KR102553088B1 - Biomarker composition for diagnosing membranous glomerulonephritis and use thereof - Google Patents

Abstract

The present invention relates to a biomarker composition for diagnosing membranous glomerulonephritis and its use, and more particularly, to any one or more miRNAs selected from the group consisting of miR-1229-3p, miR-340-3p and miR-99b-5p. It provides a biomarker composition for diagnosing membranous glomerulonephritis comprising as an active ingredient.
The composition can diagnose membranous glomerulonephritis more easily by including miRNA derived from blood or serum-derived exosomes that are specifically expressed in membranous glomerulonephritis, and by early diagnosis of membranous glomerulonephritis, appropriate treatment accordingly Through this, it is possible to treat membranous glomerulonephritis more effectively by minimizing worsening symptoms and complications.

Description

Biomarker composition for diagnosis of membranous glomerulonephritis and its use {BIOMARKER COMPOSITION FOR DIAGNOSING MEMBRANOUS GLOMERULONEPHRITIS AND USE THEREOF}

The present invention relates to a microRNA biomarker composition for diagnosing membranous glomerulonephritis (MGN) and its use.

Primary nephrotic syndrome is defined as characterized by severe edema, massive proteinuria and blood hypoalbuminemia. The cause of primary nephrotic syndrome is glomerulitis, in which the glomerulus of the kidney becomes inflamed. There are more than 10 types of glomerulonephritis. (idiopathic nephrotic syndrome, INS) accounts for the majority. Primary nephrotic syndrome is characterized by various treatment methods and treatment prognoses for each disease. MGN generally does not respond to steroid therapy alone, and resolution requires combination therapy with high-dose steroids and other immunosuppressive agents such as cyclophosphamide. Despite these treatments, there are also refractory MGN that do not respond to treatment.

In order to accurately diagnose the causative disease in nephrotic syndrome, an invasive kidney biopsy that collects kidney tissue using a gun needle is essential. In addition, invasive biopsy is a very dangerous test when taking antiplatelet agents and anticoagulation, which are taken for the recurrence of heart disease and cerebrovascular disease. Therefore, in addition to biopsy, which is an invasive diagnostic method, it is very important to develop non-invasive biomarkers that help confirm the disease or when invasive biopsy is not possible.

On the other hand, microRNA (miRNA; miR) is a non-coding small RNA present in the genomes of both animals and plants and is known to be involved in all processes of living things. studies are in progress. Most biomarkers currently used clinically are proteins circulating in body fluids, but unfortunately, the development of new protein-based biomarkers faces considerable technical difficulties due to the low affinity of the target protein in the sample. Development can be an alternative that can overcome the limitations of protein biomarkers.

Republic of Korea Patent Publication No. 10-2008-0091234 (2008.10.09. Publication)

An object of the present invention is to provide a composition capable of effectively diagnosing membranous glomerulonephritis.

Another object of the present invention is to provide a method for providing information necessary for diagnosing membranous glomerulonephritis.

In order to achieve the above object, the present invention is a biomarker composition for diagnosing membranous glomerulonephritis comprising any one or more miRNAs selected from the group consisting of miR-1229-3p, miR-340-3p and miR-99b-5p as an active ingredient. provides

The present invention relates to a composition for diagnosing membranous glomerulonephritis comprising, as an active ingredient, an agent capable of measuring the expression level of any one or more miRNAs selected from the group consisting of miR-1229-3p, miR-340-3p and miR-99b-5p, and It provides a diagnostic kit for membranous glomerulonephritis comprising the same.

In addition, the present invention measures the expression level of any one or more miRNAs selected from the group consisting of miR-1229-3p, miR-340-3p and miR-99b-5p from a sample isolated from a patient; And comparing the expression level of the miRNA with a normal control sample; provides a method for providing information necessary for diagnosing membranous glomerulonephritis, including.

The present invention selected miRNAs specifically expressed in membranous glomerulonephritis compared to normal group or idiopathic nephrotic syndrome from blood or serum-derived exosomes, and membranous glomerulonephritis can be diagnosed more easily using this.

In addition, by early diagnosis of membranous glomerulonephritis using the miRNA, it is possible to treat membranous glomerulonephritis more effectively by minimizing worsening symptoms and complications thereof through appropriate treatment accordingly.

