KR102505618B1 - Urinary exosome-derived miRNA gene biomarkers for diagnosis of antibody-mediated rejection in kidney allografts and use thereof - Google Patents

Abstract

The present invention relates to a urine exosome-derived miRNA gene biomarker for the diagnosis of antibody-mediated rejection after kidney transplantation and its use, and more particularly to antibody-mediated rejection (ABMR) after kidney transplantation It relates to a biomarker related to, a composition for diagnosing antibody-mediated rejection, a kit, a method for providing information for diagnosing antibody-mediated rejection using the same, and a method for screening a therapeutic agent for antibody-mediated rejection.

Description

Urine exosome-derived miRNA gene biomarkers for diagnosis of antibody-mediated rejection in kidney allografts and use thereof for diagnosis of antibody-mediated rejection after kidney transplantation

The present invention relates to a urine exosome-derived miRNA gene biomarker for the diagnosis of antibody-mediated rejection after kidney transplantation and its use, and more particularly to antibody-mediated rejection (ABMR) after kidney transplantation It relates to a biomarker related to, a composition for diagnosing antibody-mediated rejection, a kit, a method for providing information for diagnosing antibody-mediated rejection using the same, and a method for screening a therapeutic agent for antibody-mediated rejection.

The field of organ transplantation is slowly becoming part of precision medicine. When using the current standard immunosuppressive treatment, acute rejection still occurs in 15 to 20% of kidney transplant patients, and so far, increased serum creatinine concentration or new proteinuria is diagnosed through tissue biopsy. . Since the renal condition at the time of an increase in serum creatinine concentration or a new expression of proteinuria is already in an advanced state of inflammation, the need for a biomarker capable of early detection of subclinical acute rejection is emerging. It is known that innate/acquired immune responses first appear at the molecular level before appearing at the histological level. Therefore, the development of non-invasive biomarkers for prediagnosing and monitoring clinical conditions after kidney transplantation is an essential step for precision medicine.

In the past, rejection after kidney transplantation was classified into ultra-acute, acute, and chronic rejection according to the time of occurrence, but recently, the Banff classification, which classifies rejection according to the mechanism of occurrence and renal biopsy findings, is mainly used. Prior to the Banff classification, the pathological diagnosis of transplanted kidneys was very simple. In particular, acute and chronic rejection were classified according to the location of inflammatory cell infiltration. vascular) was classified as rejection. In other words, from the current point of view, all of these are diagnostic classifications for T cell-mediated rejection except hyperacute rejection, and at the time, the existence of antibody-mediated rejection (ABMR), which was not a hyperacute clinical picture, was not recognized. and there was no diagnostic evidence. Hyperacute rejection is now understood to be the most severe form of acute ABMR.

Regarding the diagnosis of rejection after kidney transplantation, urine biomarkers for diagnosing acute rejection after kidney transplantation are known (Suthantiran et al., Urinary-Cell mRNA Profile and Acute Cellular Rejection in Kidney Allografts. The New England Journal of Medicine (2013) 369;1). However, a biomarker capable of distinguishing between T cell-mediated rejection and antibody-mediated rejection or simultaneously diagnosing them, furthermore, distinguishing and diagnosing BK virus nephropathy and transplant rejection, complications after kidney transplantation, or simultaneously diagnosing them There is no study to discover biomarkers that can be diagnosed and use them to select treatment directions and determine treatment progress after kidney transplantation.

On the other hand, exosomes are cell-derived endoplasmic reticulum that have markers on the surface and contain nucleic acids such as lipids, proteins, and microRNAs. It is becoming. Exosomes are secreted from epithelial cells or glomerular podocytes present in the renal tubule lumen, and specific factors in exosomes reflect the state of transplanted kidney cells to diagnose rejection after kidney transplantation. It is known to have high utilization value as a biomarker for biomarkers (Hua Zhou, Peter S. T. Yuen, Trairak Pisitkum et al. Collection, storage, preservation, and normalization of human urinary exosomes for biomarker discovery. Kidney International, 2006, 69(8) 1471-76).

Under this background, the present inventors are able to diagnose miRNA gene biomarkers capable of diagnosing antibody-mediated rejection after kidney transplantation, and differentiate antibody-mediated rejection after kidney transplantation from T cell-mediated rejection and BK virus nephropathy. The present invention was completed by selecting and confirming miRNA gene biomarkers capable of diagnosis, and/or miRNA biomarkers capable of distinguishing and diagnosing kidney transplant rejection and BK virus nephropathy after kidney transplantation.

An object of the present invention is a miRNA gene biomarker for diagnosing antibody-mediated rejection after kidney transplantation, a composition for diagnosing antibody-mediated rejection after kidney transplantation using the same, a kit, an information provision method, and antibody-mediated rejection after kidney transplantation It is to provide a method for screening a therapeutic agent for sexual rejection.

Another object of the present invention is a biomarker composition for diagnosing antibody-mediated rejection by distinguishing it from T cell-mediated rejection or BK virus nephropathy after kidney transplantation, and using the same to diagnose T-cell-mediated rejection or BK after kidney transplantation It is to provide a composition for diagnosing antibody-mediated rejection, different from viral nephropathy, a kit, an information provision method, and a method for screening a therapeutic agent for antibody-mediated rejection after kidney transplantation.

Another object of the present invention is a miRNA gene biomarker for distinguishing and diagnosing kidney transplant rejection and BK virus nephropathy, and a composition, kit, and information for distinguishing and diagnosing kidney transplant rejection and BK virus nephropathy using the same. It is to provide a provision method and a screening method for a therapeutic agent for renal transplant rejection.

Another object of the present invention is to provide a biomarker composition for predicting prognosis after kidney transplantation, a composition for predicting prognosis after kidney transplantation using the same, a kit, an information providing method, and a method for screening a therapeutic agent for rejection of kidney transplantation.

As a first aspect for solving the above problems, the present invention provides hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR Any one or more miRNAs selected from the group consisting of -103a-3p , hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p Provided is a biomarker composition for diagnosing antibody mediated rejection (ABMR), including a gene.

Regarding the first aspect, the present invention provides hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p, The expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p A composition for diagnosing antibody-mediated rejection after kidney transplantation, including an agent for measurement, and a kit including the same are provided.

According to a preferred embodiment of the present invention, the hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p Expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p An agent for measuring may include a primer or probe that specifically binds to the gene.

According to another preferred embodiment of the present invention, the kit may be a real-time PCR (RT-PCR) kit, a microarray kit, or a Serial Analysis of Gene Expression (SAGE) kit.

Regarding the first aspect, the present invention also provides an information providing method for diagnosing antibody-mediated rejection after kidney transplantation, comprising the following steps:

(a) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p in a biological sample isolated from an individual; The expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p measuring; and

(b) measured in step (a), hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a- Expression of one or more miRNA genes selected from the group consisting of 3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p comparing levels to normal control samples.

According to a preferred embodiment of the present invention, the biological sample in step (a) may be urine or urine-derived exosomes.

According to another preferred embodiment of the present invention, the information providing method (c) measured in step (a), hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328- 5p, hsa-miR-455-3p, hsa-miR-103a-3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR- When the expression level of one or more miRNA genes selected from the group consisting of 221-3p is higher than that of the normal control sample, a step of diagnosing antibody-mediated rejection after kidney transplantation may be further included.

Regarding the first aspect, the present invention also provides a method for screening a therapeutic agent for antibody-mediated rejection after kidney transplantation, comprising the following steps:

(a) processing a candidate material for antibody-mediated rejection treatment after kidney transplantation to the sample; and

(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p in samples treated with the candidate substance Expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p step of measuring.

According to a preferred embodiment of the present invention, the sample in step (a) may be urine or urine-derived exosomes.

According to another preferred embodiment of the present invention, the screening method (c) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p measured in step (b) , hsa-miR-455-3p, hsa-miR-103a-3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221 If the expression level of one or more miRNA genes selected from the group consisting of -3p is suppressed more than in the sample not treated with the candidate substance, the antibody-mediated rejection treatment after renal transplantation of the candidate substance treated in step (a) above It may additionally include the step of determining as.

As a second aspect for solving the above problems, the present invention provides hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR Antibody-mediated rejection (differentiated from T cell mediated rejection (TCMR) or BK virus nephropathy after kidney transplantation, including any one or more miRNA genes selected from the group consisting of -103a-3p ( Antibody mediated rejection (ABMR) provides a biomarker composition for diagnosing.

Regarding the second aspect, the present invention also relates to hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p A composition for diagnosing antibody-mediated rejection after kidney transplantation, differentiating from T cell-mediated rejection or BK virus nephropathy, comprising an agent for measuring the expression level of any one or more miRNA genes selected from the group consisting of; and A kit containing the same is provided.

According to a preferred embodiment of the present invention, the hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p or hsa-miR-103a-3p An agent for measuring the expression level of a miRNA gene may include a primer or probe that specifically binds to the gene.

Regarding the second aspect, the present invention also provides an information providing method for diagnosing antibody-mediated rejection after renal transplantation, which is distinguished from T cell-mediated rejection or BK virus nephropathy, comprising the following steps:

(a) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p in a biological sample isolated from an individual; Measuring the expression level of any one or more miRNA genes selected from the group consisting of; and

(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-measured in step (a) above. Comparing the expression level of one or more miRNA genes selected from the group consisting of 3p with a normal control sample.

According to a preferred embodiment of the present invention, the information providing method (c) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p measured in step (a) , When the expression level of one or more miRNA genes selected from the group consisting of hsa-miR-455-3p and hsa-miR-103a-3p is higher than that in the normal control sample, T cell-mediated after kidney transplantation A step of diagnosing rejection or antibody-mediated rejection without BK virus nephropathy may be further included.

Regarding the second aspect, the present invention also provides a method for screening a therapeutic agent for antibody-mediated rejection after kidney transplantation, comprising the following steps:

(a) treating the sample with a candidate material for the treatment of kidney transplant rejection; and

(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p in samples treated with the candidate substance Measuring the expression level of any one or more miRNA genes selected from the group consisting of.

