KR20210024986A - Urinary exosome-derived miRNA gene biomarkers for diagnosis of antibody-mediated rejection in kidney allografts and use thereof - Google Patents

Abstract

The present invention relates to a urine exosome-derived miRNA gene biomarker for diagnosis of antibody-mediated rejection after kidney transplantation, and uses thereof. More specifically, the present invention relates to a biomarker related to antibody-mediated rejection (ABMR) after kidney transplantation, a composition for diagnosis of ABMR, a kit thereof, a method for providing information for diagnosing ABMR using the same, and a screening method for a therapeutic agent for ABMR.

Description

Urinary exosome-derived miRNA gene biomarkers for diagnosis of antibody-mediated rejection in kidney allografts and use thereof for diagnosis of antibody-mediated rejection after kidney transplantation

The present invention relates to a urine exosome-derived miRNA gene biomarker and its use for diagnosis of antibody-mediated rejection after kidney transplantation, and more particularly, antibody-mediated rejection (ABMR) after kidney transplantation. It relates to a biomarker, a composition for diagnosing an antibody-mediated rejection reaction, a kit, a method for providing information for diagnosis of an antibody-mediated rejection reaction using the same, and a screening method for an antibody-mediated rejection treatment agent.

The field of organ transplantation is slowly becoming a part of precision medicine. Acute rejection reactions still occur in 15 to 20% of patients receiving kidney transplants when using the current standard immunosuppressive treatment, and until now, if there is an increase in serum creatinine concentration or the expression of new proteinuria, it is diagnosed through tissue biopsy. . Since the renal condition at the time when there is an increase in serum creatinine concentration or new proteinuria expression is a condition in which inflammation is already quite advanced, there is a need for a biomarker capable of early detection of subclinical acute rejection. It is known that innate/acquired immune responses appear first at the molecular level before appearing at the histological level. Therefore, the development of non-invasive biomarkers for pre-diagnosing and monitoring clinical conditions after kidney transplantation is an essential step for precision medicine.

In the past, rejection reactions after kidney transplantation were classified into superacute, acute and chronic rejection reactions according to the time of occurrence of the rejection reaction, but recently, the Banff classification, which classified rejection reactions according to the mechanism of development and the findings of a new biopsy, is mainly used. Prior to Banff classification, the classification of pathologic diagnosis of transplanted kidney was very simple.In particular, acute and chronic rejection reactions were mainly classified according to the location of inflammatory cell infiltration. vascular) rejection. In other words, from the current point of view, this is a diagnostic classification for T cell-specific rejection except for superacute rejection, and at the time, the existence of antibody-mediated rejection (ABMR) itself was not recognized, not the clinical picture of superacute. And there was no diagnostic evidence. Currently, superacute rejection is understood as the most severe form of acute ABMR.

Regarding the diagnosis of rejection after kidney transplantation, urine biomarkers for diagnosing acute rejection after kidney transplantation are known (Suthanthiran et al., Urinary-Cell mRNA Profile and Acute Cellular Rejection in Kidney Allografts. The New England Journal of Medicine (2013) 369;1). However, T cell-mediated rejection and antibody-mediated rejection can be distinguished and diagnosed, or biomarkers that can be diagnosed at the same time. There is no research to discover biomarkers that can be diagnosed and to use them for selection of treatment directions and determination of treatment progress after kidney transplantation.

On the other hand, exosomes are endoplasmic reticulums derived from cells and have markers on the surface and contain nucleic acids such as lipids, proteins, and microRNAs inside them, so studies on normal functions and disease functions using them are actively progressing. Has become. Exosomes are secreted from epithelial cells or glomerular podocytes present in the renal tubule lumen, and a specific factor in exosomes reflects the state of transplanted kidney cells to diagnose rejection after kidney transplantation. (Hua Zhou, Peter ST Yuen, Trairak Pisitkum et al. Collection, storage, preservation, and normalization of human urinary exosomes for biomarker discovery. Kidney International, 2006, 69(8)) 1471-76).

Under this background, the present inventors can diagnose miRNA gene biomarkers capable of diagnosing antibody-mediated rejection after kidney transplantation, and antibody-mediated rejection after kidney transplantation by distinguishing between T cell-mediated rejection and BK virus nephropathy. The present invention was completed by selecting and confirming a possible miRNA gene biomarker, and/or a miRNA biomarker capable of distinguishing and diagnosing BK virus nephropathy after kidney transplant rejection and kidney transplantation.