Figure 1 is a result of comparative analysis of the expression level of microRNA (miRNA) in exosomes isolated from the serum of normal group (HV) and idiopathic nephrotic syndrome (INS) subjects. It is a heat map result of performing hierarchical clustering according to the expression level of miRNAs whose expression was significantly reduced or increased by more than 2 times (p < 0.05), and FIG. 1b is a scatter plot according to the expression level of miRNAs detected above. ) is the result.
Figure 2 is a result of comparative analysis of the expression level of miRNA in exosomes isolated from the serum of subjects with idiopathic nephrotic syndrome (INS) and membranous glomerulonephritis (MGN), Figure 2a is significant in membranous glomerulonephritis compared to idiopathic nephrotic syndrome It is a heat map result of performing hierarchical clustering according to the expression level of the miRNA whose expression is reduced or increased by more than 2 times (p < 0.05), and FIG. 2b is a scatter plot result according to the expression level of the miRNA detected above.
Figure 3 is a result of comparative analysis of the expression level of miRNA in the exosomes isolated from the serum of normal group (HV) and membranous glomerulonephritis (MGN) subjects, Figure 3a is significantly 2 in membranous glomerulonephritis compared to normal group It is a heat map result of performing hierarchical clustering according to the expression level of miRNAs whose expression is decreased or increased by more than twofold (p < 0.05), and FIG. 3b is a scatter plot result according to the expression level of miRNAs detected above.
Figure 4 shows only miRNAs whose expression was significantly changed from the results of Figures 1, 2, and 3 in a Venn diagram, showing that the expression was changed only in the membranous glomerulonephritis group (MGN) compared to the normal group (HV) or idiopathic nephrotic syndrome (INS). This is the result of deriving only miRNA (three).
Figure 5 is a result of confirming the significant expression difference between the normal group (HV), idiopathic nephrotic syndrome (INS), and membranous glomerulonephritis group (MGN) of the three miRNAs derived in FIG. 4 above.

Hereinafter, the present invention will be described in detail.

In order to discover biomarkers that can effectively diagnose membranous glomerulonephritis, the present inventors analyzed microRNAs (miRNAs) present in serum-derived exosomes, and the expression was significant in the membranous glomerulonephritis patient group compared to the normal control group or idiopathic nephrotic syndrome patient group. The present invention was completed by identifying miRNAs that change in different ways.

The present invention provides a biomarker composition for diagnosis of membranous glomerulonephritis comprising at least one miRNA selected from the group consisting of miR-1229-3p, miR-340-3p and miR-99b-5p as an active ingredient.

In the present specification, "membranous glomerulonephritis (MGN)" is a disease in which the glomerular capillary membrane thickens due to immune deposition in renal tissue, and is also referred to as 'membranous nephropathy' or 'membranous glomerulopathy'. Morphologically, it is a renal disease characterized by diffuse glomerular basement membrane thickening and granular electron-dense immunoglobulin deposition in the lower visceral epithelium. It is most common in adults over the age of 35 and occurs twice as often in men than in women. About 80% of patients show four major symptoms of nephrotic syndrome, such as proteinuria, decreased blood albumin, increased lipids, and edema.

As used herein, "diagnosis" is to confirm the presence or characteristics of a pathological state, and for the purpose of the present invention, it means to determine whether membranous glomerulonephritis occurs or whether there is an inventive possibility, membranous glomerulonephritis or at least one thereof. determining a subject's susceptibility to one or more symptoms, therametrics (eg, monitoring a subject's condition to provide information about the efficacy of a treatment), and the like. It also includes primary diagnosis of a clinical condition or diagnosis of a recurrent disease.

In the present specification, a "biomarker" is an indicator that can detect changes in the body, and is a substance that can determine the normal or pathological state of a living organism, whether or not it is changed, and includes polypeptides, nucleic acids, lipids, and glycolipids. , glycoproteins, sugars (monosaccharides, disaccharides, oligosaccharides, etc.), and the like, and the like, and the like can be used to diagnose membranous glomerulonephritis as in the present invention.

In the biomarker composition, the miRNA may be derived from exosomes, more preferably from blood or serum-derived exosomes, but is not limited thereto.