According to a preferred embodiment of the present invention, the screening method (c) the hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, measured in step (a), When the expression level of one or more miRNA genes selected from the group consisting of hsa-miR-455-3p and hsa-miR-103a-3p is suppressed more than in the sample not treated with the candidate substance, treatment in step (a) above. A step of determining one candidate substance as a therapeutic agent for antibody-mediated rejection after kidney transplantation may be further included.

As a third aspect for solving the above problems, the present invention provides hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR -455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223 Provided is a miRNA gene biomarker composition for distinguishing and diagnosing kidney transplant rejection and BK virus nephropathy, including any one or more miRNA genes selected from the group consisting of -3p.

Regarding the third aspect, the present invention also provides hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p consisting of hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p Provided is a composition for separately diagnosing kidney transplant rejection and BK virus nephropathy, including an agent for measuring the expression level of any one or more miRNA genes selected from the group, and a kit containing the same.

According to a preferred embodiment of the present invention, the hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p consisting of hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p An agent for measuring the expression level of one or more miRNA genes selected from the group may include a primer or probe that specifically binds to the gene.

Regarding the third aspect, the present invention also provides an information providing method for diagnosing kidney transplant rejection and BK virus nephropathy, comprising the following steps:

(a) hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p in a biological sample isolated from an individual; The group consisting of hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p Measuring the expression level of any one or more miRNA genes selected from; and

(b) hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-measured in step (a) above. 3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p Comparing the expression level of any one or more miRNA genes selected from the group consisting of normal control samples.

According to a preferred embodiment of the present invention, the information providing method (c) hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p measured in step (a) , hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa - When the expression level of one or more miRNA genes selected from the group consisting of miR-19a-3p and hsa-miR-223-3p is higher than that in the normal control sample, kidney without BK virus nephropathy A step of diagnosing transplant rejection may be further included.

Regarding the third aspect, the present invention also provides a method for screening a therapeutic agent for renal transplant rejection, comprising the following steps:

(a) treating the sample with a candidate material for the treatment of kidney transplant rejection; and

(b) hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p in samples treated with the candidate substance consisting of hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p Measuring the expression level of any one or more miRNA genes selected from the group.

According to a preferred embodiment of the present invention, the screening method (c) the hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, measured in step (b), hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa- If the expression level of one or more miRNA genes selected from the group consisting of miR-19a-3p and hsa-miR-223-3p is suppressed more than in the sample not treated with the candidate substance, the candidate treated in step (a) above It may further include determining the substance as a therapeutic agent for renal transplant rejection.

As a fourth aspect for solving the above problems, the present invention provides hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p , hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa -miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR Any one selected from the group consisting of -223-3p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p Provided is a biomarker composition for predicting prognosis after kidney transplantation, including the above miRNA genes.

Regarding the fourth aspect, the present invention provides hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR- 31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455- 3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p, Expression of one or more miRNA genes selected from the group consisting of hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p It provides a composition for predicting prognosis after kidney transplantation, including an agent for measuring the level, and a kit including the same.

According to a preferred embodiment of the present invention, the hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR -31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455 -3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p , hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p, and any one or more miRNA genes selected from the group consisting of hsa-miR-125b-5p Agents for measuring expression levels may include primers or probes that specifically bind to the gene.

Regarding the fourth aspect, the present invention also provides an information providing method for predicting prognosis after kidney transplantation, which includes the following steps:

(a) hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR- 31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455- 3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p, Expression of one or more miRNA genes selected from the group consisting of hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p measuring the level; and

(b) hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa- miR-31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR- 455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223- Any one or more miRNA genes selected from the group consisting of 3p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p Comparing the expression level of with a normal control sample.

According to a preferred embodiment of the present invention, the information providing method (c) the hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa measured in step (a) -miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328 -5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p , hsa-miR-19a-3p, hsa-miR-223-3p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR If the expression level of one or more miRNA genes selected from the group consisting of -125b-5p is higher than that in the normal control sample, predicting that a poor prognosis after kidney transplantation may be further included.

In addition, as a fourth aspect, the present invention provides a screening method for a therapeutic agent for kidney transplant rejection and/or a therapeutic agent for BK virus nephropathy in a patient with poor prognosis after kidney transplantation, comprising the following steps:

(a) treating the sample with a candidate drug for renal transplant rejection and/or BK virus nephropathy; and

(b) hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR in the sample treated with the candidate substance -31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455 -3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p , hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p, and any one or more miRNA genes selected from the group consisting of hsa-miR-125b-5p Measuring the expression level.

According to a preferred embodiment of the present invention, the screening method (c) the hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-8485, hsa-miR-331-3p, hsa- miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328- 5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-4449 If the expression level of one or more miRNA genes selected from the group consisting of 125b-5p is suppressed more than in the sample not treated with the candidate substance, the candidate substance treated in step (a) is used as a renal transplant rejection drug and / or A step of determining the drug as a therapeutic agent for BK virus nephropathy may be further included.

The biomarker composition containing various combinations of miRNA genes according to the present invention can not only diagnose antibody-mediated rejection after kidney transplantation, but also treat antibody-mediated rejection after kidney transplantation as T cell-mediated rejection and/or It is possible to diagnose separately from BK virus nephropathy, and it is also possible to diagnose kidney transplant rejection and BK virus nephropathy after kidney transplant, so that the cause of kidney transplant rejection can be diagnosed more precisely and accurately. Accordingly, by providing a treatment method tailored to each patient, various symptoms after kidney transplantation can be effectively treated depending on the cause.

1 is a schematic diagram showing the selection process of biomarkers representing antibody-mediated rejection group (ABMR), T cell-mediated rejection group (TCMR), and BK virus nephropathy group (BKVN).
Figure 2 is a heat map after performing hierarchical clustering analysis (Euriclid method, complete association) to group samples and mature miRNAs with similar expression levels for important data.
Figure 3 shows the miRNA genes selected through the primary and secondary selection processes. In Figure 3 (A), miRNA genes whose expression increased by more than 2-fold based on the normal control group (NOMOA) are marked in red, and the normal control group (NOMOA), miRNA genes whose expression has decreased by more than 2 times are shown in green, and FIG. 3 (B) shows antibody-mediated rejection group (ABMR) and T cell-mediated rejection compared to normal control group (NOMOA), respectively. It shows the result of confirming the up-regulated miRNA gene whose expression level is more than 2-fold different in the sexual rejection group (TCMR) and the BK virus nephropathy group (BKVN).
Figure 4 (A) is a biomarker candidate of the antibody-mediated rejection group (ABMR), compared to the antibody-mediated rejection group (TCMR) and the BK virus nephropathy group (BKVN), five species showing a significant difference in expression pattern , and FIG. 4(B) is a graph showing that the expression level of the 5 miRNA genes is increased by more than 2 times in the antibody-mediated rejection group (ABMR) compared to the normal control group (NOMOA). .
Figure 5 (A) is a biomarker candidate of the T cell-mediated rejection group (TCMR), compared to the antibody-mediated rejection group (ABMR) and the BK virus nephropathy group (BKVN), showing a significant difference in expression patterns. Figure 5(B) shows the miRNA genes of the species, and Figure 5 (B) shows that the expression level of the 5 miRNA genes is increased by more than 2 times in the T cell-mediated rejection group (TCMR) compared to the normal control group (NOMOA). it's a graph
Figure 6 (A) is a biomarker candidate of the BK virus nephropathy group (TCMR), compared to the antibody-mediated rejection group (ABMR) and the T cell-mediated rejection group (TCMR), showing a significant difference in expression patterns. 6(B) is a graph showing that the expression level of the 5 miRNA genes is increased by more than 2 times in the BK virus nephropathy group (TCMR) compared to the normal control group (NOMOA).
Figure 7 shows that the antibody-mediated rejection group (ABMR), the T cell-mediated rejection group (TCMR), and the BK virus nephropathy group (BKVN) were significantly different from each other in comparison to the normal control group (NOMOA) after statistical analysis. Differently expressed urinary exosome miRNA genes were confirmed and shown in a Venn diagram.
Figure 8 shows the expression levels of three miRNA gene biomarkers miRNA-445-3p, miRNA-126-3p and miRNA-221-3p in a healthy control group, a normal control group (NOMOA) and an antibody-mediated rejection group (ABMR); It shows the ROC (Receiver-Operating Characteristic) curve of each miRNA gene biomarker.

As described above, miRNA gene biomarkers that can diagnose antibody-mediated rejection after kidney transplantation, antibody-mediated rejection after kidney transplantation can be differentiated from T cell-mediated rejection and BK virus nephropathy. Research to discover miRNA biomarkers and/or miRNA biomarkers that can differentiate and diagnose kidney transplant rejection and BK virus nephropathy after kidney transplantation, and use them to select treatment directions and determine treatment progress after kidney transplantation is non-existent. Accordingly, the present inventors developed a specific urine exosome miRNA gene biomarker that can differentiate and diagnose antibody-mediated rejection (ABMR), T cell-mediated rejection (TCMR) and BK virus nephropathy (BKVN) after kidney transplantation. By providing a solution to the above problem was sought. The biomarker composition containing various combinations of miRNA genes according to the present invention makes it possible to diagnose antibody-mediated rejection after kidney transplantation by distinguishing it from T cell rejection and/or BK virus nephropathy. The cause can be diagnosed more precisely and accurately, and accordingly, various symptoms that appear after kidney transplantation can be effectively treated according to the cause by providing a treatment method tailored to each patient.

Hereinafter, the present invention will be described in more detail.

All technical terms used in the present invention, unless defined otherwise, are used with the same meaning as commonly understood by one of ordinary skill in the art related to the present invention. In addition, although preferred methods or samples are described in this specification, those similar or equivalent thereto are also included in the scope of the present invention.

The first aspect of the present invention is hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p, hsa-miR -192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485, and hsa-miR-221-3p, comprising any one or more miRNA genes selected from the group consisting of, antibody-mediated It relates to a biomarker composition for diagnosing antibody mediated rejection (ABMR).