An object of the present invention is a miRNA gene biomarker for diagnosing antibody-mediated rejection after kidney transplantation, a composition, kit, information providing method, and antibody-mediated after kidney transplantation for diagnosing antibody-mediated rejection after kidney transplantation using the same It is to provide a method for screening a therapeutic agent for sexual rejection.

Another object of the present invention is a biomarker composition for diagnosing antibody-mediated rejection after kidney transplantation, distinct from T cell-mediated rejection or BK virus nephropathy, and T-cell-mediated rejection or BK after kidney transplantation using the same It is to provide a composition, a kit, a method of providing information for diagnosing antibody-mediated rejection, and a method for screening a therapeutic agent for antibody-mediated rejection after kidney transplantation, in distinction from viral nephropathy.

Another object of the present invention is a miRNA gene biomarker for distinguishing and diagnosing kidney transplant rejection and BK virus nephropathy, and a composition, kit, and information for distinguishing and diagnosing kidney transplant rejection and BK virus nephropathy using the same It is to provide a method of providing and screening for a treatment for renal transplant rejection.

Another object of the present invention is to provide a biomarker composition for predicting the prognosis after a kidney transplant, a composition for predicting the prognosis after a kidney transplant using the same, a kit, a method of providing information, and a screening method for a treatment for renal transplant rejection.

In a first aspect for solving the above problems, the present invention hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR Any one or more miRNAs selected from the group consisting of -103a-3p , hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p It provides a biomarker composition for diagnosing an antibody mediated rejection (ABMR) comprising a gene.

With respect to the first aspect, the present invention provides hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p, The expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p It provides a composition for diagnosing antibody-mediated rejection after kidney transplantation, including an agent to be measured, and a kit including the same.

According to a preferred embodiment of the present invention, the hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p , hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and the expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-221-3p The agent for measuring may include a primer or probe that specifically binds to the gene.

According to another preferred embodiment of the present invention, the kit may be a real-time PCR (RT-PCR) kit, a microarray kit, or a Serial Analysis of Gene Expression (SAGE) kit.

With respect to the first aspect, the present invention also provides a method of providing information for diagnosis of antibody mediated rejection after kidney transplant comprising the following steps:

(a) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p, in biological samples isolated from individuals The expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p Measuring; And

(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a- measured in step (a) Expression of any one or more miRNA genes selected from the group consisting of 3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p Comparing the level to a normal control sample.

According to a preferred embodiment of the present invention, the biological sample of step (a) may be urine or urine-derived exosomes.

According to another preferred embodiment of the present invention, the information providing method is (c) measured in step (a), hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328- 5p, hsa-miR-455-3p, hsa-miR-103a-3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR- When the expression level of any one or more miRNA genes selected from the group consisting of 221-3p is higher than the expression level in the normal control sample, diagnosis of antibody-mediated rejection after kidney transplantation may be further included.

With respect to the first aspect, the present invention also provides a method of screening for a therapeutic agent for antibody mediated rejection after kidney transplant comprising the following steps:

(a) treating the sample with a candidate substance for an antibody-mediated rejection treatment after kidney transplantation; And

(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p in the sample treated with the candidate substance , hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and the expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-221-3p Steps to measure.

According to a preferred embodiment of the present invention, the sample of step (a) may be urine or urine-derived exosomes.

According to another preferred embodiment of the present invention, the screening method is (c) measured in step (b), hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p. , hsa-miR-455-3p, hsa-miR-103a-3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221 When the expression level of any one or more miRNA genes selected from the group consisting of -3p is more suppressed in a sample not treated with a candidate substance, the candidate substance treated in step (a) is used as a therapeutic agent for antibody-mediated rejection after kidney transplantation. It may further include the step of determining as.

As a second aspect for solving the above-described problem, the present invention is hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR Antibody-mediated rejection reaction (T cell mediated rejection, TCMR) or BK virus nephropathy, including any one or more miRNA genes selected from the group consisting of -103a-3p. Antibody mediated rejection (ABMR) provides a biomarker composition for diagnosing.

With respect to the second aspect, the present invention also provides hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p. A composition for diagnosing antibody-mediated rejection by distinguishing from T cell mediated rejection or BK virus nephropathy after kidney transplant, comprising an agent measuring the expression level of any one or more miRNA genes selected from the group consisting of, and A kit containing this is provided.

According to a preferred embodiment of the present invention, the hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p or hsa-miR-103a-3p The agent for measuring the expression level of the miRNA gene may include a primer or probe that specifically binds to the gene.

