KR20050045319A - Microarray and kit for diagnosing hvp genotypes and method of manufacturing the same - Google Patents

Abstract

In the present invention, a DNA chip using a probe for detecting a type specific human papillomavirus and a human papillomavirus type diagnosis kit including the DNA chip are provided. The human papillomavirus type diagnostic kit according to the present invention can be used to quickly detect and diagnose tumorigenic human papillomavirus infection, which is closely related to the generation and progression of cervical cancer, especially in women.

Description

Microarray and Kit for Diagnosing HVP Genotypes and Method of Manufacturing the Same}

The present invention relates to a diagnostic kit capable of detecting a type of human papillomavirus (hereinafter referred to as "HPV") and a method of manufacturing the same, and more particularly to a specific type of HPV associated with cervical cancer. The present invention relates to an oligonucleotide probe that can be used, and an HPV type diagnostic kit using DNA microarray technology capable of rapidly detecting and diagnosing HPV type using the probe, and a method of manufacturing the same.

Cervical cancer is a malignant tumor occurring in the cervix, accounting for more than 95% of all uterine cancers, and the highest incidence of cancer among women in the world after breast cancer. About 440,000 new cases are reported each year. In the developing world, the most common female cancer is about 300,000 people die of cervical cancer each year. In Korea, the Ministry of Health and Welfare Cancer Registration Survey 2000 reported that about 5,000 new cases occur every year. For women, cervical cancer (10.6%) was 3803 cases, which ranked third after gastric cancer (15.8%) and breast cancer (15.1%) in the long-term incidence of teenage cancers, especially recently among young women in their 20s and 30s. The number has risen sharply, accounting for 32% of all patients, making it a serious health problem.

Cervical cancer usually develops after HPV infections of cervical epithelial basal cells, followed by prolonged prognostic stages such as low squamous intraepithelial lesions (LSIL), high squamous intraepithelial lesions (HSIL), and epithelial cancer. It develops into invasive cancer, and since there are precancerous stages before the cancer develops, cervical cancer can be prevented by early diagnosis and treatment of these lesions early and effectively.

To date, studies of cervical cancer have revealed that HPV (about 8 kb of double-stranded circular DNA virus), which is infected by sexual contact, is a major factor. In the genome of HPV, there are E1 to E7 genes involved in the initial process after infection with the host cell, and L1 and L2 genes involved in the late process, and in particular, the E6 and E7 proteins, the viral carcinogen products of HPV, respectively. It is confirmed that cancer is caused by binding the tumor suppressor proteins p53 and pRb to discard the functions of these tumor suppressor proteins.

More than 120 different types have been discovered to date based on differences in the open reading frame of the E6, E7 and L1 genes in the HPV genome sequences. Among these HPV types, HPV types that infect the genitals include HPV-16, -31, -33, -35, -52, -58, -67, -40, -43, -7, -32,- 42, -6, -11, -74, -44, -55, -13, -61, -72, -62, -2, -27, -57, -3, -28, -29, -10, -54, -18, -39, -45, -59, -68, -70, -26, -69, -51, -30, -53, -56, -66, -34, -64 and -73 Among these, HPV-16, -18, -26, -30, -31, -33, -35,-belonging to the high-risk group are among the HPV types that are closely related to cervical cancer. 22 types of low risk groups (39, -45, -51, -52, -53, -56, -57, -58, -59, -61, -67, -68, -70, and -73, -74) low-risk group), HPV-2a, -3, -6, -10, -11, -32, -34, -40, -42, -43, -44. Types 15 of -54, -55, -66 and -69 are closely related to the progression of cervical cancer.

As such, the type of infected HPV may have a significant impact on the future progression of cancer, and thus, by accurately identifying the presence and type of HPV in the sample, it may have important significance in the prognosis and diagnosis of cervical cancer patients. Can be.

Currently, Pappanicolaou (Pap) smear based on the cytological morphology of cervical papules for the primary screening of cervical cancer and progenitor lesions has been performed as a standard test since the 1940s, greatly reducing mortality from cervical cancer. Although he has been in charge of it, he still reports a high false negative rate of 30-40%.

On the other hand, the method for analyzing the presence and type of HPV through molecular biological means can be largely the method of directly identifying the HPV DNA and the method using amplification of HPV DNA, Southern direct method of HPV DNA Blots, dot blots and filter in situ methods are used. In particular, US Pat. No. 6,221,581 discloses a liquid hybridization method (Hybrid Hybridization II) which detects a liquid complementary bond between a target DNA and an RNA probe through an antibody enzymatic color reaction. The Hybrid Capture II method allows for adjuvant screening or follow-up of cervical cancer and its precursor lesions. However, since the method uses an RNA probe, there is a problem that the stability is low and the possibility of contamination cannot be excluded.

As a method using DNA amplification, PCR techniques are widely used to identify various types of HPV infections and to identify their types. The methods using these methods include type-specific polymerase chain reaction (PCR) and general primer PCR (general-type). primer PCR). However, these analytical methods have some problems in detection sensitivity and data interpretation.

Recently, a combination of molecular biology and electronics technology has led to the development of DNA chips (DNA chips, DNA microarrays) that can simultaneously test tens to tens of thousands of genes on a single microscope slide. This DNA chip is a new level of analysis system that can be widely applied for gene expression analysis, gene diagnosis, gene mutation, pharmaceutical screen and disease diagnosis. Therefore, the identification of HPV type using this has enabled the development of HPV DNA chip that can quickly detect HPV type related to cervical cancer.