Information on the 10 miRNA gene biomarkers is shown in Table 1.

mature miRNA genes order sequence number Accession Number hsa-miR-126-3p UCGUACCGUGAGUAAUAAUGCG One MIMAT0000445 hsa-miR-126-5p CAUUAUUACUUUUGGUACGCG 2 MIMAT0000444 hsa-miR-328-5p GGGGGGGCAGGAGGGGCUCAGGG 3 MIMAT0026486 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC 4 MIMAT0004784 hsa-miR-103a-3p AGCAGCAUUGUACAGGGCUAUGA 5 MIMAT0000101 hsa-miR-192-5p CUGACCUAUGAAUUGACAGCC 6 MIMAT0000222 hsa-miR-331-3p GCCCCUGGGCCUAUCCUAGAA 7 MIMAT0000760 hsa-miR-1290 UGGAUUUUUGGAUCAGGGA 8 MIMAT0005880 hsa-miR-8485 CACACACACACACACACGUAU 9 MIMAT0033692 hsa-miR-221-3p AGCUACAUUGUCUGCUGGGUUUC 10 MIMAT0000278

In the present invention, unless otherwise specified, the term "miRNA" is transcribed as a hairpin-shaped RNA precursor, cleaved by a dsRNA cleavage enzyme having RNase III cleavage activity, introduced into a protein complex called RISC, and translated into mRNA. Non-coding RNA of 15 to 25 bases involved in inhibition is intended and used. In addition, the miRNA used in the present invention is not only miRNA represented by a specific nucleotide sequence (or sequence number), but also precursors (pre-miRNA, primiRNA) of the miRNA, and miRNAs with biological functions equivalent to these, such as homologues (i.e., homologs or orthologs), variants such as polymorphisms, and derivatives. These precursors, homologues, mutants or derivatives can be specifically identified by miRBase release 20 (http://www.mirbase.org/), and miRNAs having base sequences that hybridize with the complementary sequences of miRNAs under stringent conditions. can be heard In addition, the miRNA mentioned in the present invention may be a gene product of a miR gene, and such a gene product is a mature miRNA (eg, a ratio of 15 to 25 bases or 19 to 25 bases involved in translational inhibition of mRNA as described above). coding RNA) or miRNA precursors (eg, pre-miRNA or pri-miRNA as above).

In the present invention, the term "nucleic acid" is used for nucleic acids including both RNA, DNA, and RNA/DNA (chimera). In addition, the DNA includes all of cDNA, genomic DNA, and synthetic DNA. In addition, the RNA includes all of total RNA, mRNA, rRNA, miRNA, siRNA, snoRNA, snRNA, non-coding RNA and synthetic RNA. In the present invention, "synthetic DNA" and "synthetic RNA" are artificially produced based on a predetermined base sequence (which may be either a natural sequence or a non-natural sequence), for example, using an automatic nucleic acid synthesizer. refers to DNA and RNA. In the present invention, "non-natural sequence" is intended to be used in a broad sense, and is different from the natural sequence, for example, a sequence containing substitution, deletion, insertion and / or addition of one or more nucleotides (i.e., , variant sequences), sequences comprising one or more modified nucleotides (ie, modified sequences), and the like. Also, in the present invention, polynucleotides are used interchangeably with nucleic acids.

In the present invention, the term "renal allograft rejection" refers to a series of immune reactions that occur when the recipient's immune system recognizes the transplanted kidney as a foreign antigen, and the mechanism of development and renal biopsy Depending on the findings, it can be classified into antibody-mediated rejection (ABMR), T cell mediated rejection (TCMR), and mixed rejection in which all of these appear in combination. there is.

In the present invention, the rejection of the kidney transplant may include antibody-mediated rejection, T cell-mediated rejection, and mixed rejection, and preferably acute T cell mediated rejection (TCMR) ), chronic antibody mediated rejection (CAMR), active antibody mediated rejection, chronic active T cell mediated rejection and mixed rejection It may be selected from the group consisting of reaction (mixed rejection).

The term "biomarker" of the present invention refers to a molecule quantitatively or qualitatively associated with the presence of a biological phenomenon, and the biomarker of the present invention is a miRNA gene that can determine whether rejection or BK virus nephropathy appears after kidney transplantation. Or, it refers to a gene that serves as a standard for predicting patients with good or poor prognosis after kidney transplantation. The term includes nucleic acid sequences complementary to or flanking a marker sequence, such as nucleic acids used as probes or primer pairs capable of amplifying the marker sequence.

In the present invention, the term "prognosis" means the prediction of medical outcomes (eg, long-term viability, disease-free survival rate, etc.), and includes positive prognosis (positive prognosis) or negative prognosis (negative or poor prognosis), In the present invention, the negative prognosis includes the occurrence of various rejection reactions or diseases after kidney transplantation, and the positive prognosis means that rejection reactions or diseases do not occur after kidney transplantation.

In the present invention, the term "prediction" means to guess in advance about medical consequences, and for the purpose of the present invention, the response of a patient who has received a kidney transplant (various kidney transplant rejection, onset of BK virus infectious disease, etc.) means to guess in advance.

Among renal transplant patients, the present inventors compared the expression of the above-mentioned 10 miRNA genes in the urine of patients with antibody-mediated rejection (ABMR) compared to a normal control group (no major abnormality, NOMOA) with no major abnormality on biopsy among renal transplant patients. This increased more than 2 times, and as a result of statistical analysis, the p-value value was less than 0.05, indicating significance, indicating that these miRNA gene biomarkers can be used as diagnostic markers for antibody-mediated rejection.

Regarding the first aspect, the present invention provides hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p, The expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p A composition for diagnosing antibody-mediated rejection after kidney transplantation, including an agent for measurement, and a kit including the same are provided.

According to a preferred embodiment of the present invention, the hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p Expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p An agent for measuring may include a primer or probe that specifically binds to the gene.

In the present invention, the term "primer" is a nucleic acid sequence having a short free 3' hydroxyl group, which can form a base pair with a complementary template and serves as a starting point for copying the template. It refers to a short nucleic acid sequence that functions. In the present invention, PCR amplification is performed using sense and antisense primers of the miRNA gene, and the rejection of kidney transplantation can be diagnosed or the prognosis can be predicted by determining whether a desired product is produced. PCR conditions and lengths of sense and antisense primers can be modified based on those known in the art. In the present invention, the primers used for mRNA amplification of the gene are prepared under appropriate conditions (eg, four different nucleoside triphosphates and a polymerizing agent such as DNA, RNA polymerase or reverse transcriptase) in an appropriate buffer and at an appropriate temperature. It can be a single-stranded oligonucleotide that can serve as a starting point for template-directed DNA synthesis under the following conditions, and the appropriate length of the primer may vary depending on the purpose of use. The primer sequence does not have to be completely complementary to the polynucleotide of the miRNA gene biomarker or its complementary polynucleotide, and can be used as long as it is sufficiently complementary to hybridize.

In the present invention, the term "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to a few bases to several hundreds of bases as short as possible to achieve specific binding with mRNA, and is labeled. The presence or absence of a specific mRNA can be confirmed. The probe may be manufactured in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like. In the present invention, hybridization is performed using a miRNA gene and a complementary probe, and the rejection of kidney transplantation can be diagnosed or the prognosis can be predicted through hybridization. Selection of suitable probes and hybridization conditions can be modified based on those known in the art.

Primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method or other well-known methods. Such nucleic acid sequences can also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, capping, substitution of one or more natural nucleotides with homologues, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phosphotriesters, phosphoro amidates, carbamates, etc.) or to charged linkages (eg phosphorothioates, phosphorodithioates, etc.).

The nucleotide sequence of the agent for measuring the expression level of the miRNA gene used in the present invention is also a sequence showing substantial identity with a sequence that specifically binds to the miRNA gene, considering mutations with biologically equivalent activity. be interpreted as including The term 'substantial identity' means that when a specific sequence and any other sequence are aligned so as to correspond as much as possible, and the aligned sequence is analyzed using an algorithm commonly used in the art, at least 60 % identity, more specifically 70% identity, even more specifically 80% identity, and most specifically 90% identity.

The kit of the present invention may be a real-time PCR (RT-PCR) kit such as quantitative real-time PCR (qRT-PCR), a microarray kit, or a Serial Analysis of Gene Expression (SAGE) kit, but is not limited thereto. As a specific example, the kit may be a kit including essential elements required to perform RT-PCR. For example, the RT-PCR kit contains, in addition to each primer specific for the miRNA gene, a test tube or other suitable container, a reaction buffer (with varying pH and magnesium concentration), deoxynucleotides (dNTPs), and dideoxynucleotides (ddNTPs). ), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like. In addition, a primer pair specific to DNA, RNA or miRNA used as a quantitative control may be included.

The kit of the present invention may include a kit for extracting nucleic acid (eg, total RNA) from body fluids, cells or tissues, a fluorescent material for labeling, an enzyme and medium for amplifying nucleic acid, instructions for use, and the like.

The kit of the present invention is a device for measuring a Parkinson's disease marker in which the nucleic acid is bound or attached to, for example, a solid phase. Examples of the material of the solid phase are plastic, paper, glass, silicon, and the like, and a material of the solid phase preferable from the viewpoint of ease of processing is plastic. The shape of the solid phase is arbitrary, and is, for example, square, circular, rectangular, or film-like.

The kit of the present invention may contain a nucleic acid capable of specifically binding to at least one of the miRNAs.

Regarding the first aspect, the present invention also provides an informational method for diagnosing antibody-mediated rejection after kidney transplantation comprising the following steps:

(a) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p in a biological sample isolated from an individual; The expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p measuring; and

(b) measured in step (a), hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a- Expression of one or more miRNA genes selected from the group consisting of 3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p comparing levels to normal control samples.

In the information provision method of the present invention, the term "subject" refers to humans who are likely or have developed kidney transplant rejection or BK virus nephropathy, primates including chimpanzees, pets such as dogs and cats, and cows. , It is interpreted as meaning including livestock animals such as horses, sheep, and goats, and mammals such as rodents such as mice and rats.