More specifically, the miR-1229-3p may consist of the nucleotide sequence represented by SEQ ID NO: 1, the miR-340-3p may consist of the nucleotide sequence represented by SEQ ID NO: 2, and the miR-99b- 5p may consist of the nucleotide sequence represented by SEQ ID NO: 3.

-miR-1229-3p: cucucaccacugcccucccacag (SEQ ID NO: 1)

- miR-340-3p: uccgucucaguuacuuuauagc (SEQ ID NO: 2)

-miR-99b-5p: cacccguagaaccgaccuugcg (SEQ ID NO: 3)

The expression of the miRNA can be significantly changed in the membranous glomerulonephritis patient group compared to the normal control group or the idiopathic nephrotic syndrome patient group. can be reduced

According to an embodiment of the present invention, the miRNA expression level of the normal control group or the idiopathic nephrotic syndrome patient group compared to the miRNA expression level of the membranous glomerulonephritis patient group calculated as log2 (fold change) value is -2 to -5 days can

Since the biomarker according to the present invention shows the same results even in repeated experiments, and the change in its expression level shows significant results, it can be regarded as a highly reliable marker, and thus the predicted results can be reasonably trusted.

The present invention provides a composition for diagnosis of membranous glomerulonephritis comprising, as an active ingredient, an agent capable of measuring the expression level of any one or more miRNAs selected from the group consisting of miR-1229-3p, miR-340-3p and miR-99b-5p. to provide.

An agent capable of measuring the expression level of the miRNA may be a primer or probe that specifically binds to the miRNA, but is not limited thereto.

As used herein, a "primer" is a nucleic acid sequence having a short free 3' hydroxl group, capable of forming base pairs with a complementary template and serving as a starting point for template strand copying. Refers to a short nucleic acid sequence. The primer can initiate DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleotide triphosphates in an appropriate buffer and temperature. PCR conditions and lengths of sense and antisense primers can be appropriately selected according to techniques known in the art.

In the present specification, "probe" refers to a fragment of several to hundreds of nucleotide sequences capable of specifically binding to miRNA, and is labeled so that the presence or absence of the miRNA and the expression level can be confirmed. Appropriate probes and hybridization conditions can be appropriately selected according to techniques known in the art.

The present invention provides a kit for diagnosing membranous glomerulonephritis comprising the composition for diagnosing membranous glomerulonephritis. The kit can be used to diagnose the onset of membranous glomerulonephritis by measuring the expression level of the miRNA in a sample isolated from an individual suspected of having membranous glomerulonephritis.

The kit for diagnosing membranous glomerulonephritis may include not only an agent for measuring the miRNA expression level, but also one or more other component compositions, solutions, or devices suitable for analysis methods.

For example, the kit according to the present invention includes genomic DNA derived from a sample to be analyzed to perform PCR, a primer set specific for the marker gene of the present invention, an appropriate amount of DNA polymerase, a dNTP mixture, a PCR buffer and It may be a kit containing water. The PCR buffer may contain KCl, Tris-HCl and MgCl ₂ . In addition, the kit of the present invention may additionally include components necessary for performing electrophoresis to confirm whether the PCR product is amplified or not.

In addition, the kit according to the present invention may be a kit including essential elements necessary for performing RT-PCR. The RT-PCR kit contains, in addition to each pair of primers specific for a marker gene, a test tube or other suitable container, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC -Water (DEPC-water), sterilized water, etc. may be included. It may also include a primer pair specific to a gene used as a quantitative control.

The present invention measures the expression level of any one or more miRNAs selected from the group consisting of miR-1229-3p, miR-340-3p and miR-99b-5p from a sample isolated from a patient; And comparing the expression level of the miRNA with a normal control sample; provides a method for providing information necessary for diagnosing membranous glomerulonephritis, including.

The method for providing information necessary for the diagnosis of membranous glomerulonephritis may further include comparing the expression level of the miRNA with that of idiopathic nephrotic syndrome patient group samples.

The sample may include tissue, cell, whole blood, blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine, preferably blood or serum, and more preferably blood or serum-derived exosomes. However, it is not limited thereto.

