of manufacturing the same

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100914911B1 (en) * 2007-07-10 2009-08-31 의료법인제일의료재단 Method and kit for detecting human papillomavirus quantitatively and qualitatively using real-time pcr and hpv dna chip

Also Published As

Publication number Publication date
KR20060015669A (en) 2006-02-17

Similar Documents

Publication Publication Date Title
US7393633B1 (en) Genotyping kit for diagnosis of human papillomavirus infection
KR100633525B1 (en) Probe Of Human Papillomavirus Oligonucleotide Microarray And Genotyping Kit Comprising The Same And Genotyping Method For Human Papillomavirus Using The Same
US7301015B2 (en) Genotyping kit for diagnosis of human papilloma virus infection
US7670774B2 (en) Probe of human papillomavirus and DNA chip comprising the same
US20070031826A1 (en) Diagnostic kit for determining the genotype of a human papilloma virus and method of using thereof
KR100786637B1 (en) Kit for Diagnosing HPV Genotypes
KR100914911B1 (en) Method and kit for detecting human papillomavirus quantitatively and qualitatively using real-time pcr and hpv dna chip
US20100285485A1 (en) Primer, probe, dna chip containing the same and method for detecting human papillomavirus and detection kit thereof
KR100589508B1 (en) Microarray and Kit for Diagnosing HVP Genotypes and Method of Manufacturing the Same
Delrio-Lafreniere et al. Low-density addressable array for the detection and typing of the human papillomavirus
KR100645257B1 (en) Novel Oligonucleotide Probes DNA Chip and Detection Kit for Diagnosing HPV Genotypes and Method of Manufacturing Thereof
KR100645253B1 (en) .Type-Specific Oligonucleotide Primers and Methods for Determining of Human Papillomavirus Genotypes by PCR
KR20090129639A (en) Probe for detecting hpv and genotyping method thereof
KR100645259B1 (en) Type-specific Oligonucleotide Probes DNA Chip and Detection Kit for Diagnosing HPV Genotypes and Method of Manufacturing Thereof
WO2004050917A1 (en) General primers and process for detecting diverse genotypes of human papillomavirus by pcr
KR101462643B1 (en) Dna chip for determining genomic types of human papillomavirus, kit comprising the same and determining method of genomic types of human papillomavirus using the same
KR100576610B1 (en) Primers and Method for Detecting High Risk Human Papillomavirus by PCR
KR100452103B1 (en) Primers and Method for Detecting Oncogenic Human Papillomavirus by PCR
KR100564215B1 (en) Novel PCR General Primers and Method for Detecting Diverse Types of Human Papillomavirus by PCR in Genital
JP3600616B2 (en) Primer set for detecting human papilloma virus, detection method, and DNA array for detection
KR100584700B1 (en) Novel Type-Specific Primers and Method for Detecting and Typing of Human Papillomavirus Genotypes by Multiplex-PCR
KR100539342B1 (en) Method for Detecting Diverse Types of Human Papillomavirus by Nested-PCR
KR100491842B1 (en) Novel PCR General Primers and Method for Detecting Various Type of Human Papillomavirus by PCR
KR100616548B1 (en) Novel PCR General Primers and Method for Detecting Diverse Types of Human Papillomavirus by PCR
KR20090093035A (en) Oligonucleotide Primers and Method for Detecting Human Papillomavirus Nucleic Acids by Multiplex-PCR

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20111212

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20121210

Year of fee payment: 6

LAPS Lapse due to unpaid annual fee