In the information provision method of the present invention, the "sample" used for analysis is blood, plasma, serum, saliva, nasal fluid, sputum, ascites, vaginal secretion, urine, feces, etc. Kidney transplant rejection that can be distinguished from normal conditions or a biological sample capable of confirming miRNA genes specific to BK virus nephropathy. Preferably, it may be a biological liquid sample such as blood, serum, plasma or urine, and most preferably urine or urine-derived exosomes.

In the present invention, the term "exosome" means a cell-derived lipid bilayer vesicle. Exosomes contain unique proteins and nucleic acids derived from cells or tissues, and contain a large amount of biomarkers such as RNA and miRNA that can be used for diagnosis of various diseases.

The information providing method of the present invention may use a variety of well-known test methods, and may be performed using, for example, a hybridization method, an immunoassay method, or a gene amplification method, but is not limited thereto.

The hybridization method may be to confirm the presence of miRNA using a probe.

When the information providing method of the present invention is performed in a microarray method among hybridization methods, the above probe is used as a hybridizable array element and is immobilized on a substrate. Preferred substrates include rigid or semi-rigid supports such as membranes, filters, chips, slides, wafers, fibers, magnetic or non-magnetic beads, gels, tubing, plates, polymers, microparticles and capillaries. The hybridization array elements are arranged and immobilized on the substrate. This immobilization is carried out by chemical bonding methods or covalent bonding methods such as UV. For example, the hybridization array element may be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and may also be bonded to a polylysine-coated surface by UV. In addition, the hybridization array element may be coupled to a substrate through a linker (eg, ethylene glycol oligomer and diamine).

Meanwhile, sample DNA applied to the microarray of the present invention can be labeled and hybridized with array elements on the microarray. Hybridization conditions can be variously changed. In addition, the degree of hybridization may be detected and analyzed in various ways depending on the labeling substance.

The label of the probe may provide a signal allowing detection of hybridization, which may be linked to an oligonucleotide. Suitable labels include fluorophores (e.g., fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia)), terminal deoxynucleotidyl transferase (TdT), chromophores, chemiluminescent provided, however, that magnetic particles, radioactive isotopes (P32 or S35), mass labels, electron dense particles, enzymes (alkaline phosphatase or horseradish peroxidase), cofactors, substrates for enzymes, heavy metals (e.g., gold), and Antibodies, streptavidin, biotin, digoxigenin and haptens with specific binding partners such as chelating groups, but are not limited thereto. Labeling is performed by various methods commonly practiced in the art, such as the nick translation method, the random priming method (Multiprime DNA labeling systems booklet, “Amersham” (1989)), and the kination method (Maxam & Gilbert, Methods in Enzymology, 65:499 (1986)). The label provides a signal that can be detected by fluorescence, radioactivity, chromometry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, hybridization radiofrequency, nanocrystals.

Nucleic acid samples to be analyzed in the hybridization method can be prepared using RNA obtained from various biological samples (biosamples). The biological sample is preferably intestinal epithelial cells. Hybridization reaction-based analysis can also be performed by labeling the cDNA to be analyzed instead of the probe.

When using a probe, the probe is hybridized with the cDNA molecule. In the present invention, suitable hybridization conditions can be determined in a series of steps by an optimization procedure. This procedure is carried out as a series of procedures by those skilled in the art to establish a protocol for use in the laboratory. For example, conditions such as temperature, concentration of components, hybridization and washing time, buffer components and their pH and ionic strength depend on various factors such as probe length and GC amount and target nucleotide sequence. Detailed conditions for hybridization are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); and M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y. (1999).

After the hybridization reaction, a hybridization signal generated through the hybridization reaction is detected. Hybridization signals can be performed in various ways depending on the type of label bound to the probe, for example. For example, when a probe is labeled by an enzyme, hybridization can be confirmed by reacting a substrate of the enzyme with a hybridization reaction product. Enzyme/substrate combinations that can be used include peroxidases (e.g., horseradish peroxidase) with chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium nitrate). rate), resorufin benzyl ether, luminol, amplex red reagent (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2, 2'-Azine-di[3-ethylbenzthiazoline sulfonate]), o-phenylenediamine (OPD) and naphthol/pyronine; alkaline phosphatase with bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol-AS-B1-phosphate and ECF substrate; These include glucose oxidase, t-NBT (nitroblue tetrazolium), and m-PMS (phenzaine methosulfate). When the probe is labeled with gold particles, it can be detected by a silver staining method using silver nitrate.

When the hybridization signal to the miRNA sequence in the biological sample is up-regulated compared to the normal sample, antibody-mediated rejection is diagnosed after kidney transplantation.

The information providing method of the present invention can be performed by an immunoassay method. The immunoassay method includes radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), capture-ELISA, inhibition or hard material assay, sandwich assay, flow cytometry, immunofluorescence staining and immunophile including, but not limited to, chemical tablets. The immunoassay method is Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J.M. ed., Humana Press, NJ, 1984; and Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, incorporated herein by reference.

The information providing method of the present invention can be implemented by a gene amplification method. Detection of miRNA using a gene amplification method can be performed using various methods known in the art, and in this case, miRNA primers or probes can be used. In the case of using primers, a gene amplification reaction is performed to examine the expression level of the miRNA gene. Since the present invention analyzes the expression level of miRNA genes, the level of expression of the marker gene is determined by examining the amount of mRNA of the marker in the sample to be analyzed (eg, urine-derived exosomes). Therefore, in the present invention, in principle, a gene amplification reaction is performed using mRNA in a biological sample as a template and primers binding to mRNA or cDNA.

First, total RNA is isolated from a sample to obtain mRNA. Isolation of total RNA can be performed according to conventional methods known in the art (see: Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold pring Harbor Press (2001); Tesniere, C. et al., PlantMol. Biol. Rep., 9:242 (1991) Ausubel, F.M. et al., Current Protocols in Molecular Biology, John Willey & Sons (1987) and Chomczynski, P. et al., Anal. Biochem. 162:156 (1987)). For example, total RNA in cells can be easily isolated using Trizol.

Then, cDNA is synthesized from the isolated mRNA, and this cDNA is amplified. Since the total RNA of the present invention is isolated from human samples, mRNA has a poly-A tail at the end, and cDNA can be easily synthesized using oligo dT primers and reverse transcriptase using this sequence characteristic ( References: PNAS USA, 85:8998 (1988) Libert F, et al., Science, 244:569 (1989) and Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)). Subsequently, the synthesized cDNA is amplified through a gene amplification reaction. The primer used in the present invention is hybridized or annealed to one site of the template to form a double-stranded structure. Conditions of nucleic acid hybridization suitable for forming such a double-stranded structure are Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001) and Haymes, B. D., et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985).

A variety of DNA polymerases can be used for the amplification of the present invention, including the “Klenow” fragment of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase. Polymerases are thermostable DNA polymerases available from various bacterial species, including Thermus aquaticus (Taq), Thermusthermophilus (Tth), Thermusfiliformis, Thermisflavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu). When carrying out the polymerization reaction, it is preferable to provide the reaction vessel with components necessary for the reaction in excess. An excess of components required for the amplification reaction means an amount to the extent that the amplification reaction is not substantially limited by the concentration of the components. Cofactors such as Mg 2+ , dATP, dCTP, dGTP and dTTP are preferably provided in the reaction mixture in such a way that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In effect, the buffer brings all enzymes closer to optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reactant without changing conditions such as addition of reactants.

In the present invention, annealing or hybridization is performed under stringent conditions enabling specific binding between the target nucleotide sequence and the primer. Stringent conditions for annealing are sequence-dependent and vary depending on environmental variables.

As used herein, the term "amplification reaction" refers to a reaction that amplifies a nucleic acid molecule. Various amplification reactions have been reported in the art, including polymerase chain reaction (hereinafter referred to as PCR) (U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcription-polymerase chain reaction (hereinafter referred to as RT-PCR) (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)), Miller, H. I. (WO 89/06700) and Davey, C. et al. (EP 329,822) method, ligase chain reaction chain reaction; LCR) (17, 18), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA) (19) (WO 88/10315), self sustained sequence replication (20) (WO 90/06995), selective amplification of target polynucleotide sequences (U.S. Patent No. 6,410,276), consensus sequence primed polymerase chain reaction (CP-PCR) (US Pat. No. 4,437,975) and loopmediated isothermal amplification (LAMP). Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617 and U.S. Patent No. 09/854,317. The gene amplification method of the present invention may be performed according to the PCR (polymerase chain reaction) disclosed in US Patent Nos. 4,683,195, 4,683,202 and 4,800,159.

PCR is the most well-known nucleic acid amplification method, and many variations and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction chain reaction (IPCR), vectorette PCR, thermal asymmetric interlaced PCR (TAIL-PCR) and multiplex PCR have been developed for specific applications. For details on PCR, see McPherson, M.J., and Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000), the teachings of which are incorporated herein by reference.

Primers used in the gene amplification method in the present invention are oligonucleotides having a sequence complementary to the cDNA sequence of the miRNA. The suitable length of a primer varies depending on various factors, such as temperature and use of the primer, but is typically 15-30 nucleotides. Shorter primer molecules generally require lower temperatures to form a sufficiently stable hybrid complex with the template.

The sequence of the primer does not have to have a sequence completely complementary to a part of the sequence of the template, and it is sufficient to have sufficient complementarity within the range of hybridizing with the template to perform the specific function of the primer. Therefore, the primer set in the present invention does not have to have a sequence perfectly complementary to the cDNA sequence of the marker as a template, and it is sufficient to have sufficient complementarity within the range in which the primer can function as a primer by hybridizing to this sequence. Preferably, the primer used in the present invention may have a sequence perfectly complementary to the cDNA sequence of the marker.

The design of such primers can be easily performed by those skilled in the art by referring to the cDNA sequence of the miRNA, for example, using a primer design program (eg, PRIMER 3 program).

The amplified cDNA of the marker is analyzed by an appropriate method to examine the expression level of the marker gene. For example, the expression level of the marker gene is investigated by subjecting the amplification reaction product described above to gel electrophoresis and observing and analyzing a band formed as a result.