With respect to the second aspect, the present invention also provides a method for diagnosing antibody-mediated rejection after kidney transplantation, distinct from T cell mediated rejection or BK virus nephropathy, comprising the following steps:

(a) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p in biological samples isolated from individuals Measuring the expression level of any one or more miRNA genes selected from the group consisting of; And

(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a- measured in step (a) Comparing the expression level of any one or more miRNA genes selected from the group consisting of 3p with a normal control sample.

According to a preferred embodiment of the present invention, the information providing method comprises (c) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p measured in step (a). , When the expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-455-3p and hsa-miR-103a-3p is higher than that in the normal control sample, T cell mediated after kidney transplantation It may further comprise the step of diagnosing rejection or antibody mediated rejection not accompanied by BK virus nephropathy.

With respect to the second aspect, the present invention also provides a method of screening for a therapeutic agent for antibody-mediated rejection after kidney transplant comprising the following steps:

(a) treating the sample with a candidate substance for a therapeutic agent for kidney transplant rejection; And

(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p in the sample treated with the candidate substance Measuring the expression level of any one or more miRNA genes selected from the group consisting of.

According to a preferred embodiment of the present invention, the screening method comprises (c) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, measured in step (a), When the expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-455-3p and hsa-miR-103a-3p is suppressed than in the sample not treated with the candidate substance, the treatment in step (a) above. It may further include the step of determining one candidate substance as a therapeutic agent for antibody-mediated rejection after kidney transplantation.

In a third aspect for solving the above-described problem, the present invention is hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR -455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223 It provides a miRNA gene biomarker composition for distinguishing and diagnosing kidney transplant rejection and BK virus nephropathy, including any one or more miRNA genes selected from the group consisting of -3p.

Regarding the third aspect, the present invention also provides hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p , hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p It provides a composition for diagnosing and diagnosing kidney transplant rejection and BK virus nephropathy, including an agent for measuring the expression level of any one or more miRNA genes selected from the group, and a kit including the same.

According to a preferred embodiment of the present invention, the hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p , hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p The agent for measuring the expression level of any one or more miRNA genes selected from the group may include a primer or probe that specifically binds to the gene.

With respect to the third aspect, the present invention also provides a method for providing information for distinguishing and diagnosing kidney transplant rejection and BK virus nephropathy, comprising the following steps:

(a) hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p, in biological samples isolated from individuals The group consisting of hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p Measuring the expression level of any one or more miRNA genes selected from; And

(b) hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455- measured in step (a) 3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p Comparing the expression level of any one or more miRNA genes selected from the group consisting of a normal control sample.

According to a preferred embodiment of the present invention, the information providing method is (c) hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, measured in step (a). , hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa -If the expression level of any one or more miRNA genes selected from the group consisting of miR-19a-3p and hsa-miR-223-3p is higher than that in the normal control sample, kidney not accompanied by BK virus nephropathy It may further comprise the step of diagnosing transplant rejection.

In connection with the third aspect, the present invention also provides a method of screening for a therapeutic agent for renal transplant rejection, comprising the steps of:

(a) treating the sample with a candidate substance for a therapeutic agent for kidney transplant rejection; And

(b) hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p in the sample treated with the candidate substance , hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p Measuring the expression level of any one or more miRNA genes selected from the group.

According to a preferred embodiment of the present invention, the screening method is (c) measured in step (b), hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa- When the expression level of any one or more miRNA genes selected from the group consisting of miR-19a-3p and hsa-miR-223-3p is more suppressed in the sample not treated with the candidate substance, the candidate treated in step (a) above It may further include the step of determining the substance as a treatment for kidney transplant rejection.

In a fourth aspect for solving the above-described problem, the present invention hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p , hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa -miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR -223-3p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and any one selected from the group consisting of hsa-miR-125b-5p It provides a biomarker composition for predicting prognosis after kidney transplantation, including the above miRNA gene.

With respect to the fourth aspect, the present invention provides hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR- 31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455- 3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p, Expression of any one or more miRNA genes selected from the group consisting of hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p It provides a composition for predicting prognosis after kidney transplantation, including an agent for measuring the level, and a kit including the same.

According to a preferred embodiment of the present invention, the hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR -31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455 -3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p , hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p of any one or more miRNA genes selected from the group consisting of The agent for measuring the expression level may include a primer or probe that specifically binds to the gene.