In this regard, Korean Patent Laid-Open Publication No. 2001-0091450 (this patent is presented for reference only) discloses a DNA chip for detecting type-specific HPV and a kit using the same. The Korean Patent Publication is characterized in that the terminal of the type-specific probe is modified by the amine group and then fixed by the reaction of the base aldehyde on the glass, the process of adding a functional group such as an amine group is inevitably added to the manufacturing cost PCR reaction cycles to amplify such large amounts of DNA from the resulting DNA sample, as well as causing rises in the DNA sample, are usually required in order to detect hybridization reactions between the modified probe and the target DNA. This can not only be long, there is a problem that the time required for diagnosis is long.

In addition, in the case of the DNA chip described in the patent publication there is a problem that can not be read if a large number of background fluorescence is present around the measurement point.

The present invention has been proposed to solve the above problems, an object of the present invention by spotting a probe consisting of oligonucleotides that can quickly and simply detect oncogenic human papillomavirus that is closely related to cervical cancer The present invention provides an oligonucleotide DNA chip (microarray) capable of selectively detecting tumorigenic human papillomavirus and a human papillomavirus type diagnostic kit comprising the DNA chip.

It is another object of the present invention to provide a method for producing the diagnostic kit that can quickly diagnose the presence and type of human papillomavirus.

In order to achieve the above object, in one aspect of the invention there is provided a probe for detecting oncogenic human papillomavirus type consisting of oligonucleotides selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 30. The probe is characterized in that it can specifically bind to the DNA sequence of the L1 region, which is the standard of classification of human papillomavirus.

According to another aspect of the present invention, by adding a guanine base to the 5 'end of the probe to improve the reactivity with the glass on the surface of the oligonucleotide DNA chip; And a labeling means for detecting a hybridization reaction between the probe and the sample DNA.

Through the configuration of the kit according to the present invention, it is possible to diagnose early and accurately an infection of tumorigenic human papilloma virus associated with cervical cancer.

In still another aspect of the present invention, a probe is modified by binding a guanine base to the 5 'end of the probe capable of specifically binding to a tumorigenic human papillomavirus so as to increase the reactivity with the glass on the surface of the DNA chip. Making a step; And immobilizing the modified probe on a glass to prepare a DNA chip.

Furthermore, in another aspect of the present invention, an oligonucleotide DNA chip for diagnosing HPV type comprising a probe specifically binding to the DNA sequence of the L1 region in the genome of oncogenic HPV and a positive control indicating the position of the DNA probe. Is provided.

EMBODIMENT OF THE INVENTION Hereinafter, this invention is demonstrated in detail.

As described above, about 120 types of HPV have been identified to date, and are classified into high-risk HPV type and low-risk HPV type according to the relevance of cervical cancer. High-risk HPV types include HPV -16, -18, -26, -30, -31, -33, -34, -35, -39, -45, -51, -52, -53, -56, and -58 , -59, -61, -66, -67, -68, -69, -70, -73, -74, etc. Low risk HPV types include HPV -2, -3, -6, -7, -10, -11, -13, -32, -40, -42, -43, -44, -55, -54 and -57.

First, in the present invention, a probe capable of detecting various types of HPV associated with cervical cancer was designed, and the probe was used to detect a plurality of HPV types existing in the cervix. To this end, in the present invention, a type-specific probe was designed using a computer program based on HPV DNA sequences highly related to cervical cancer among a total of 72 HPV types. The designed probe was then screened for 30 sets of probes after confirming the binding capacity for various HPV types using other computer programs.

The probes selected above were synthesized using a nucleic acid autosynthesizer (Expedite ™ 8909 synthesizer, ABI). Modification of adding a plurality of guanine bases to the 5 'end of the total 30 trillion probes thus synthesized to form a probe of the oligonucleotide containing a plurality of guanine bases in which the modified probe is added to the probe ends is formed on the surface of the DNA chip. It can be fixed to the glass slide spontaneously. That is, according to a preferred embodiment of the present invention, by adding a modification process to add a plurality of guanine base at the 5 'end of the probe capable of specifically binding to the L1 region of the genome sequence of the type specific human papillomavirus, The DNA chip of the microarray can recognize the guanine base and immobilize it on the surface without adding a functional group, so that the microarray can be produced at a lower cost than the probe modified with the conventional amine base. In addition, compared to the conventional DNA chip, it was possible to reduce the single nucleotide polymorphism (SNP) discrimination process from 30 steps to 5 steps with a relatively short hybridization time and a simple washing process.

In this regard, the DNA probe may preferably be included at a concentration of 50 to 150 μg / ml, more preferably at a concentration of about 100 pmol / μl.

Labels suitable for HPV PCR products amplified by general primers capable of hybridizing with the probes to detect HPV infection on the immobilized DNA chip is modified HPV type specific probes as described above It is possible to take the configuration further comprising the label means. Primers that can be used in this regard can use generic primers that can amplify as many HPV types of DNA as possible, and in particular the present invention utilizes a GP4F / GP4R primer system known to produce approximately 320 bp of HPV amplification products. Used. On the other hand, the labeling material attached to the HPV DNA amplification product in the context of the present invention, Cy3 may be preferably used as the fluorescent material.

Using a diagnostic kit using the DNA microarray technology as described above, the target DNA of the first HPV infected cell lines CaSki (HPV-16) and HeLa (HPV-18) and HPV non-infected cell lines K562 DNA in the present invention PCR was performed using the primers used, followed by hybridization experiments with 30 sets of HPV type specific probes identified in the present invention.

On the other hand, the hybridization of the various types of HPV plasmid DNA using the 30 trillion HPV type specific probes synthesized in the present invention results in that both selectively bind to the corresponding specific type of HPV DNA. Confirmed.