The normal control group refers to a normal person who has not undergone a kidney transplant or who has undergone a kidney transplant, but has stable kidney function, has no major abnormal findings on histological examination, antibody-mediated rejection, T cell-mediated rejection, mixed rejection or BK virus Kidney transplant patients without nephropathy, etc., and gene expression levels or expression patterns in samples collected from these patients and samples collected from patients who want to know the existence or prognosis of kidney transplant rejection or BK virus nephropathy. By obtaining and comparing, the patient's prognosis can be accurately predicted.

The information providing method related to the first aspect of the present invention is (c) measured in step (a), hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa- miR-455-3p, hsa-miR-103a-3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p When the expression level of one or more miRNA genes selected from the group consisting of is higher than that of the normal control sample, a step of diagnosing antibody-mediated rejection after kidney transplantation may be further included.

Specifically, hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p, hsa-miR-192-5p , hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p, the expression level of any one or more miRNA genes selected from the group consisting of normal control samples If it is up-regulated by 100% or more, preferably by 200% or more, antibody-mediated rejection can be diagnosed.

Regarding the first aspect, the present invention also provides a method for screening a therapeutic agent for antibody-mediated rejection after kidney transplantation, comprising the following steps:

(a) processing a candidate material for antibody-mediated rejection treatment after kidney transplantation to the sample; and

(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p in samples treated with the candidate substance Expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p step of measuring.

In the therapeutic agent screening method of the present invention, the "sample" used for analysis is the same as the sample used in the information providing method.

The term of the present invention, "candidate for antibody-mediated rejection treatment", "candidate for T cell-mediated rejection treatment", "candidate for kidney transplant rejection treatment" or "candidate for BK virus nephropathy treatment" It is a substance expected to be able to treat antibody-mediated rejection, T cell-mediated rejection, kidney transplant rejection, or BK virus nephropathy, and directly or indirectly improves or improves kidney transplant rejection or BK virus nephropathy. Any material that is expected to be able to treat can be used without limitation, and includes all expected therapeutic substances such as compounds, genes, or proteins.

In the therapeutic agent screening method of the present invention, any method known to those skilled in the art may be used for the step (b) of measuring the expression level of the miRNA gene. Specifically, PCR, ligase chain reaction (LCR), transcription amplification, self-maintained sequence replication, nucleic acid-based sequence amplification (NASBA), co-immunoprecipitation assay (Co-Immunoprecipitation assay), ELISA (Enzyme Linked Immunosorbent Assay), real-time RT-PCR, etc. may be used, but are not limited thereto.

The therapeutic agent screening method related to the first aspect of the present invention is (c) the hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa- miR-455-3p, hsa-miR-103a-3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p When the expression level of one or more miRNA genes selected from the group consisting of is suppressed more than in the sample not treated with the candidate material, the candidate material treated in step (a) is judged as a therapeutic agent for antibody-mediated rejection after kidney transplantation Additional steps may be included.

The second aspect of the present invention is from the group consisting of hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p Diagnosis of antibody mediated rejection (ABMR) by distinguishing it from T cell mediated rejection (TCMR) or BK virus nephropathy after kidney transplantation, including any one or more selected miRNA genes It relates to a biomarker composition for

Information on the five miRNA gene biomarkers is as described in Table 1 above.

The term of the present invention, "BK virus nephropathy (BKVN)" means a kidney disease caused by the BK virus, and is referred to as BK virus nephropathy or nephropathy. Nephropathy refers to a condition in which a lesion occurs in the kidney, and refers to all cases in which the unit of disease is not established or the lesion is unclassifiable. Mainly, it occurs as a complication of immunosuppressant administration in kidney transplant patients, and the BK virus invades the epithelial cells of the transplant gland, causes inflammation, and eventually causes functional deterioration of the transplanted kidney.

As used herein, the term "BK virus (BKV)" refers to a virus belonging to Papovavirus. Mainly, it is isolated from the urine of cancer patients undergoing chemotherapy and patients with Wiskott-Aldrich syndrome.

The present inventors compared antibody-mediated rejection group (TCMR) and BK virus nephropathy group (BKVN) with no major abnormality (NOMOA), T cell-mediated rejection group (BKVN) among renal transplant patients without major abnormalities in histological examination. In the urine of patients with rejection (ABMR), the expression of the above-mentioned 5 miRNA genes increased more than 2-fold, and as a result of statistical analysis, the p-value value was less than 0.05, indicating significance. It was found that it can be used as a diagnostic marker for antibody-mediated rejection and/or antibody-mediated rejection without BK virus nephropathy.

Regarding the second aspect, the present invention also relates to hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p A composition for diagnosing antibody-mediated rejection after kidney transplantation, differentiating from T cell-mediated rejection or BK virus nephropathy, comprising an agent for measuring the expression level of any one or more miRNA genes selected from the group consisting of; and A kit containing the same is provided.

According to a preferred embodiment of the present invention, the hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p or hsa-miR-103a-3p An agent for measuring the expression level of a miRNA gene may include a primer or probe that specifically binds to the gene.

Regarding the second aspect, the present invention also provides an information providing method for diagnosing antibody-mediated rejection after renal transplantation, which is distinguished from T cell-mediated rejection or BK virus nephropathy, comprising the following steps:

(a) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p in a biological sample isolated from an individual; Measuring the expression level of any one or more miRNA genes selected from the group consisting of; and

(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-measured in step (a) above. Comparing the expression level of one or more miRNA genes selected from the group consisting of 3p with a normal control sample.

According to a preferred embodiment of the present invention, the information providing method (c) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p measured in step (a) , When the expression level of one or more miRNA genes selected from the group consisting of hsa-miR-455-3p and hsa-miR-103a-3p is higher than that in the normal control sample, T cell-mediated after kidney transplantation A step of diagnosing rejection or antibody-mediated rejection without BK virus nephropathy may be further included.

Specifically, any one selected from the group consisting of hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p If the expression level of the above miRNA genes is up-regulated by 100% or more, preferably 200% or more, than the expression level in the normal control sample, T cell-mediated rejection and/or antibody-mediated rejection without BK virus nephropathy It can be diagnosed as sexual rejection.

Regarding the second aspect, the present invention also provides a method for screening a therapeutic agent for antibody-mediated rejection after kidney transplantation, comprising the following steps:

(a) treating the sample with a candidate material for the treatment of kidney transplant rejection; and

(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p in samples treated with the candidate substance Measuring the expression level of any one or more miRNA genes selected from the group consisting of.

According to a preferred embodiment of the present invention, the screening method (c) the hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, measured in step (a), When the expression level of one or more miRNA genes selected from the group consisting of hsa-miR-455-3p and hsa-miR-103a-3p is suppressed more than in the sample not treated with the candidate substance, treatment in step (a) above. A step of determining one candidate substance as a therapeutic agent for antibody-mediated rejection after kidney transplantation may be further included.

Regarding the second aspect of the present invention, the description of the same parts as the first aspect is omitted.

The third aspect of the present invention is hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR -126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, selected from the group consisting of hsa-miR-19a-3p and hsa-miR-223-3p It relates to a miRNA gene biomarker composition for distinguishing and diagnosing kidney transplant rejection and BK virus nephropathy, including any one or more miRNA genes.

Information on biomarkers not listed in Table 1 among the 11 miRNA gene biomarkers is listed in Table 2.

mature miRNA genes order sequence number Accession Number hsa-miR-345-5p GCUGACUCCUAGUCCAGGGCUC 11 MIMAT0000772 hsa-miR-215-5p AUGACCUAUGAAUUGACAGAC 12 MIMAT0000272 hsa-miR-1273g-3p ACCACUGCACUCCAGCCUGAG 13 MIMAT0022742 hsa-miR-19a-3p UGUGCAAAUCUAUGCAAAACUGA 14 MIMAT0000073 hsa-miR-223-3p UGUCAGUUUGUCAAAUACCCCA 15 MIMAT0000280

The present inventors compared antibody-mediated rejection group (ABMR) and T cell-mediated rejection group (TCMR) with no major abnormality (NOMOA) among renal transplant patients. The expression of the above-mentioned 11 miRNA genes in the urine of patients with the disease increased more than twice, and as a result of statistical analysis, the p-value value was less than 0.05, indicating significance. Since there was no significant increase in expression, it was found that these miRNA gene biomarkers can be used as markers for diagnosing kidney transplant rejection and BK virus nephropathy.

Regarding the third aspect, the present invention also provides hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p consisting of hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p Provided is a composition for separately diagnosing kidney transplant rejection and BK virus nephropathy, including an agent for measuring the expression level of any one or more miRNA genes selected from the group, and a kit containing the same.

According to a preferred embodiment of the present invention, the hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p consisting of hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p An agent for measuring the expression level of one or more miRNA genes selected from the group may include a primer or probe that specifically binds to the gene.

Regarding the third aspect, the present invention also provides an information providing method for diagnosing kidney transplant rejection and BK virus nephropathy, comprising the following steps:

(a) hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p in a biological sample isolated from an individual; The group consisting of hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p Measuring the expression level of any one or more miRNA genes selected from; and

(b) hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-measured in step (a) above. 3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p Comparing the expression level of any one or more miRNA genes selected from the group consisting of normal control samples.

According to a preferred embodiment of the present invention, the information providing method (c) hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p measured in step (a) , hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa - When the expression level of one or more miRNA genes selected from the group consisting of miR-19a-3p and hsa-miR-223-3p is higher than that in the normal control sample, kidney without BK virus nephropathy A step of diagnosing transplant rejection may be further included.

Specifically, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p At least one miRNA selected from the group consisting of hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p When the expression level of the gene is up-regulated by 100% or more, preferably by 200% or more, compared to the expression level in the normal control sample, kidney transplant rejection without BK virus nephropathy can be diagnosed.

Regarding the third aspect, the present invention also provides a method for screening a therapeutic agent for renal transplant rejection, comprising the following steps:

(a) treating the sample with a candidate material for the treatment of kidney transplant rejection; and

(b) hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p in samples treated with the candidate substance consisting of hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p Measuring the expression level of any one or more miRNA genes selected from the group.