With respect to the fourth aspect, the present invention also provides a method of providing information for predicting prognosis after kidney transplantation comprising the following steps:

(a) hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR- in biological samples isolated from individuals 31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455- 3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p, Expression of any one or more miRNA genes selected from the group consisting of hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p Measuring the level; And

(b) measured in the step (a), hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa- miR-31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR- 455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223- Any one or more miRNA genes selected from the group consisting of 3p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p Comparing the expression level of the normal control sample.

According to a preferred embodiment of the present invention, the information providing method is (c) measured in step (a), hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa -miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328 -5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p , hsa-miR-19a-3p, hsa-miR-223-3p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR When the expression level of any one or more miRNA genes selected from the group consisting of -125b-5p is higher than the expression level in the normal control sample, predicting that a kidney transplant has a poor prognosis may be further included.

In addition, as a fourth aspect, the present invention provides a screening method for a treatment for kidney transplant rejection and/or a treatment for BK virus nephropathy in a patient with a poor prognosis after a kidney transplant, comprising the following steps:

(a) treating the sample with a candidate substance for the treatment of kidney transplant rejection and/or the treatment of BK virus nephropathy; And

(b) hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR in the sample treated with the candidate substance -31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455 -3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p , hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p of any one or more miRNA genes selected from the group consisting of Measuring the expression level.

According to a preferred embodiment of the present invention, the screening method is (c) measured in step (b), hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa- miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328- 5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR- When the expression level of any one or more miRNA genes selected from the group consisting of 125b-5p is more suppressed in the sample not treated with the candidate material, the candidate material treated in step (a) is used as a kidney transplant rejection treatment agent and/or It may further include the step of determining as a therapeutic agent for BK virus nephropathy.

The biomarker composition comprising various combinations of miRNA genes according to the present invention can diagnose antibody-mediated rejection after kidney transplantation, as well as T cell-mediated rejection and/or antibody-mediated rejection after kidney transplantation. It is possible to diagnose BK virus nephropathy separately, and it is also possible to diagnose kidney transplant rejection reaction and BK virus nephropathy after kidney transplantation, so that the cause of kidney transplant rejection can be diagnosed more precisely and accurately. Accordingly, by providing a treatment method tailored to each patient, various symptoms appearing after a kidney transplant can be effectively treated according to the cause.

1 is a schematic diagram showing the selection process of biomarkers representing antibody-mediated rejection group (ABMR), T cell mediated rejection group (TCMR), and BK virus nephropathy group (BKVN).
2 is a hierarchical cluster analysis (Uriclid method, fully correlated) for grouping samples with similar expression levels and mature miRNAs for important data, and this is shown as a heat map.
3 shows the miRNA genes selected through the first and second screening processes, and FIG. 3(A) shows the miRNA genes whose expression increased by more than 2 times based on the normal control (NOMOA) is shown in red, and the normal control The miRNA gene whose expression was reduced by more than 2 times based on (NOMOA) is shown in green, and FIG. 3(B) shows the antibody-mediated rejection group (ABMR) and T-cell mediated compared to the normal control group (NOMOA), respectively. It shows the result of confirming the upregulated miRNA gene whose expression level differs by more than 2 times in the sexual rejection group (TCMR) and BK virus nephropathy group (BKVN).
Figure 4(A) is five kinds of biomarker candidates in the antibody-mediated rejection group (ABMR) showing a significant difference in expression patterns compared to the antibody-mediated rejection group (TCMR) and the BK virus nephropathy group (BKVN). 4(B) is a graph showing that the 5 types of miRNA genes exhibit a 2-fold or more increased expression level in the antibody-mediated rejection group (ABMR) compared to the normal control (NOMOA). .
Figure 5 (A) is a T cell mediated rejection group (TCMR) of the biomarker candidates, compared to the antibody-mediated rejection group (ABMR) and BK virus nephropathy group (BKVN) 5 showing a significant difference in expression patterns. It shows the miRNA gene of the species, Figure 5 (B) shows that the expression level of the five miRNA genes increased more than two times in the T cell mediated rejection group (TCMR) compared to the normal control (NOMOA). It is a graph.
6(A) is 5 showing a significant difference in expression patterns compared to the antibody-mediated rejection group (ABMR) and the T cell mediated rejection group (TCMR) among biomarker candidates for BK virus nephropathy (TCMR). Species miRNA genes are shown, and FIG. 6(B) is a graph showing that the 5 types of miRNA genes exhibit a 2-fold or more increased expression level in the BK virus nephropathy group (TCMR) compared to the normal control (NOMOA).
Figure 7 is significantly different from the other groups in the antibody-mediated rejection group (ABMR), T cell mediated rejection group (TCMR), and BK virus nephropathy group (BKVN) compared to the normal control group (NOMOA) after statistical analysis. The urine exosome miRNA gene expressed differently was identified and shown as a Venn diagram.
Figure 8 shows the expression levels of the three miRNA gene biomarkers miRNA-445-3p, miRNA-126-3p, and miRNA-221-3p in the robust control, normal control (NOMOA), and antibody-mediated rejection group (ABMR). It shows the ROC (Receiver-Operating Characteristic) curve of each miRNA gene biomarker.