Furthermore, it is possible to quickly identify whether HPV infection and type through DNA chip analysis after PCR amplification on a sample obtained from the human body using the probe confirmed in the present invention. In the present invention, cervical cancer-related abnormal patients [(microscopic invasive cancer (SCC)) through professional examinations such as cervicography, biopsy and Pap smear examination under the responsibility of the clinician. , High-grade lesions (HSIL)] and DNA chip experiments were performed in parallel with the commercialized HPV DNA chip (BioMedLab) for 10 normal people who were found to be unrelated to cervical cancer. Performing DNA chip experiments using the probes identified in the invention enabled accurate identification of the types identified in the HPV DNA chips.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, the following examples are only examples for demonstrating the constitution and effects of the present invention, and the present invention is not limited to the following examples.

Example 1 Preparation of HPV Oligonucleotide DNA Chips

The oligonucleotide DNA chip (microarray) according to the present invention consists of synthesizing oligonucleotide probes and fixing the probes on a slide.

(1) Design of HPV Oligonucleotide Probes

Oligonucleotides have been designed that can be used as type specific probes that can selectively bind to oncogenic HPV DNA closely related to cervical cancer.

First, HPV-1a, -2a, -3, -4, -5, -6b, -7, -8, -9, -10 from the National Center for Biotechnology Information (NCBI) and the US Los Angeles Alamos HPV database. , -11, -12, -13, -15, -16, -16r, -17, -18, -19, -20, -21, -22, -23, -24, -25, -26,- 27, -28, -29, -30, -31, -32, -33, -34, -35, -35h, -36, -37, -38, -39, -40, -41, -42, -44, -45, -47, -48, -49, -50, -51, -52, -53, -54, -55, -56, -57, -58, -59, -60, -61 A total of 72 HPV types were obtained: -63, -65, -66, -67, -68, -70, -72, -73, -74, -76, -77, and -80. . The obtained DNA sequence is performed using the computer program 'DNASTAR (MegAlignTM 5, DNASTAR Inc.)' to perform pairwise alignment and multiple sequence alignment using the ClustalW method, and then use the Phylogenetic tree. After typing and selecting the type-specific sequences of each group, the type-specific probe was designed using the computer program primer premier 5 (PreMIER Biosoft International Co.). At this time, the length of the probe was set to 30 ± 3 and 40 ± 2 oligonucleotides to design 100 trillion type specific probes.

(2) Hybridization and Probe Selection of Designed Probes

A total of 100 sets of probes designed in the above process were analyzed using a computer program (Amplify 1.2, University of Wisconsin) to analyze virtual binding capacity of 72 different HPV types already acquired during the design process. In this embodiment, HPV-16, -18, -26, -30, -31, -33, -35, -39, -45, -51, -52, -53, -56, -58 associated with cervical cancer Tumors of -59, -61, -68, -70, -73, -74, -6, -7, -11, -32, -34, -40, -42, -44, -55 and -66 Priority was given to being able to specifically bind to the native HPV type and the name, sequence number and type of the probe are shown in Table 1 below. For convenience of explanation, a total of 30 sets of probes used in the present invention were named ALP-1 to ALP-30, respectively, and these probes consisted of SEQ ID NO: 1 to SEQ ID NO: 30.

Table 1. Type specific probes that can bind to various types of HPV DNA

Probe Sequence (5 '→ 3') SEQ ID NO: Combined HPV Type ALP-1 CTCTGGGTCTACTGCAAATTTAGCCAGTT SEQ ID NO: 1 HPV-16 ALP-2 CACAGGTATGCCTGCTTCACCTG SEQ ID NO: 2 HPV-18 ALP-3 AAAGGTGCTGAATCAGGCAGGGA SEQ ID NO: 3 HPV-26 ALP-4 TACAAATAACAGGGATCCCCCGC SEQ ID NO: 4 HPV-30 ALP-5 AATAGATCAGGCACGGTTGGTGAATC SEQ ID NO: 5 HPV-31 ALP-6 TGGTACATTAGGAGAGGCTGTTCCCG SEQ ID NO: 6 HPV-33 ALP-7 CCACTGGCACATTGCCTAGTACTAGTTATTTT SEQ ID NO: 7 HPV-35 ALP-8 CACAGATATACGTGCAAACCCCGG SEQ ID NO: 8 HPV-39 ALP-9 CACTAGCGCTAATATGCGTGAAACCC SEQ ID NO: 9 HPV-45 ALP-10 TAGTGGTAATGGCCGTGACCCTATAGAA SEQ ID NO: 10 HPV-51 ALP-11 CTTAGGTGACCCTGTGCCAGGTG SEQ ID NO: 11 HPV-52 ALP-12 ACCCGCCCCCTAGCTCTGTATAT SEQ ID NO: 12 HPV-53 ALP-13 TAAAGTTGGGGAAACAATACCTGCAGAG SEQ ID NO: 13 HPV-56 ALP-14 CTGGAAAACTTGGCGAGGCTGT SEQ ID NO: 14 HPV-58 ALP-15 TGCCAACCCAGGCAGTTATTTATATTCC SEQ ID NO: 15 HPV-59 ALP-16 TTGATATTTGCACCACTATATGCAAGTATCCTG SEQ ID NO: 16 HPV-61 ALP-17 TCCTAGTAGTTATGTATATGCCCCCTCG SEQ ID NO: 17 HPV-68 ALP-18 TTACGTGAGCGTCCTGGTACTCATGTATA SEQ ID NO: 18 HPV-70 ALP-19 CTGGTGATACCGGTGATAAAATCCCA SEQ ID NO: 19 HPV-73 ALP-20 TGATGTTCCATTGGACATATGCAACACT SEQ ID NO: 20 HPV-74 ALP-21 AAATCGCACGTCTGTAGG SEQ ID NO: 21 HPV-6 ALP-22 ATATAACAGGTTCATCTAATCGCGCTTCTATTG SEQ ID NO: 22 HPV-7 ALP-23 TGCCTGATGACCTGTTGGTAAAAGG SEQ ID NO: 23 HPV-11 ALP-24 TTTATAAAAGCTTCTAATGGTGCTTGTGGC SEQ ID NO: 24 HPV-32 ALP-25 AAATGCTATTCCAGATGACTTAATGATTAAGGGT SEQ ID NO: 25 HPV-34 ALP-26 CCGGTAGTTCTGTATACTGCCCCTCTTG SEQ ID NO: 26 HPV-40 ALP-27 CTGCTAATAATGCATCTGGCAGACATAATTTAG SEQ ID NO: 27 HPV-42 ALP-28 AACAGTTGGTGAGGACGTTTCCCA SEQ ID NO: 28 HPV-44 ALP-29 AAAGGTGCTACTAAAAGTACAGTTCCTAATGCCA SEQ ID NO: 29 HPV-55 ALP-30 TAATGTTGGGGAAGCCATTCCTACAG SEQ ID NO: 30 HPV-66