According to a preferred embodiment of the present invention, the screening method (c) the hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, measured in step (b), hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa- If the expression level of one or more miRNA genes selected from the group consisting of miR-19a-3p and hsa-miR-223-3p is suppressed more than in the sample not treated with the candidate substance, the candidate treated in step (a) above It may further include determining the substance as a therapeutic agent for renal transplant rejection.

Regarding the third aspect of the present invention, the description of the same parts as the first aspect is omitted.

The fourth aspect of the present invention is hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p , hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa -miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p, hsa-miR -205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p, comprising any one or more miRNA genes selected from the group consisting of elongation It relates to a biomarker composition for predicting prognosis after transplantation.

Information on biomarkers not listed in Tables 1 and 2 among the 23 miRNA gene biomarkers is listed in Table 3.

mature miRNA genes order sequence number Accession Number hsa-miR-19b-3p UGUGCAAAUCCAUGCAAAACUGA 16 MIMAT0000074 hsa-miR-31-5p AGGCAAGAUGCUGGCAUAGCU 17 MIMAT0000089 hsa-miR-17-5p CAAAGUGCUUACAGUGCAGGUAG 18 MIMAT0000070 hsa-miR-205-5p UCCUUCAUUCCACCGGAGUCUG 19 MIMAT0000266 hsa-miR-4449 CGUCCCGGGGCUGCGCGAGGCA 20 MIMAT0018968 hsa-miR-106a-5p AAAAGUGCUUACAGUGCAGGUAG 21 MIMAT0000103 hsa-miR-514a-3p AUUGACACUUCUGUGAGUAGA 22 MIMAT0002883 hsa-miR-125b-5p UCCCUGAGACCCUAACUUGUGA 23 MIMAT0000423

The present inventors compared antibody-mediated rejection (ABMR), T-cell-mediated rejection (TCMR) and BK virus in renal transplant patients compared to normal controls (no major abnormality, NOMOA) with no major abnormalities on histological examination. In the urine of patients with nephropathy (BKVN), the expression of the above-mentioned 23 miRNA genes increased more than 2-fold, and as a result of statistical analysis, the p-value value was less than 0.05, indicating significance. It was found that it can be used as a marker for predicting post-prognosis.

Regarding the fourth aspect, the present invention provides hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR- 31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455- 3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p, Expression of one or more miRNA genes selected from the group consisting of hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p It provides a composition for predicting prognosis after kidney transplantation, including an agent for measuring the level, and a kit including the same.

According to a preferred embodiment of the present invention, the hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR -31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455 -3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p , hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p, and any one or more miRNA genes selected from the group consisting of hsa-miR-125b-5p Agents for measuring expression levels may include primers or probes that specifically bind to the gene.

Regarding the fourth aspect, the present invention also provides an information providing method for predicting prognosis after kidney transplantation, which includes the following steps:

(a) hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR- 31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455- 3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p, Expression of one or more miRNA genes selected from the group consisting of hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p measuring the level; and

(b) hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa- miR-31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR- 455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223- Any one or more miRNA genes selected from the group consisting of 3p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p Comparing the expression level of with a normal control sample.

According to a preferred embodiment of the present invention, the information providing method (c) the hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa measured in step (a) -miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328 -5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p , hsa-miR-19a-3p, hsa-miR-223-3p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR If the expression level of one or more miRNA genes selected from the group consisting of -125b-5p is higher than that in the normal control sample, predicting that a poor prognosis after kidney transplantation may be further included.

Specifically, hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR -17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126 -3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p, hsa-miR-205-5p , hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p, the expression level of any one or more miRNA genes selected from the group consisting of normal control samples If the expression level is up-regulated by 100% or more, preferably by 200% or more, it can be predicted to have a poor prognosis after kidney transplantation.

In the information provision method of the fourth aspect, “poor prognosis after kidney transplantation” means kidney transplantation rejection including antibody-mediated rejection and T cell-mediated rejection and/or BK virus nephropathy.

Regarding the fourth aspect, the present invention also provides a method for screening a therapeutic agent for rejection of kidney transplantation and/or a therapeutic agent for BK virus nephropathy in a patient with poor prognosis after kidney transplantation, comprising the following steps:

(a) treating the sample with a candidate drug for renal transplant rejection and/or BK virus nephropathy; and

(b) hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR in the sample treated with the candidate substance -31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455 -3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p , hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p, and any one or more miRNA genes selected from the group consisting of hsa-miR-125b-5p Measuring the expression level.

According to a preferred embodiment of the present invention, the screening method (c) the hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-8485, hsa-miR-331-3p, hsa- miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328- 5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-4449 If the expression level of one or more miRNA genes selected from the group consisting of 125b-5p is suppressed more than in the sample not treated with the candidate substance, the candidate substance treated in step (a) is used as a renal transplant rejection drug and / or A step of determining the drug as a therapeutic agent for BK virus nephropathy may be further included.

Regarding the fourth aspect of the present invention, the description of the same parts as the first aspect is omitted.

Hereinafter, the present invention will be described in more detail through examples. However, the present invention can be made with various changes and can have various forms, and the specific embodiments and descriptions described below are only intended to help the understanding of the present invention, and the present invention is limited to specific disclosure forms. It's not something I want to do. It should be understood that the scope of the present invention includes all modifications, equivalents and substitutes included in the spirit and scope of the present invention.

sample preparation

1-1. Selection of patients and preparation of urine samples

In order to discover biomarkers for diagnosing antibody-mediated rejection of kidney transplant patients, urine samples were taken 2 to 3 hours before biopsy in 15 patients who underwent an indication biopsy within 5 years after kidney transplantation. collected. In addition, urine samples were collected from living kidney donors immediately before kidney donation surgery. Patients were classified into 4 groups according to the pathological diagnosis of biopsy, as shown in Table 4; Antibody-mediated rejection (ABMR) 4 groups, T cell-mediated rejection (TCMR) 4 groups, BK virus nephropathy (BKVN) 3 groups and no major abnormality (NOMOA) 4 groups, mixed allogeneic Urine from patients with diseased lesions was excluded. The collected urine samples were centrifuged at 4,000 rpm and 4° C. for 15 minutes with a protease inhibitor mixture, and the supernatant was collected and stored frozen until use. This study was conducted with the approval of the Medical Institution Evaluation Committee of Asan Medical Center, and written informed consent was obtained from all patients.

sample name group order One Bx579-1 NOMOA 1805KHP-0067 2 Bx613 NOMOA 1808AHP-0002 3 Bx623-1 NOMOA 1808AHP-0002 4 Bx632 NOMOA 1808AHP-0002 5 Bx144 TCMR 1805KHP-0067 6 Bx39-1 TCMR 1805KHP-0067 7 Bx201-1 TCMR 1805KHP-0067 8 Bx175 TCMR 1808AHP-0002 9 Bx107 BKVN 1805KHP-0067 10 Bx650 BKVN 1805KHP-0067 11 Bx98-1 BKVN 1805KHP-0067 12 Bx85 ABMR 1804AHP-0057 13 Bx376 ABMR 1804AHP-0057 14 Bx326 ABMR 1804AHP-0057 15 Bx605 ABMR 1804AHP-0057

1-2. Urine-derived exosome isolation and miRNA isolation in exosomes

The cryopreserved urine was thawed at room temperature (RT) and centrifuged at 4° C. at 17,000xg for 15 minutes to remove cell debris, and then the supernatant was filtered through a 450 nm filter. After obtaining the precipitate by centrifugation at 200,000xg for 1 hour using an ultra-high-speed centrifuge, washing with PBS at 200,000xg for 1 hour, dissolving in PBS in a volume of 200ul to collect exosomes, small RNA isolation kit (miRNeasy mini kit, Quiagen) according to the suggested method, and RNA was isolated and stored at 80°C.

Selection and validation of miRNA gene biomarker candidates

In order to select a specific biomarker representing each pathological group, a t-test was used to select a miRNA gene that showed a difference of more than 2 times and P<0.05 when ABMR, TCMR and BKVN were compared with the NOMOA group, respectively. did. RNA was requested to an RNA-seq performer using an RNA bioanalyzer pico 6000 chip, and a library was produced with an Illumnia smarter kit after QC. RNA-seq was amplified by adapter ligation and RT-RCR method to a 20nt genome through size fractionation, followed by sequencing by Hi-seq. As a result, the expression level was more than twice as high as that of the normal group, and miRNAs with statistically significant expression were selected.

A more specific miRNA gene biomarker candidate selection process is as follows.

As shown in FIG. 1, as a first step, 2,588 mature miRNAs were selected from the 15 samples prepared in Example 1 above. As a second step, for important data, hierarchical clustering analysis (Euriclid method, complete association) was performed to group samples and mature miRNAs with similar expression levels, and this is shown as a heatmap in FIG. 2 . For each mature miRNA, among a total of 2,588 mature miRNAs in 15 samples, mature miRNAs with a count value of 0 were excluded from the analysis, and statistical analysis was performed on 892 mature miRNAs.