As described above, a miRNA gene biomarker that can diagnose antibody-mediated rejection after kidney transplantation, and antibody-mediated rejection after kidney transplantation can be diagnosed separately from T cell-mediated rejection and BK virus nephropathy. Research to discover miRNA gene biomarkers and/or miRNA biomarkers that can differentiate and diagnose BK virus nephropathy after kidney transplant rejection and kidney transplantation, and use them for selection of treatment directions and treatment progress after kidney transplantation. There is no situation. Accordingly, the present inventors have developed a specific urine exosome miRNA gene biomarker capable of distinguishing and diagnosing antibody-mediated rejection (ABMR), T cell-mediated rejection (TCMR) and BK virus nephropathy (BKVN) after kidney transplantation By providing it, a solution to the above-described problem was sought. The biomarker composition comprising various combinations of miRNA genes according to the present invention can diagnose antibody-mediated rejection after kidney transplantation by distinguishing it from T cell rejection and/or BK virus nephropathy. The cause can be diagnosed more precisely and accurately, and accordingly, various symptoms that appear after kidney transplant can be effectively treated according to the cause by providing a treatment method tailored to the patient.

Hereinafter, the present invention will be described in more detail.

All technical terms used in the present invention, unless otherwise defined, are used in the same meaning as those of ordinary skill in the art generally understand in the related field of the present invention. In addition, although preferred methods or samples are described in the present specification, those similar or equivalent are included in the scope of the present invention.

The first aspect of the present invention is hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p, hsa-miR -192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p comprising any one or more miRNA genes selected from the group consisting of, antibody-mediated It relates to a biomarker composition for diagnosing antibody mediated rejection (ABMR).

Information on the 10 miRNA gene biomarkers is shown in Table 1.

Mature miRNA gene order Sequence number Accession Number hsa-miR-126-3p UCGUACCGUGAGUAAUAAUGCG One MIMAT0000445 hsa-miR-126-5p CAUUAUUACUUUUGGUACGCG 2 MIMAT0000444 hsa-miR-328-5p GGGGGGGCAGGAGGGGCUCAGGG 3 MIMAT0026486 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC 4 MIMAT0004784 hsa-miR-103a-3p AGCAGCAUUGUACAGGGCUAUGA 5 MIMAT0000101 hsa-miR-192-5p CUGACCUAUGAAUUGACAGCC 6 MIMAT0000222 hsa-miR-331-3p GCCCCUGGGCCUAUCCUAGAA 7 MIMAT0000760 hsa-miR-1290 UGGAUUUUUGGAUCAGGGA 8 MIMAT0005880 hsa-miR-8485 CACACACACACACACACGUAU 9 MIMAT0033692 hsa-miR-221-3p AGCUACAUUGUCUGCUGGGUUUC 10 MIMAT0000278

In the present invention, the term "miRNA" is transcribed as an RNA precursor having a hairpin-like structure, and is cleaved by a dsRNA cleavage enzyme having RNase III cleavage activity, and introduced into a protein complex called RISC, unless otherwise noted, translation of mRNA Non-coding RNA of 15 to 25 bases involved in inhibition is intended and used. In addition, the miRNA used in the present invention is not only a miRNA represented by a specific nucleotide sequence (or sequence number), but also a precursor of the miRNA (pre-miRNA, primiRNA), a miRNA having a biological function equivalent to these, for example, a homologue (i.e. Homologs or orthologs), polymorphisms, and other variants, and derivatives. As such a precursor, homologue, variant or derivative, it can be specifically identified by miRBase release 20 (http://www.mirbase.org/), and a miRNA having a base sequence that hybridizes with the complementary sequence of miRNA under stringent conditions Can be lifted. In addition, the miRNA mentioned in the present invention may be a gene product of the miR gene, and such a gene product is a mature miRNA (e.g., a ratio of 15 to 25 bases or 19 to 25 bases involved in the translational inhibition of such mRNA. Coding RNA) or miRNA precursors (eg, pre-miRNA or pri-miRNA as above).