(3) Selected Type Specific Probe Synthesis

Thirty trillion type-specific probes selected in the above process were synthesized through the following process including nine guanine groups at the 5 ′ end.

The probe was synthesized using an Expedite ™ 8909 nucleic acid synthesizer (ABI) equipped with a solid phase synthesis technique based on oligonucleotide phosphoramidite synthesis chemistry. First, the synthesis reaction was carried out on a CPG column immobilized with nucleosides located at the 3 'end of the oligonucleotide, and basically detritylation, coupling, capping and oxidation reactions. The oligonucleotide polymerization reaction of the selected primers was carried out in a repeating cycle. After completion of the synthesis, 30% ammonia water was added to the CPG column to isolate the oligomer, and then deprotected at 55 ° C. for at least 12 hours, concentrated to dryness by Speed Vac., And then reversed phase liquid chromatography and anion exchange chromatography. Pure water purification was carried out. The final purified oligomer was quantified by measuring absorbance at 260 nm.

(4) fixation of HPV oligonucleotides

The oligonucleotide probe synthesized above was immobilized on a DNA chip using the following method. First, the oligonucleotide probe synthesized with the 5 'end modified with a plurality of guanine bases was dissolved in 2X SSC (0.05 M sodium citrate, 0.45 M NaCl) to 100 pmol / ul and then reacted with the guanine base added at the 5' end. 1 ul (54 ug / ml) was spotted on the glass of the DNA chip.

Meanwhile, in the present embodiment, as a positive control to identify the position of the probe and the amplification product of the target DNA, oligonucleotide composed of SEQ ID NO: 31 (5'-TTTACACCTAGTGGCTCTATGGTGTCCTCT-3 ') is used. As modified by the addition of guanine base at the 5 'end, it was spotted on glass according to the same procedure.

Then, the spotted was placed in a wet chamber (humid chamber) and the reaction was fixed at room temperature for 2 hours.

After completion of the reaction, the slides were washed vigorously in 0.2% sodium dodecyl sulfate (SDS) solution for 1 minute, transferred to tertiary distilled water for 1 minute, and washed with NaBH ₄ solution (0.1 g NaBH4, 30ml phosphate buffered saline (PBS). ), 10 ml ethanol) was reduced for 5 minutes, washed again with distilled water for 1 minute, and air-dried and stored in a dark room at room temperature until use.

Example 2

In the present Example, the kit prepared in Example 1 was used to make HPV-16 infected cell line CaSki (ATCC CRL-1550), HPV-18 infected cell line HeLa (ATCC CCL-2) and HPV uninfected cell line K562 (KCLB). -10243, Korean Cell Line Bank).

(1) cell line purification

Caski and HeLa was cultured according to the manufacturer's instructions, and then these Dulbecco's phosphate-buffered saline (Gibco, Inc.) as a one-time After the cleaning was completed, the measuring the number of cells on a microscope, and then 2 × 10 ⁶ cells, genomic DNA isolation kit (Genomic DNA Isolation Kit, Cat.No. K-3032, Bioneer Co., Ltd.) was isolated and purified and finally dissolved in 200 μl of distilled water (DW) to use as template DNA solution.

(2) polymerase chain reaction

The composition of the PCR reaction solution for detecting HPV infection was 10 Buffer 2.5, purchased from SuperBio, 3.75 10 mM MgCl ₂ , 0.5 10 10 mM dNTP, 0.5 Ta Taq polymerase (1 unti) The primers used were 1 μl (40 pmoles) of GP4F (5'-Cy3-GATGGTGATATGGTAGATACAGGATTTGG-3 ') and GP4R (5'-Cy3-GCGTCAGAGGTTACCATAGAGCCACTAGG-3') with Cy3 bound, 5.2 μl of distilled water, respectively. , And the reaction solution consisting of 8.0 μl of template DNA of the Caski, HeLa, and K562 cell lines purified above was adjusted to 50 μl in total.

The PCR cycle was pre-heated for 5 minutes at 94 ° C, followed by 50 cycles of 1 minute at 94 ° C, 1 minute at 50 ° C, and 1 minute at 72 ° C, and finally heated at 72 ° C for 5 minutes. 5 μl of the final reaction solution was added to a 2% agarose gel in combination with a DNA size standard marker, followed by electrophoresis.

(3) Hybridization

Hybridization reactions were carried out using PCR amplified products amplified by PCR on a slide substrate on which a total of 30 sets of oligonucleotide probes synthesized with the cell line DNA used in this example were immobilized. A hybridization reaction chamber (Hybridization reaction chamber) was used for 100 μl capslips (GRACE Bio-Labs, USA).