If the expression level of the miRNA is lower than that of the normal control group or idiopathic nephrotic syndrome patient group sample, it can be determined that the possibility of membranous glomerulonephritis is high.

According to one embodiment of the present invention, the miRNA expression level of the normal control group or the idiopathic nephrotic syndrome patient group compared to the miRNA expression level of the membranous glomerulonephritis patient group calculated as log2 (fold change) value is -2 to -5 days When it occurs, it can be judged that the possibility of membranous glomerulonephritis is high.

The expression level of the miRNA is polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), competitive RT-PCR (Competitive RT-PCR), real-time RT-PCR (Real-time RT-PCR), RNase It can be measured by one or more methods selected from the group consisting of RNase protection assay (RPA), Northern blotting, and DNA microarray chip, but is not limited thereto.

The method for providing information necessary for diagnosing membranous glomerulonephritis may further include a step of confirming an increased level of proteinuria from a sample isolated from the patient, but is not limited thereto.

Hereinafter, examples will be described in detail to aid understanding of the present invention. However, the following examples are merely illustrative of the contents of the present invention, but the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.

<Experimental example>

The following experimental examples are intended to provide items commonly applied to each embodiment according to the present invention.

1. Recruitment of analysis subjects

To discover biomarkers for diagnosis of membranous glomerulonephritis for early diagnosis of membranous glomerulonephritis and prevention of complications related to membranous glomerulonephritis, 20 normal group (HV) and 19 membranous glomerulonephritis group (MGN), respectively. 21 subjects with idiopathic nephrotic syndrome (INS) were recruited, and serum was provided from subjects in each group.

2. RNA isolation and sequencing from serum

Previously, exosomes were isolated using Exoquick (SBI, USA) from serum samples collected from subjects in each group, and total RNA was extracted from the isolated exosomes using Qiagen miRNeasy kit, and extraction The quality of total RNA obtained was measured using an Agilent RNA Bioanalyzer according to the manufacturer's instructions.

Then, using the isolated RNA, a library was prepared using the Takara SMARTer smRNA for illumina kit from Macrogen, and then microRNA was detected by next-generation sequencing (NGS) using the Hiseq 2500.

<Example 1> Discovery of microRNA for diagnosis of membranous glomerulonephritis

1. Normal vs. normal group Identification of microRNAs with differences in expression levels of idiopathic nephrotic syndrome

First, in order to identify microRNA (miRNA) with a difference in expression level in the blood-derived exosomes of 20 normal people and 21 people with idiopathic nephrotic syndrome, serum collected from each subject as in the above experimental example Exosomes were isolated from and NGS analysis was performed on the extracted total RNA. As a result of the analysis, 228 miRNAs were detected, and the expression levels of the detected miRNAs were further compared.

As a result, as shown in FIG. 1a, when comparing the normal group and the idiopathic nephrotic syndrome, 33 miRNAs showed increased expression and 11 decreased expression among 44 miRNAs with a difference of more than 2-fold and p < 0.05. Confirmed. In addition, the result of a scatter plot according to the expression level of the miRNA showing the significant expression change was confirmed as shown in FIG. 1B.

2. Idiopathic nephrotic syndrome vs. Identification of microRNAs with differences in expression levels of membranous glomerulonephritis

In order to identify miRNAs with different expression levels in the blood-derived exosomes of 21 patients with idiopathic nephrotic syndrome and 19 patients with membranous glomerulonephritis, NGS analysis was performed on total RNA in exosomes obtained in the same manner as described above. As a result of the analysis, 228 miRNAs were detected, and the expression levels of the detected miRNAs were compared.

As a result, when idiopathic nephrotic syndrome and membranous glomerulonephritis were compared, as shown in FIG. 2a, 3 out of 11 miRNAs with a 2-fold or more expression difference and p < 0.05 showed increased expression and 8 decreased expression. identified as a dog. In addition, the scatter plot result according to the expression level of the miRNA showing the significant expression change was confirmed as shown in FIG. 2b.

3. Normal control vs. Identification of microRNAs with differences in expression levels of membranous glomerulonephritis

In order to identify miRNAs having different expression levels in blood-derived exosomes of 20 normal patients and 19 patients with membranous glomerulonephritis, NGS analysis was performed on total RNA in exosomes obtained in the same manner as described above. As a result of the analysis, 228 miRNAs were detected, and the expression levels of the detected miRNAs were compared.