In the present invention, the term "nucleic acid" is used for a nucleic acid including both RNA, DNA, and RNA/DNA (chimera). In addition, the DNA includes all of cDNA, genomic DNA, and synthetic DNA. In addition, the RNA includes all of total RNA, mRNA, rRNA, miRNA, siRNA, snoRNA, snRNA, non-coding RNA, and synthetic RNA. In the present invention, "synthetic DNA" and "synthetic RNA" are artificially produced using, for example, an automatic nucleic acid synthesizer based on a predetermined nucleotide sequence (either natural sequence or non-natural sequence may be used). Refers to DNA and RNA. In the present invention, the "non-natural sequence" is intended to be used in a broad sense, and different from the native sequence, for example, a sequence including substitution, deletion, insertion and/or addition of one or more nucleotides (ie , A variant sequence), a sequence containing one or more modified nucleotides (ie, a modified sequence), and the like. In addition, in the present invention, polynucleotides are used interchangeably with nucleic acids.

In the present invention, the term "renal allograft rejection" refers to a series of immune reactions that occur when the recipient's immune system, who has received the donor's kidney, recognizes the transplanted kidney as an external antigen. Depending on the findings, it can be classified into antibody-mediated rejection (ABMR), T cell mediated rejection (TCMR), and mixed rejection in which all of them appear in combination. have.

In the present invention, the rejection reaction of the kidney transplant may include both antibody-mediated rejection, T cell-mediated rejection, and mixed rejection, and preferably, acute T cell mediated rejection (TCMR). ), chronic antibody mediated rejection (CAMR), active antibody mediated rejection, chronic active T cell mediated rejection, and mixed rejection It may be selected from the group consisting of reactions (mixed rejection).

The term "biomarker" of the present invention refers to a molecule that is quantitatively or qualitatively associated with the presence of a biological phenomenon, and the biomarker of the present invention is a miRNA gene that can confirm whether a rejection reaction or BK virus nephropathy appears after a kidney transplant. Or it refers to a gene that is a criterion for predicting a patient with a good or poor prognosis after a kidney transplant. The term includes a nucleic acid sequence that is complementary to or flanked by a marker sequence, such as a nucleic acid used as a probe or primer pair capable of amplifying the marker sequence.

In the present invention, the term "prognosis" means a prediction for medical consequences (eg, long-term viability, disease-free survival rate, etc.), and includes a positive prognosis (positive prognosis) or a negative prognosis (negative or poor prognosis), In the present invention, the negative prognosis means that various rejection reactions or diseases occur after kidney transplantation, and the positive prognosis means that rejection reactions or diseases do not occur after kidney transplantation.

In the present invention, the term "prediction" means a preliminary guess for medical consequences, and for the purposes of the present invention, reactions of patients who have undergone a kidney transplant (various kidney transplant rejection reactions, onset of BK virus infectious diseases, etc.) It means to guess in advance.

The present inventors expressed the above-described 10 kinds of miRNA genes in the urine of patients with antibody-mediated rejection (ABMR) compared to a no major abnormality (NOMOA) among kidney transplant patients. This increases by more than two times, and the statistical analysis shows that the p-value value is less than 0.05, indicating that these miRNA gene biomarkers can be used as diagnostic markers for antibody-mediated rejection.

With respect to the first aspect, the present invention provides hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p, The expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p It provides a composition for diagnosing antibody-mediated rejection after kidney transplantation, including an agent to be measured, and a kit including the same.

According to a preferred embodiment of the present invention, the hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p , hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and the expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-221-3p The agent for measuring may include a primer or probe that specifically binds to the gene.

In the present invention, the term "primer" is a nucleic acid sequence having a short free 3'hydroxyl group, which can form a complementary template and a base pair, and serves as a starting point for copying a template. It refers to a short functional nucleic acid sequence. In the present invention, PCR amplification is performed using the sense and antisense primers of the miRNA gene, and the rejection reaction of a kidney transplant can be diagnosed or the prognosis can be predicted through whether a desired product is generated. The PCR conditions, the length of the sense and antisense primers can be modified based on those known in the art. In the present invention, the primers used to amplify the mRNA of the gene are appropriate conditions in an appropriate buffer (e.g., 4 different nucleoside triphosphates and a polymerization agent such as DNA, RNA polymerase or reverse transcriptase) and an appropriate temperature. It may be a single-stranded oligonucleotide that can serve as a starting point for template-directed DNA synthesis under, and the appropriate length of the primer may vary depending on the purpose of use. The primer sequence need not be completely complementary to the polynucleotide of the miRNA gene biomarker or the polynucleotide complementary thereto, and can be used as long as it is sufficiently complementary to hybridize.