5 μl of the amplified product obtained above was denatured at 95 ° C. for 5 minutes and immediately left for 3 minutes on ice. Then, 18 × SSC 18 μl, 90% glycerol 50 μl, 50 mM phosphate buffer 15.65 μl, 0.1% with a hybridization reaction solution. The final dose was adjusted to 90 μl by addition of 1.35 μl SDS followed by reaction for 10 minutes with the probe immobilized on the slide at 51 ° C.

After completion of the hybridization reaction, the chip was immersed in 2 × SSC / 0.1% SDS solution, washed at 30 ° C. for 2 minutes, washed with 4 × SSC solution at room temperature for 1 minute, then the wells were removed and washed briefly at room temperature with EtOH and then 0.1. Washed once more with X SSC solution and dried. The dried slides were analyzed for fluorescent signals using a confocal laser scanner (GMS 418 Array Scanner TaKaRa).

1A to 1C show DNA microorganisms using a total of 30 sets of probes synthesized in the present invention in the HPV-16 infected cell line Caski, HPV-18 infected cell line HeLa, and HPV non-infected cell line K562, respectively. It is the photograph which performed array hybridization and the analysis result. Circles in each figure indicate the position according to the type of probe, and each number indicates the type of HPV amplified according to the type of probe to which the guanine base is added at the 5 'end used in the present invention. That is, 16 is ALP-1 probe, 18 is ALP-2 probe, 26 is ALP-3 probe, 30 is ALP-4 probe, 31 is ALP-5 probe, 33 is ALP-6 probe, 35 is ALP-7 probe , 39 is an ALP-8 probe, 45 is an ALP-9 probe, 51 is a probe in which each 5 'end of the ALP-10 probe is modified with guanine. On the other hand, the PC is a positive control used to confirm the position of each modified probe.

As can be seen in the figure, using the HPV-16 infected cell line CaSki as the target DNA, the cross-hybridization reaction occurred specifically in the region where the ALP-1 probe synthesized in the present invention was spotted (FIG. 1A). When using HeLa, an HPV-18 infected cell line, as a target DNA, a cross-hybridization reaction occurred specifically for the spot to which the ALP-2 probe synthesized in the present invention was spotted (FIG. 1B). For the cell line K-562, it was confirmed that no cross-hybridization reaction occurred with the probe synthesized in the present invention. That is, hybridization reactions occurred only to the probes modified at the 5 'end of the probes found to specifically bind to the HPV-16 infected cell line and the HPV-18 infected cell line.

Example 3

In this example, using a diagnostic kit in which the HPV-specific probe identified in Example 2 was immobilized, it was confirmed whether hybridization was performed on more various types of HPV cell lines. In other words, in the present embodiment, a hive in a kit using a DNA chip may be used for E. coli strains containing non-tumorogenic HPV type plasmid DNA as well as E. coli strains containing oncogenic HPV type plasmids. It was checked whether or not re-edification.

E. coli strains used in this example are as follows.

HPV-2a (ATCC 45022);

HPV-6b (ATCC 45150);

HPV-11 (ATCC 45151);

HPV-16 (ATCC 45113);

HPV-18 (ATCC 45152);

HPV-31 (ATCC 65446);

HPV-35 (ATCC 40331);

HPV-43 (ATCC 40338);

HPV-44 (ATCC 40353);

HPV-56 (ATCC 40549)

Each E. coli strain was incubated for 16 hours in 37 ° C. LB liquid medium, separated and purified by Qiafilter Plasmid Maxi Kit (Cat. No. 12263, QIAGEN), and adjusted to 10 ng / μl. Utilized. Subsequently, PCR amplification of the DNA of the strain used in this example was carried out according to the same procedure as in Example 2, and then hybridization was confirmed.

2A to 2J are photographs and analysis results of hybridization reactions using 30 sets of modified probes synthesized in the present invention using HPV infected plasmid DNA used in this example, respectively, as template DNA. In each figure, the circle indicates the position according to the type of probe, and each number indicates the type of HPV amplified according to the type of probe to which the guanine base is added at the 5 'end used in the present invention, and the PC is modified. Positive control used to identify the position of the probe.

Figure 2a shows the ATCC 45113 strain containing HPV-16 DNA, Figure 2b shows the ATCC 45152 strain containing HPV-18 DNA, Figure 2c shows the ATCC 65446 strain containing HPV-31 DNA, Figure 2d shows the HPV- ATCC 40331 strain containing 35 DNA, FIG. 2E shows ATCC 40338 strain containing HPV-43 DNA, FIG. 2F shows ATCC 40353 strain containing HPV-44 DNA, FIG. 2G contains HPV-56 DNA ATCC 40549 strain, FIG. 2H shows ATCC 45150 strain containing HPV-6b DNA, FIG. 2I shows ATCC 45151 strain containing HPV 11 DNA, FIG. 2J shows DNA obtained from ATCC 45202 strain containing HPV 2a DNA Is the target DNA.