As a result, as shown in Figure 3a, when comparing the normal group and membranous glomerulonephritis, expression difference was more than 2 times and p < 0.05 of 58 miRNAs, 31 increased expression and 27 decreased expression. Confirmed. In addition, the scatter plot result according to the expression level of the miRNA showing the significant expression change was confirmed as shown in FIG. 3b.

4. membranous glomerulonephritis for diagnosis microRNA check

In order to discover miRNAs capable of specifically diagnosing membranous glomerulonephritis based on the results identified above, miRNAs confirmed to have significantly changed expression as a result of each analysis are shown in a Venn diagram as shown in FIG.

As a result, three miRNAs whose expression was significantly changed in membranous glomerulonephritis compared to the normal group and idiopathic nephrotic syndrome were selected.

Table 1 below shows the three miRNAs that were significantly changed.

miRNAs sequence No. compared to normal group
fold change fold change compared to idiopathic nephrotic syndrome hsa-miR-1229-3p cucucaccacugcccucccacag SEQ ID NO: 1 -2.57 (p=0.001) -2.02
(p=0.038) hsa-miR-340-3p uccgucucaguuacuuuauagc SEQ ID NO: 2 -4.53 (p<0.001) -3.45
(p=0.002) hsa-miR-99b-5p cacccguagaaccgaccuugcg SEQ ID NO: 3 -2.06 (p=0.019) -2.44
(p=0.019)

Referring to Figure 5 and Table 1 confirming the significant difference between the normal group or idiopathic nephrotic syndrome and membranous glomerulonephritis of the miRNA, the three miRNAs were 2.57 times, 4.53 times and 4.53 times respectively compared to the normal group in membranous glomerulonephritis It can be seen that it shows a significant difference of 2.06 times and shows a significant difference of 2.02 times, 3.45 times and 2.44 times compared to idiopathic nephrotic syndrome.

Therefore, the above results show that the three miRNAs whose expression is significantly changed only in membranous glomerulonephritis compared to the normal group or idiopathic nephrotic syndrome can be usefully used as biomarkers for specifically diagnosing membranous glomerulonephritis.

< Example 2> Identification of Serum Indicators

In the serum of 20 normal group (HV), 19 membranous glomerulonephritis (MGN), and 21 idiopathic nephrotic syndrome (INS) collected in the previous experimental example, the level changes of various indicators were confirmed as shown in Table 2.

Variables Study subjects P value
(MGN vs Idiopathic NS) HVs (n = 20) MGN (n = 19) Idiopathic NS
(n = 21) AGE 51.9±12.4 54.4±13.7 61.0±16.2 0.797 Sex (Male) 11 (55%) 11 (57.9%) 12 (57.1%) 0.962 WBC 5364.6±588.8 7490.7±1466.7* 6985.5±1914.1 0.96 Hb 13.9±1.3 13.2±2.0 13.7±1.7 0.398 PLT (K) 219.9±48.1 303.0±100.2* 289.3±70.3** 0.209 BUN 12.9±3.2 14.1±5.5 21.3±10.4 0.009 Cr 0.9±0.2 0.9±0.2 1.3±0.8** 0.04 eGFR 88.2±15.7 81.5±23.2 70.1±38.2 0.360 Baseline proteinuria (g/day)
82.3±49.3
7046.3±4423.2*
9023.6±4062.6**
0.220 AST 19.5±7.0 26.4±10.1* 31.1±19.5** 0.892 ALT 18.9±9.1 19.7±8.2 27.9±22.1 0.188 Total protein 7.2±0.3 4.8±0.7* 5.1±1.2** 0.366 Albumin 4.6±0.2 2.4±0.6* 2.5±1.1** 0.775 CRP 0.1±0.2 0.3±0.5* 0.2±0.2** 0.668 Total cholesterol 192.9±28.5 300.3±94.1* 340.3±116.0** 0.445 Triglycerides 108.7±48.4 332.2±214.9* 454.1±350.9** 0.871 HDL 60.8±9.3 53.1±19.0 58.1±21.4 0.552 LDL 123.8±30.1 180.8±98.7 201.9±84.3** 0.913