Through the first and second selection process, genes whose expression increased or decreased by more than 2 times based on the NOMOA group and whose p-value was 0.05 or less as a result of statistical analysis were selected and filtered to generate ABMR, TCMR and TCMR compared to NOMOA. Up- or down-regulated miRNAs were identified in BKVN patients. miRNAs with increased expression levels are shown in red, and miRNAs with reduced expression levels are shown in green, as shown in FIG. 3(A). In particular, as shown in FIG. 3(B), 10 miRNA genes whose expression levels increased in the ABMR group compared to the NOMOA group, 11 in TCMR patients, and 12 in BKVN were finally selected, and the lists are shown in Table 5.

group number of biomarkers Selected miRNA genes ABMR 10 hsa-miR-8485
hsa-miR-221-3p
hsa-miR-331-3p
hsa-miR-1290
hsa-miR-192-5p
hsa-miR-126-5p
hsa-miR-328-5p
hsa-miR-103a-3p
hsa-miR-455-3p
hsa-miR-126-3p TCMR 11 hsa-miR-8485
hsa-miR-221-3p
hsa-miR-19b-3p
hsa-miR-31-5p
hsa-miR-17-5p
hsa-miR-192-5p
hsa-miR-345-5p
hsa-miR-215-5p
hsa-miR-1273g-3p
hsa-miR-19a-3p
hsa-miR-223-3p BKVN 12 hsa-miR-8485
hsa-miR-221-3p
hsa-miR-331-3p
hsa-miR-1290
hsa-miR-19b-3p
hsa-miR-31-5p
hsa-miR-17-5p
hsa-miR-205-5p
hsa-miR-4449
hsa-miR-106a-5p
hsa-miR-514a-3p
hsa-miR-125b-5p

Identification of pathological groups according to selected miRNA gene biomarkers

3-1. Identification of miRNA gene biomarkers showing increased expression levels in the ABMR group compared to the TCMR and BKVN groups

Among the miRNA genes whose expression levels increased in the ABMR group compared to the NOMOA group selected in Example 2, 5 miRNA genes showing significant differences in expression compared to the TCMR and BKVN groups were selected, and the results are shown in FIG. 4(A). showed up As confirmed in Figure 4 (A), hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p The five miRNA genes in showed significant differences in expression patterns compared to the TCMR group and the BKVN group. In addition, as shown in FIG. 4(B) and Table 6, the expression level of the 5 miRNA genes increased more than 2-fold in the ABMR group compared to the NOMOA group, and it was confirmed that there was statistical significance at p<0.05.

fc and p values for the 5 miRNA genes whose expression levels increased in the ABMR group compared to the NOMOA group mature miRNAs ABMR/NOMOA.fc ABMR/NOMOA.
raw. pval hsa-miR-126-3p 68.50836132 0.001521504 hsa-miR-328-5p 18.95670412 0.028949512 hsa-miR-126-5p 6.349283058 0.04204756 hsa-miR-455-3p 4.462248233 0.030123151 hsa-miR-103a-3p 3.468801322 0.041345617

Through these results, it can be confirmed that the 5 kinds of miRNA genes can be used as biomarkers for diagnosing ABMR by distinguishing them from TCMR or BKVN as well as the normal group.

3-2. Identification of miRNA gene biomarkers showing increased expression levels in the TCMR group compared to the ABMR and BKVN groups

Among the miRNA genes whose expression levels increased in the TCMR group compared to the NOMOA group selected in Example 2, 5 miRNA genes showing significant differences in expression compared to the ABMR and BKVN groups were selected, and the results are shown in FIG. 5(A). showed up As confirmed in Figure 5 (A), hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p The five miRNA genes in showed significant differences in expression patterns compared to the ABMR group and the BKVN group. In addition, as shown in FIG. 5(B) and Table 7, the expression level of the 5 miRNA genes increased more than 2-fold in the TCMR group compared to the NOMOA group, and it was confirmed that there was statistical significance at p<0.05.

fc and p values for 5 miRNA genes whose expression levels increased in the TCMR group compared to the NOMOA group mature miRNAs TCMR/NOMOA.fc TCMR/NOMOA.
raw. pval hsa-miR-223-3p 32.74820417 0.048789474 hsa-miR-215-5p 15.7181011 0.000681271 hsa-miR-345-5p 4.382669986 0.027876534 hsa-miR-19a-3p 3.350489467 0.038075117 hsa-miR-1273g-3p 2.611936568 0.021783891

Through these results, it can be confirmed that the 5 kinds of miRNA genes can be used as biomarkers for diagnosing ABMR by distinguishing them from not only the normal group but also ABMR or BKVN.

3-3. Identification of miRNA gene biomarkers showing increased expression levels in the BKVN group compared to the ABMR and TCMR groups

Among the miRNA genes whose expression levels increased in the BKVN group compared to the NOMOA group selected in Example 2, 5 miRNA genes showing significant differences in expression patterns compared to the ABMR and TCMR groups were selected, and the results are shown in FIG. 6(A). showed up As confirmed in Figure 6 (A), hsa-miR-4449, hsa-miR-514a-3p, hsa-miR-106a-5p, hsa-miR-205-5p and hsa-miR-125b-5p of 5 There was a significant difference in the expression pattern of the miRNA genes of the species compared to the ABMR and TCMR groups. In addition, as shown in Figure 6 (B) and Table 8, the expression level of the 5 miRNA genes increased more than 2 times in the BKVN group compared to the NOMOA group, and it was confirmed that there was statistical significance with p <0.05.

fc and p values for the 5 miRNA genes whose expression levels increased in the BKVN group compared to the NOMOA group mature miRNAs BKVN/NOMOA.fc BKVN/NOMOA.
raw. pval hsa-miR-4449 97.73931542 0.002109469 hsa-miR-514a-3p 27.83153494 0.04499645 hsa-miR-106a-5p 10.65524582 0.02574265 hsa-miR-205-5p 5.24474511 0.035616063 hsa-miR-125b-5p 3.278234589 0.049386561

Through these results, it can be confirmed that the 5 kinds of miRNA genes can be used as biomarkers for diagnosing BKVN by distinguishing them from not only the normal group but also ABMR or TCMR.

3-4. Grouping of biomarkers according to pathological group

Based on the above results, the biomarker list in Table 2 was regrouped as shown in Table 9, which is shown in a Venn diagram in FIG. 7.

group number of biomarkers Selected miRNA genes ABMR BKVN TCMR 2 hsa-miR-8485
hsa-miR-221-3p ABMR BKVN 2 hsa-miR-331-3p
hsa-miR-1290 BKVN TCMR 3 hsa-miR-19b-3p
hsa-miR-31-5p
hsa-miR-17-5p ABMR TCMR One hsa-miR-192-5p ABMR 5 hsa-miR-126-5p
hsa-miR-328-5p
hsa-miR-103a-3p
hsa-miR-455-3p
hsa-miR-126-3p TCMR 5 hsa-miR-345-5p
hsa-miR-215-5p
hsa-miR-1273g-3p
hsa-miR-19a-3p
hsa-miR-223-3p BKVN 5 hsa-miR-205-5p
hsa-miR-4449
hsa-miR-106a-5p
hsa-miR-514a-3p
hsa-miR-125b-5p

Using the grouped biomarkers as described above, antibody-mediated rejection, T cell rejection, and BK virus nephropathy after kidney transplantation can be separately diagnosed.

Validation of selected miRNA biomarkers

In the grouped biomarkers in Table 9, miRNA-445-3p and miRNA-126-3p, whose expression levels specifically increased in the ABMR group, and miRNA-221-3p, whose expression levels increased in all of the ABMR, BKVN, and TCMR groups, verification was conducted.

As in Example 1, urine samples were collected 2-3 hours before biopsy for patients who underwent indication biopsy within 5 years after kidney transplantation, and urine samples were collected immediately before kidney donation surgery from live kidney donors. . As shown in Table 4, the patients were classified into 4 groups according to the pathological diagnosis of the biopsy, and the urine of patients with mixed allopathic lesions was excluded. Living kidney donors were selected as healthy controls, and urine samples were collected immediately before kidney donation surgery.

The number of samples used for verification of each biomarker is shown in Table 10.

miRNAs a stalwart opponent NOMOA ABMR miR-445-3p 9 8 20 miR-126-3p 9 8 20 miR-221-3p 7 7 20

The collected urine samples were centrifuged at 4,000 rpm and 4° C. for 15 minutes with a protease inhibitor mixture, and the supernatant was collected and stored frozen until use. This study was conducted with the approval of the Medical Institution Evaluation Committee of Asan Medical Center, and written informed consent was obtained from all patients.

Thereafter, samples were treated in the same manner as in Example 1-2 for the isolation of urine-derived exosomes and miRNAs in exosomes, and then RT-PCR was performed on the three types of miRNAs in Table 10. Gene expression levels were analyzed using QuantStudio ^TM Real-Time PCR software (Applied Biosystems).

As confirmed in FIG. 8 , miRNA-445-3p, miRNA-126-3p, and miRNA-221-3p all showed significantly higher expression levels in the ABMR group than in the NOMOA group. As a result of drawing a Receiver-Operating Characteristic (ROC) curve and obtaining AUC (Area under the ROC curve; AUC) values for these results, as shown in Table 11, miRNA-445-3p was 0.825 and miRNA-126-3p was 0.944. , miRNA-221-3p showed a very high value of 0.887, confirming that all three biomarkers are clinically very useful for ABMR diagnosis.

miRNAs AUC Sensitivity (%) Specificity (%) Cut off value miR-445-3p 0.825 90 62.5 >29.91 miR-126-3p 0.944 85 100 >1.324 miR-221-3p 0.887 89.47 85.71 >12.30