As can be clearly seen in the figure, hybridization occurred only in the region where the ALP-1 probe specifically bound to HPV-16 DNA was spotted on the ATCC 45113 strain containing HPV-16 DNA (Fig. 2a), ATCC 45152 strain containing HPV-18 DNA hybridization occurred only in the region where the ALP-2 probe specifically bound to HPV-18 DNA was spotted (FIG. 2B), and HPV-31 For the ATCC 65446 strain containing DNA, hybridization occurred only in the region where the ALP-5 probe that specifically binds to HPV-31 DNA was spotted (FIG. 2C), and ATCC containing HPV-35 DNA was detected. For the 40331 strain hybridization occurred only in the region where the ALP-7 probe specifically bound to HPV-35 DNA was spotted (FIG. 2D), and HPV for the ATCC 40353 strain containing HPV-44 DNA. Specific with -44 DNA Hybridization occurred only in the region where the ALP-28 probe that binds to the ALP-28 probe was spotted (FIG. 2F), and ALP- that specifically binds to HPV-56 DNA for the ATCC 40549 strain containing HPV-56 DNA. Hybridization reactions occurred only in the region where the 13 probe was spotted (FIG. 2g), and for the ATCC 45150 strain containing HPV-6b DNA, the ALP-21 probe that specifically binds HPV-6 DNA was spotted. Hybridization reaction occurred only in the region of the affected region (FIG. 2H), and in the ATCC 45151 strain containing HPV-11 DNA, only the region in which the ALP-23 probe that specifically binds HPV-11 DNA was spotted Redidation took place (FIG. 2I).

On the other hand, no hybridization was performed when the ATCC 40338 strain containing HPV-43 DNA was used as the target DNA (FIG. 2E) and the ATCC 45202 strain containing HPV-2a DNA was used as the target DNA (FIG. 2J). It can be seen that no reaction occurred.

This result was confirmed to be in agreement with the results of Table 1 presented in Example 1, it was expected that the same results as in Table 1 can be derived for many other oncogenic HPV types not confirmed in this Example .

Comparative Example 1

In this comparative example, HPV infection of the sample obtained from the human body was confirmed according to a conventional cytological method.

For women who visited the outpatient clinic of the Women's Cancer Center of the Pocheon College of Medicine, Korea, under the responsibility of a clinician, colposcopy, cervicography, biopsy, and pap-smear smears Specialized examinations were performed according to cytological methods such as). In this comparative example, a total of 20 patients were examined, and the results of the examination through the cell test are shown in Table 2 below.

As shown in Table 2, abnormal patients associated with cervical cancer were identified as 7 patients with low grade squamous stool disease (LSIL), 2, 3, 4 patients with high grade squamous epithelial disease (HSIL). 6, 8, and 10, and subjects 1, 5, and 9, which were determined to be microinvasive cancers (SCC), were included, and the remaining subjects 11 to 20 were judged to be normal subjects not related to cervical cancer.

Table 2. Clinical Trial Results by Cytometry

Subject No. Cytology Subject No. Cytology One SCC ^* 11 normal 2 HSIL ^** 12 normal 3 HSIL 13 normal 4 SCC 14 normal 5 HSIL 15 normal 6 SIL 16 normal 7 LSIL ^*** 17 normal 8 HSIL 18 normal 9 SCC 19 normal 10 HSIL 20 normal

HSIL ^* : High Squamous Intraepithelial Lesions

SCC ^** : Squamous Cell Carcinoma

LSIL ^*** : Low Squamous Intraepithelial Lesions

Comparative Example 2

In the comparative example 1, DNA chip (biomed lab) test was performed on 20 samples of cervical cancer-related abnormal patients and samples obtained from normal persons not related to cervical cancer. According to the comparative example, the examination result according to the DNA chip test is briefly shown in Table 3 below.

As shown in Table 3, among the total 10 patients determined to be related to cervical cancer in Comparative Example 1, Subject 1 was HPV-16, Subject 2 was HPV-31, Subject 3 was HPV-58, Subject 4 to HPV-59, Subject 5 to HPV-68, Subject 6 to HPV-56, Subject 7 to HPV-35, Subject 8 to HPV-18 and 70, Subject 9 to HPV-16 and 52 In addition, subject 10 was examined as having been infected with HPV-18, respectively.

On the other hand, in Comparative Example 1, it was found that the samples obtained from the subjects 11 to 20 that were not related to cervical cancer were not infected with HPV.

Table 3. Results of HPV Type Screening with DNA Chips for Clinical Samples

Subject NO. DNA chip test result Subject No. DNA chip test result One HPV-16 11 negative 2 HPV-31 12 negative 3 HPV-58 13 negative 4 HPV-59 14 negative 5 HPV-68 15 negative 6 HPV-56 16 negative 7 HPV-35 17 negative 8 HPV-18, 70 18 negative 9 HPV-16, 52 19 negative 10 HPV-18 20 negative

Example 4

In the present embodiment, whether the hybridization using a microarray was confirmed using a diagnostic kit prepared in the present invention for a sample obtained from a subject diagnosed as being related to cervical cancer as a result of the cytological examination of Comparative Example 1. .

First, a sample was taken from the cervix of Subjects 1 to 10 determined to be related to cervical cancer in Comparative Example 1, and then the sample was precipitated by rotating at 12,000 rpm for 2 minutes in a centrifuge. After adding an appropriate amount of cell lysis buffer to the precipitated cells and incubated for 10 minutes at 60 ℃, 6M sodium chloride (NaCl) and chloroform was added and centrifuged again at 12,000 rpm for 2 minutes and the supernatant was added to a new tube Moved to. About 2.5 times of ethanol was added to the transferred supernatant according to a conventional method, the mixture was mixed, centrifuged again at 12,000 rpm for 2 minutes to recover the pellet, and then washed with an appropriate amount of 70% ethanol. Finally, it was dissolved in 200 μl of distilled water and used as template DNA solution.

 Subsequently, DNA samples obtained from the subjects were amplified by a PCR process according to the same procedure as in Example 2 and Example 3, and then hybridization was confirmed.

3A to 3J show DNA microarray hybridization using a diagnostic kit using a total of 30 sets of probes synthesized in the present invention for samples obtained from subjects determined to be related to cervical cancer according to the present embodiment. It is a photograph performed and the analysis result. In each figure, the circle indicates the position according to the type of probe, and each number indicates the type of HPV amplified according to the type of the probe to which the guanine base is added at the 5 'end used in the present invention, and the PC is a probe. Positive control that tells the location of the.