(* HVs vs MGN P value < 0.05; ** HVs vs Idiopathic NS P value < 0.05

HVs-Health volunteers, MGN-Membranous glomerulonephritis, NSnephrotic syndrome. Hb-hemoglobin, PLT-platelet, BUN-blood urea nitrogen, Crcreatinine, eGFR-estimated glomerular filtration rate, HDL-high density lipoprotein, LDL-low density lipoprotein)

Having described specific parts of the present invention in detail above, it is clear to those skilled in the art that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. do. That is, the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> Research Cooperation Foundation of Yeungnam University <120> BIOMARKER COMPOSITION FOR DIAGNOSING MEMBRANOUS GLOMERULONEPHRITIS AND USE THEREOF <130> ADP-2021-0250 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> RNA <213> artificial sequence <220> <223> miR-1229-3p <400> 1 cucucaccac ugcccuccca cag 23 <210> 2 <211> 22 <212> RNA <213> artificial sequence <220> <223> miR-340-3p <400> 2 uccgucucag uuacuuuaua gc 22 <210> 3 <211> 22 <212> RNA <213> artificial sequence <220> <223> miR-99b-5p <400> 3 cacccguaga accgaccuug cg 22

Claims (16)

A biomarker composition for diagnosis of membranous glomerulonephritis comprising miR-340-3p as an active ingredient. According to claim 1,
The miR-340-3p,
A biomarker composition for diagnosing membranous glomerulonephritis, characterized in that expression is reduced compared to a normal control group. According to claim 1,
The miR-340-3p,
A biomarker composition for diagnosis of membranous glomerulonephritis, characterized in that it is derived from exosomes. According to claim 3,
The exosome,
A biomarker composition for diagnosis of membranous glomerulonephritis, characterized in that it is derived from blood or serum. A composition for diagnosis of membranous glomerulonephritis comprising an agent capable of measuring the expression level of miR-340-3p as an active ingredient. According to claim 5,
The agent capable of measuring the expression level of the miR-340-3p,
A composition for diagnosing membranous glomerulonephritis, characterized in that the primer or probe specifically binds to the miR-340-3p. A diagnostic kit for membranous glomerulonephritis comprising the composition of claim 5 or claim 6. Measuring the expression level of miR-340-3p from a sample isolated from the patient; and
A method for providing information necessary for diagnosing membranous glomerulonephritis, comprising: comparing the expression level of miR-340-3p with a normal control sample. According to claim 8,
The method,
Comparing the expression level of miR-340-3p with idiopathic nephrotic syndrome patient group samples; method for providing information necessary for diagnosing membranous glomerulonephritis, characterized in that it further comprises. According to claim 8 or 9,
The sample is
A method for providing information necessary for diagnosis of membranous glomerulonephritis, characterized in that it is blood or serum. According to claim 10,
The sample is
A method for providing information necessary for diagnosis of membranous glomerulonephritis, characterized in that it is blood or serum-derived exosomes. According to claim 8,
The method,
A method for providing information necessary for diagnosing membranous glomerulonephritis, further comprising the step of determining an increased level of proteinuria from a sample isolated from the patient. According to claim 1,
The biomarker composition for diagnosing membranous glomerulonephritis is a biomarker composition for diagnosing membranous glomerulonephritis, characterized in that it contains miR-1229-3p or miR-99b-5p as an active ingredient. According to claim 5,
The composition for diagnosing membranous glomerulonephritis is a composition for diagnosing membranous glomerulonephritis, characterized in that it comprises an agent capable of measuring the expression level of miR-1229-3p or miR-99b-5p as an active ingredient. According to claim 7,
The kit for diagnosing membranous glomerulonephritis is a kit for diagnosing membranous glomerulonephritis, characterized in that it comprises a composition comprising an agent capable of measuring the expression level of miR-1229-3p or miR-99b-5p as an active ingredient. According to claim 8,
The method includes measuring the expression level of miR-1229-3p or miR-99b-5p; and
Comparing the expression level of the miR-1229-3p or miR-99b-5p with a normal control sample; a method for providing information necessary for diagnosing membranous glomerulonephritis, comprising the.

Images