SEQUENCE LISTING <110> THE ASAN FOUNDATION University of Ulsan Foundation For Industry Cooperation <120> Urinary exosome-derived miRNA gene biomarkers for diagnosis of antibody-mediated rejection in kidney allografts and use thereof <130> 1067970 <150> KR 10-2019-0104723 <151> 2019-08-26 <160> 23 <170> PatentIn version 3.2 <210> 1 <211> 22 <212> RNA <213> artificial <220> <223> hsa-miR-126-3p <400> 1 ucguaccgug aguaauaug cg 22 <210> 2 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-126-5p <400> 2 cauuauuacu uuugguacgc g 21 <210> 3 <211> 23 <212> RNA <213> artificial <220> <223> hsa-miR-328-5p <400> 3 gggggggcag gaggggcuca ggg 23 <210> 4 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-455-3p <400> 4 gcaguccaug ggcauauaca c 21 <210> 5 <211> 23 <212> RNA <213> artificial <220> <223> hsa-miR-103a-3p <400> 5 agcagcauug uacaggggcua uga 23 <210> 6 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-192-5p <400> 6 cugaccuaug aauugacagc c 21 <210> 7 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-331-3p <400> 7 gccccugggc cuauccuaga a 21 <210> 8 <211> 19 <212> RNA <213> artificial <220> <223> hsa-miR-1290 <400> 8 uggauuuuug gaucaggga 19 <210> 9 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-8485 <400> 9 cacacacaca cacacacgua u 21 <210> 10 <211> 23 <212> RNA <213> artificial <220> <223> hsa-miR-221-3p <400> 10 agcuacauug ucugcugggu uuc 23 <210> 11 <211> 22 <212> RNA <213> artificial <220> <223> hsa-miR-345-5p <400> 11 gcugacuccu aguccagggc uc 22 <210> 12 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-215-5p <400> 12 augaccuaug aauugacaga c 21 <210> 13 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-1273g-3p <400> 13 accacugcac uccagccuga g 21 <210> 14 <211> 23 <212> RNA <213> artificial <220> <223> hsa-miR-19a-3p <400> 14 uugcaaauc uaugcaaaac uga 23 <210> 15 <211> 22 <212> RNA <213> artificial <220> <223> hsa-miR-223-3p <400> 15 ugucaguuug ucaaauaccc ca 22 <210> 16 <211> 23 <212> RNA <213> artificial <220> <223> hsa-miR-19b-3p <400> 16 uggcaaauc caugcaaaac uga 23 <210> 17 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-31-5p <400> 17 aggcaagaug cuggcauagc u 21 <210> 18 <211> 23 <212> RNA <213> artificial <220> <223> hsa-miR-17-5p <400> 18 caaagugcuu acagugcagg uag 23 <210> 19 <211> 22 <212> RNA <213> artificial <220> <223> hsa-miR-205-5p <400> 19 uccuucauuc caccggaguc ug 22 <210> 20 <211> 22 <212> RNA <213> artificial <220> <223> hsa-miR-4449 <400> 20 cgucccgggg cugcgcgagg ca 22 <210> 21 <211> 23 <212> RNA <213> artificial <220> <223> hsa-miR-106a-5p <400> 21 aaaagugcuu acagugcagg uag 23 <210> 22 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-514a-3p <400> 22 auugacacuu cugugaguag a 21 <210> 23 <211> 22 <212> RNA <213> artificial <220> <223> hsa-miR-125b-5p <400> 23 cccuugagac ccuaacuugu ga 22

Claims (24)

A biomarker composition for diagnosing antibody mediated rejection (ABMR) after kidney transplantation, including hsa-miR-126-3p and hsa-miR-455-3p miRNA genes. According to claim 1, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR- A biomarker composition for diagnosing antibody-mediated rejection after kidney transplantation, further comprising any one or more miRNA genes selected from the group consisting of 1290, hsa-miR-8485 and hsa-miR-221-3p. A composition for diagnosing antibody-mediated rejection after kidney transplantation, comprising an agent for measuring the expression levels of hsa-miR-126-3p and hsa-miR-455-3p miRNA genes. According to claim 3, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR- Diagnosing antibody-mediated rejection after kidney transplantation, further comprising an agent for measuring the expression level of any one or more miRNA genes selected from the group consisting of 1290, hsa-miR-8485 and hsa-miR-221-3p composition for. According to claim 4, the hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p, hsa-miR -192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p miRNA agents that measure the expression level of the gene specifically bind to the gene A composition for diagnosing antibody-mediated rejection after kidney transplantation, comprising primers or probes. A kit for diagnosing antibody-mediated rejection after kidney transplantation, comprising the composition of claim 3 or 4. The kit for diagnosing antibody-mediated rejection after kidney transplantation according to claim 6, wherein the kit is a real-time PCR (RT-PCR) kit, a microarray kit, or a Serial Analysis of Gene Expression (SAGE) kit. (a) measuring the expression levels of hsa-miR-126-3p and hsa-miR-455-3p miRNA genes in a biological sample isolated from the subject; and
(b) Comparing the expression levels of hsa-miR-126-3p and hsa-miR-455-3p miRNA genes measured in step (a) with the expression levels of the same miRNA genes measured in biological samples isolated from normal controls A method for providing information for diagnosis of antibody-mediated rejection after kidney transplantation, comprising the step of: The method of claim 8, wherein (c) in the biological sample isolated from the subject in step (a) and the biological sample isolated from the normal control in step (b), hsa-miR-126-5p, hsa-miR-328 -5p, hsa-miR-103a-3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p Further measuring the expression level of any one or more selected miRNA genes, respectively; and
(d) hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-192, additionally measured in biological samples isolated from the subject in step (a) -5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p, the expression level of any one or more miRNA genes selected from the group consisting of the above (b) Comparing with the expression level of the same miRNA gene additionally measured in the biological sample isolated from the normal control group of step; Information providing method for diagnosis of antibody-mediated rejection after kidney transplantation, further comprising. The method of claim 8 or 9, wherein the biological sample is urine or urine-derived exosomes. The method of claim 8, wherein (e-1) the expression levels of the hsa-miR-126-3p and hsa-miR-455-3p miRNA genes measured in step (a) are higher than those of the normal control group in step (b). Provide information for diagnosis of antibody-mediated rejection after kidney transplantation, further comprising diagnosing antibody-mediated rejection after kidney transplantation if the expression level of the same miRNA gene measured in the isolated biological sample is increased. method. The method of claim 9, wherein (e-2) hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a additionally measured in the biological sample isolated from the subject in step (a) -3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p of any one or more miRNA genes selected from the group consisting of If the expression level is higher than the expression level of the same miRNA gene additionally measured in the biological sample isolated from the normal control group in step (b), further comprising the step of diagnosing antibody-mediated rejection after kidney transplantation , Information provision method for the diagnosis of antibody-mediated rejection after kidney transplantation. Differentiated from T cell mediated rejection (TCMR) or BK virus nephropathy after kidney transplantation, including hsa-miR-126-3p and hsa-miR-455-3p miRNA genes, antibody-mediated Biomarker composition for diagnosing rejection (Antibody mediated rejection, ABMR). The method of claim 13, further comprising any one or more miRNA genes selected from the group consisting of hsa-miR-126-5p, hsa-miR-328-5p and hsa-miR-103a-3p, after kidney transplant T A biomarker composition for diagnosing antibody-mediated rejection by distinguishing it from cell-mediated rejection or BK virus nephropathy. Antibody-mediated rejection, differentiating from T-cell-mediated rejection or BK virus nephropathy after kidney transplantation, including agents measuring the expression levels of hsa-miR-126-3p and hsa-miR-455-3p miRNA genes A composition for diagnosing a reaction. The method of claim 15, wherein an agent for measuring the expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-126-5p, hsa-miR-328-5p and hsa-miR-103a-3p is added Comprising, a composition for diagnosing antibody-mediated rejection after renal transplantation, as distinguished from T cell-mediated rejection or BK virus nephropathy. The method of claim 15 or 16, wherein the hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p An agent for measuring the expression level of a miRNA gene is distinguished from T cell-mediated rejection or BK virus nephropathy after kidney transplantation, including primers or probes that specifically bind to the gene, to diagnose antibody-mediated rejection. composition to do. A kit for diagnosing antibody-mediated rejection after renal transplantation, comprising the composition of claim 15 or 16, in distinction from T cell-mediated rejection or BK virus nephropathy. The method of claim 18, wherein the kit is a real-time PCR (RT-PCR) kit, a microarray kit, or a serial analysis of gene expression (SAGE) kit, which is associated with T cell-mediated rejection or BK virus nephropathy after kidney transplantation. Separately, a kit for diagnosing antibody-mediated rejection. (a) measuring the expression levels of hsa-miR-126-3p and hsa-miR-455-3p miRNA genes in a biological sample isolated from the subject; and
(b) The expression levels of the hsa-miR-126-3p and hsa-miR-455-3p miRNA genes measured in step (a) were compared to the expression levels of the same miRNA genes measured in the biological sample isolated from the normal control group. A method for providing information for the diagnosis of antibody-mediated rejection after kidney transplantation, including the step of comparing, distinguishing from T cell-mediated rejection or BK virus nephropathy. The method of claim 20, wherein (c) in the biological sample isolated from the subject in step (a) and the biological sample isolated from the normal control in step (b), hsa-miR-126-5p, hsa-miR-328 -5p and hsa-miR-103a-3p; further measuring the expression level of any one or more miRNA genes selected from the group consisting of; and
(d) selected from the group consisting of hsa-miR-126-5p, hsa-miR-328-5p and hsa-miR-103a-3p further measured in a biological sample isolated from the subject in step (a) Comparing the expression level of one or more miRNA genes with the expression level of the same miRNA gene additionally measured in the biological sample isolated from the normal control group in step (b); T cells after kidney transplantation, further comprising A method for providing information for the diagnosis of antibody-mediated rejection, as distinguished from mediated rejection or BK virus nephropathy. The method of claim 20 or 21, wherein the biological sample is urine or urine-derived exosomes, which is different from T cell-mediated rejection or BK virus nephropathy after kidney transplantation, and diagnosis of antibody-mediated rejection How to provide information for The method of claim 20, wherein (e-1) the expression levels of the hsa-miR-126-3p and hsa-miR-455-3p miRNA genes measured in step (a) are higher than those of the normal control group in step (b). If the expression level of the same miRNA gene measured in the isolated biological sample is increased, further comprising a step of diagnosing T cell-mediated rejection or antibody-mediated rejection without BK virus nephropathy after kidney transplantation. How to provide information for the diagnosis of antibody-mediated rejection after kidney transplantation, distinguishing it from T cell-mediated rejection or BK virus nephropathy. The method of claim 21, wherein (e-2) additionally measured hsa-miR-126-5p, hsa-miR-328-5p and hsa-miR-103a in a biological sample isolated from the subject in step (a). When the expression level of one or more miRNA genes selected from the group consisting of -3p is higher than the expression level of the same miRNA gene additionally measured in the biological sample isolated from the normal control group in step (b), after kidney transplantation Separated from T cell-mediated rejection or BK virus nephropathy after kidney transplantation, further comprising diagnosing antibody-mediated rejection without T cell-mediated rejection or BK virus nephropathy, antibody A method for providing information for the diagnosis of mediated rejection.

Images