FIG. 3A shows a subject 1, FIG. 3B shows a subject 2, FIG. 3C shows a subject 3, FIG. 3D shows a subject 4, FIG. 3E shows a subject 5, FIG. 3F shows a subject 6, FIG. 3G shows a subject 7, FIG. 3H shows a subject 8, and FIG. 3I. FIG. 3J is a DNA sample obtained from Subject 10. FIG.

As can be seen in the figure, subject 1 has an ALP-1 probe that specifically binds to HPV-16 DNA (FIG. 3A), and subject 2 has ALP that specifically binds to HPV-31 DNA. For regions where the -5 probe was spotted (FIG. 3B), subject 3 was spotted with an ALP-14 probe that specifically binds to HPV-58 DNA (FIG. 3C), and subject 4 was exposed to HPV-59 DNA. For regions where ALP-15 probe that specifically binds was spotted (FIG. 3D), subject 5 was examined for regions where ALP-17 probe that specifically binds HPV-68 DNA (FIG. 3E), subject 6 For the region spotted with ALP-13 probe that specifically binds to HPV-56 DNA (FIG. 3F), and subject 7 for the region spotted with ALP-7 probe that specifically binds to HPV-35 DNA (FIG. FIG. 3G), Subject 8 is specific to HPV-70 DNA and the region spotted with an ALP-18 probe that specifically binds to HPV-18 DNA. For regions where the ALP-18 probe that binds specifically binds (FIG. 3H), subject 9 specifically binds to the HPV-52 DNA and the spotted region where the ALP-1 probe binds specifically to HPV-16 DNA For the region where the ALP-11 probe was spotted (FIG. 3I), subject 10 was specifically cross-hived for the region where the ALP-2 probe specifically bound to HPV-18 DNA (FIG. 3J). It can be seen that redidation has taken place.

These results were in agreement with those of Comparative Example 2 using a conventional DNA chip.

Example 5

In this example, the hybridization using a microarray was confirmed using a diagnostic kit prepared in the present invention for a sample obtained from a subject who was found to be unrelated to cervical cancer as a result of the cytological examination of Comparative Example 1. .

In the present embodiment, according to the same procedure as in Example 4, DNA samples obtained from the subjects not related to cervical cancer were amplified through a PCR process, and then hybridization was confirmed.

Figures 4a to 4j are DNA microarray hybridization using a total of 30 sets of probes synthesized in the present invention for DNA samples obtained from a subject not associated with cervical cancer according to the present embodiment and its The result of the analysis. In each figure, the circle indicates the position according to the type of probe, and each number indicates the type of HPV amplified according to the type of the probe to which the guanine base is added at the 5 'end used in the present invention, and the PC is a probe. Positive control that tells the location of the.

4A is a subject 11, FIG. 4B is a subject 12, FIG. 4C is a subject 13, FIG. 4D is a subject 14, FIG. 4E is a subject 15, FIG. 4F is a subject 16, FIG. 4G is a subject 17, FIG. 4H is a subject 18, FIG. 4I Fig. 4J shows DNA samples obtained from Test Subject 20 as target DNA.

As can be seen in the figure, no cross-hybridization reaction occurred for DNA samples obtained from the subjects determined to be unrelated to cervical cancer by cytological examination, which is consistent with the conventional DNA chip examination. It was confirmed that.

In the above description of the preferred embodiment of the present invention, it will be apparent to those skilled in the art that various modifications and changes can be made without departing from the spirit of the present invention. It will also be apparent from the appended claims that such modifications and variations are all within the scope of the present invention.

In the present invention, a fluorescent substance in a DNA chip, ie, oligonucleotide microarrays and amplification products, comprising a probe modified with a type-specific oligonucleotide capable of specifically binding to oncogenic human papillomavirus types closely related to cervical cancer. Through the diagnostic kit consisting of the labeled means, it is possible to accurately and quickly diagnose a large amount of tumorigenic HPV types.

In particular, the present invention can not only prevent the dust due to contamination of the DNA sample in advance, but also greatly improve the stability.

In particular, compared to DNA chips for determining HPV type through probes modified by conventional amine groups, the treatment by a separate functional group is omitted, so that DNA chips can be manufactured at low cost, and relatively short hybridization time and simple The SNP can be determined only by the washing process.

In addition, in the conventional HPV type diagnostic kit, when the temperature range required for the hybridization and washing process exceeds about 1 ° C., the binding was not maintained even when there was a difference in only one nucleotide sequence. In the diagnostic kit, the binding is maintained during the binding and washing of the SNP even at a temperature difference of 5 ° C. or more, so that a DNA fragment such as SNP having only one nucleotide sequence can be easily identified.

In particular, in conventional HPV type diagnostic kits, cDNA of ng / ml or more should be used for reading hybridization reactions. However, when the probe modified by the present invention is used, reading of SNP at concentrations of several tens of pg / ml to several ng / ml This is possible.

In addition, the conventional diagnostic kit has difficulty in reading when a large number of background fluorescence is present around the measurement point, but in the present invention, the background fluorescent is prevented by modifying the probe fixed on the upper surface of the DNA chip and adding a blocking solution to prevent cDNA from attaching to the surface. Was removed as much as possible and only the fluorescence of the clear measuring point was observed.

Figures 1a to 1c respectively targets the HPV-16 infected cell line Caski, HPV-18 infected cell line HeLa and HPV non-infected cell line K562 using a total of 30 sets of probes synthesized in the present invention according to an embodiment of the present invention It is a photograph which performed DNA microarray hybridization, and its analysis figure.