In the present invention, the term "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to a short number of bases to several hundred bases capable of specific binding to mRNA, and is labeled You can check the presence or absence of a specific mRNA. The probe may be manufactured in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like. In the present invention, hybridization is performed using a probe complementary to the miRNA gene, and the rejection reaction of a kidney transplant can be diagnosed or the prognosis can be predicted through hybridization. Selection of suitable probes and conditions for hybridization can be modified based on those known in the art.

The primer or probe of the present invention can be chemically synthesized using a phosphoramidite solid support method or other well known method. Such nucleic acid sequences can also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, encapsulation, substitution with one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphotriester, phosphoro Amidates, carbamates, etc.) or with charged linkers (eg phosphorothioate, phosphorodithioate, etc.).

The base sequence of the agent for measuring the expression level of the miRNA gene used in the present invention is a sequence diagram showing substantial identity with the sequence that specifically binds to the miRNA gene, considering a mutation having biologically equivalent activity. Is to be interpreted as including. The term,'substantial identity', is aligned to match a specific sequence and any other sequence as much as possible, and when the aligned sequence is analyzed using an algorithm commonly used in the art, at least 60 % Identity, more specifically 70% identity, even more specifically 80% identity, most specifically 90% identity.

The kit of the present invention may be a real-time PCR (RT-PCR) kit such as quantitative real-time PCR (qRT-PCR), a microarray kit, or a Serial Analysis of Gene Expression (SAGE) kit, but is not limited thereto. As a specific example, the kit may be a kit including essential elements necessary to perform RT-PCR. For example, RT-PCR kits include test tubes or other suitable containers, reaction buffers (varies in pH and magnesium concentration), deoxynucleotides (dNTPs), didioxynucleotides (ddNTPs), in addition to each primer specific for the miRNA gene. ), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitor, DEPC-water, sterile water, and the like. In addition, a primer pair specific for DNA, RNA or miRNA used as a quantitative control may be included.

The kit of the present invention may include a kit for extracting a nucleic acid (eg, total RNA) from a body fluid, cell or tissue, a fluorescent substance for labeling, an enzyme and a medium for amplifying nucleic acid, and instructions for use.

The kit of the present invention is a device for measuring a Parkinson's disease marker to which the nucleic acid is bound or attached to, for example, a solid phase. Examples of the solid material are plastic, paper, glass, silicone, and the like, and the preferred solid material from the ease of processing is plastic. The shape of the solid phase is arbitrary, for example, a square, a circle, a rectangle, a film shape, etc.

The kit of the present invention may contain a nucleic acid capable of specifically binding to at least one of the miRNAs.

With respect to the first aspect, the present invention also provides a method of providing information for diagnosis of antibody mediated rejection after kidney transplantation comprising the following steps:

(a) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p, in biological samples isolated from individuals The expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p Measuring; And

(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a- measured in step (a) Expression of any one or more miRNA genes selected from the group consisting of 3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p Comparing the level to a normal control sample.

In the information providing method of the present invention, the term "individual" refers to humans, primates including chimpanzees, dogs, cats, etc., and cattle with a possibility of developing kidney transplant rejection or developing BK virus nephropathy. , It is interpreted to include domestic animals such as horses, sheep and goats, and mammals such as rodents such as mice and rats.

In the information providing method of the present invention, the "sample" used for analysis is a kidney transplant rejection reaction that can be distinguished from normal conditions such as blood, plasma, serum, saliva, nasal fluid, sputum, ascites, vaginal discharge, urine, and feces. Or a biological sample capable of identifying a miRNA gene specific for BK virus nephropathy. Preferably, it may be a biological liquid sample, such as blood, serum, plasma or urine, and most preferably, it may be a urine or urine-derived exosome.

In the present invention, the term "exosomes" refers to vesicles of a lipid bilayer derived from cells. Exosomes contain unique proteins and nucleic acids derived from cells or tissues, and contain a large amount of biomarkers such as RNA and miRNA that can be used for diagnosis of various diseases.