2A to 2J show DNA microarray hybridization using HPV plasmids containing DNA sequences of various HPV types as target DNA, respectively, using a total of 30 sets of probes synthesized according to another embodiment of the present invention. It is a photograph performed and the analysis drawing.

3A to 3J are DNA microarray hive for DNA samples obtained from a human body identified as being related to cervical cancer using a total of 30 sets of probes synthesized in the present invention, respectively, according to another embodiment of the present invention. It is a photograph which carried out redidation, and its analysis drawing.

4A to 4J are DNA microarray hive for DNA samples obtained from a human body each identified as not related to cervical cancer using a total of 30 trillion probes synthesized in the present invention according to another embodiment of the present invention. It is a photograph which carried out redidation, and its analysis drawing.

<110> AlBIOMED Co., LTD. <120> Microarray and Kit for Diagnosing HVP Genotypes and Method of Manufacturing the same <160> 31 <170> KopatentIn 1.71 <210> 1 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 1 ctctgggtct actgcaaatt tagccagtt 29 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecing HPV Types <400> 2 cacaggtatg cctgcttcac ctg 23 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 3 aaaggtgctg aatcaggcag gga 23 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 4 tacaaataac agggatcccc cgc 23 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 5 aatagatcag gcacggttgg tgaatc 26 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 6 tggtacatta ggagaggctg ttcccg 26 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 7 ccactggcac attgcctagt actagttatt tt 32 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 8 cacagatata cgtgcaaacc ccgg 24 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 9 cactagcgct aatatgcgtg aaaccc 26 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 10 tagtggtaat ggccgtgacc ctatagaa 28 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 11 cttaggtgac cctgtgccag gtg 23 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 12 acccgccccc tagctctgta tat 23 <210> 13 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 13 taaagttggg gaaacaatac ctgcagag 28 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 14 ctggaaaact tggcgaggct gt 22 <210> 15 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 15 tgccaaccca ggcagttatt tatattcc 28 <210> 16 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 16 ttgatatttg caccactata tgcaagtatc ctg 33 <210> 17 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 17 tcctagtagt tatgtatatg ccccctcg 28 <210> 18 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 18 ttacgtgagc gtcctggtac tcatgtata 29 <210> 19 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 19 ctggtgatac cggtgataaa atccca 26 <210> 20 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 20 tgatgttcca ttggacatat gcaacact 28 <210> 21 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPv Types <400> 21 aaatcgcacg tctgtagg 18 <210> 22 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 22 atataacagg ttcatctaat cgcgcttcta ttg 33 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 23 tgcctgatga cctgttggta aaagg 25 <210> 24 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 24 tttataaaag cttctaatgg tgcttgtggc 30 <210> 25 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 25 aaatgctatt ccagatgact taatgattaa gggt 34 <210> 26 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 26 ccggtagttc tgtatactgc ccctcttg 28 <210> 27 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 27 ctgctaataa tgcatctggc agacataatt tag 33 <210> 28 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 28 aacagttggt gaggacgttt ccca 24 <210> 29 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 29 aaaggtgcta ctaaaagtac agttcctaat gcca 34 <210> 30 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Probe for Detecting HPV Types <400> 30 taatgttggg gaagccattc ctacag 26 <210> 31 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Postivie control for informing Prove Locations <400> 31 tttacaccta gtggctctat ggtgtcctct 30

Claims (15)

An oligonucleotide DNA chip for human papillomavirus type analysis in which a probe consisting of oligonucleotides selected from the group consisting of SEQ ID NOs: 1 to 30 is immobilized on a glass. The method of claim 1, The oligonucleotide DNA chip further has a positive control for indicating the position of the probe in a region independent of the region to which the selected probe is fixed. The method according to claim 1 or 2, The probe is an oligonucleotide DNA chip is immobilized on the glass of the DNA chip through a modification in which a plurality of guanine base is added at the 5 'end. The method of claim 1, The probe is oligonucleotide DNA chip, characterized in that specifically binding to oncogenic human papillomavirus associated with cervical cancer. The method of claim 1, The probe is oligonucleotide DNA chip, characterized in that 50 ~ 150 ㎍ / ㎖. Oligonucleotide DNA chips for human papillomavirus type analysis in which a probe consisting of oligonucleotides selected from the group consisting of SEQ ID NOs: 1 to 30 is immobilized on a glass; And Human papillomavirus type diagnostic kit comprising a label means for detecting a hybridization reaction of the probe of the DNA chip and the sample DNA obtained. The method of claim 6, And a positive control for informing the position of the probe in a region independent of the region to which the probe is fixed on the DNA chip. The method of claim 6, The probe is a diagnostic kit that is fixed on the glass of the DNA chip through the modification to add a plurality of guanine base at the 5 'end. The method of claim 6, The diagnostic kit is characterized in that the concentration of the probe is 50 ~ 150 ㎍ / ㎖. The method of claim 6, And amplification means for amplifying the sample DNA. The method of claim 10, The amplification means diagnostic kit, characterized in that it comprises a GP4F / GP4F primer system. The method of claim 11, The marker means is a diagnostic kit containing a Cy3.  Modifying the probe by binding a plurality of guanine bases to the 5 'end of the probe consisting of an oligonucleotide selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 30; The method of manufacturing a human papillomavirus type diagnostic kit comprising the step of immobilizing the modified probe on a glass to prepare a DNA chip. The method of claim 13, The probe is a method for producing a human papillomavirus type diagnostic kit, characterized in that the specific binding to the tumorigenic human papillomavirus type. The method according to any one of claims 13 or 14, The concentration of the probe is 50 ~ 150 ㎍ / ㎖ method for producing a human papillomavirus type diagnostic kit, characterized in that.