The information providing method of the present invention may be performed using a variety of known test methods, for example, a hybridization method, an immunoassay method, or a gene amplification method, but is not limited thereto.

The hybridization method may be to confirm the presence of miRNA using a probe.

When the information providing method of the present invention is implemented in a microarray method among hybridization methods, the probe is used as a hybridizable array element and is immobilized on a substrate. Preferred substrates are rigid or semi-rigid supports, including, for example, membranes, filters, chips, slides, wafers, fibers, magnetic or non-magnetic beads, gels, tubing, plates, polymers, microparticles and capillaries. The hybridization array element is arranged and immobilized on the substrate. Such immobilization is carried out by a chemical bonding method or a covalent bonding method such as UV. For example, the hybridization array element can be bonded to a glass surface modified to contain an epoxy compound or an aldehyde group, and can also be bonded to a polylysine coated surface by UV. In addition, the hybridization array element may be bonded to the substrate through a linker (eg, ethylene glycol oligomer and diamine).

Meanwhile, the sample DNA applied to the microarray of the present invention may be labeled and hybridized with the array element on the microarray. Hybridization conditions can be changed in various ways. In addition, detection and analysis of the degree of hybridization may be performed in various ways depending on the labeling material.

The label of the probe can provide a signal to detect hybridization, which can be linked to an oligonucleotide. Suitable labels are fluorophores (e.g., fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia)), terminal deoxynucleotidyl transferase (TdT), chromophore, chemiluminescence. However, magnetic particles, radioactive isotopes (P32 or S35), mass labels, electron condensing particles, enzymes (alkaline phosphatase or horseradish peroxidase), cofactors, substrates for enzymes, heavy metals (eg, gold), and Antibodies, streptavidin, biotin, digoxigenin, and haptens having specific binding partners such as a chelating group are included, but are not limited thereto. Labeling can be carried out by various methods commonly practiced in the art, such as nick translation method, random priming method (Multiprime DNA labeling systems booklet, "Amersham" (1989)) and kineation method (Maxam & Gilbert, Methods. in Enzymology, 65:499 (1986)). The label provides a signal that can be detected by fluorescence, radioactivity, colorimetric measurement, gravimetric measurement, X-ray diffraction or absorption, magnetic, enzymatic activity, mass analysis, binding affinity, high frequency hybridization, and nanocrystals.

A nucleic acid sample to be analyzed in the hybridization method can be prepared using RNA obtained from various biosamples. The biological sample is preferably intestinal epithelial cells. Instead of a probe, a hybridization reaction-based analysis may be performed by labeling the cDNA to be analyzed.

When using a probe, the probe is hybridized with a cDNA molecule. In the present invention, suitable hybridization conditions can be determined in a series of processes by an optimization procedure. This procedure is performed as a series of procedures by a person skilled in the art to establish a protocol for use in the laboratory. For example, conditions such as temperature, concentration of components, hybridization and washing times, buffer components, and their pH and ionic strength depend on various factors such as the length of the probe and the amount of GC and the target nucleotide sequence. Detailed conditions for hybridization include Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); And M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. It can be found in N.Y. (1999).

After the hybridization reaction, a hybridization signal generated through the hybridization reaction is detected. The hybridization signal can be performed in various ways depending on the type of label bound to the probe, for example. For example, when the probe is labeled with an enzyme, it is possible to confirm whether or not hybridization has occurred by reacting a substrate of this enzyme with a result of hybridization reaction. Combinations of enzymes/substrates that can be used include peroxidase (e.g. horseradish peroxidase) and chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium nit Rate), resorupine benzyl ether, luminol, amplex red reagent (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2, 2'-Azine-di[3-ethylbenzthiazoline sulfonate]), o-phenylenediamine (OPD) and naphthol/pyronine; Alkaline phosphatase and bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol-AS-B1-phosphate and ECF substrate; Glucose oxidase, nitroblue tetrazolium (t-NBT) and phenzaine methosulfate (m-PMS). When the probe is labeled with gold particles, it can be detected by a silver staining method using silver nitrate.

When the hybridization signal for the miRNA sequence in a biological sample is up-regulated than that of a normal sample, it is diagnosed as antibody-mediated rejection after kidney transplantation.

The information providing method of the present invention can be carried out by an immunoassay method. The immunoassay methods include radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, ELISA (enzyme-linked immunosorbent assay), capture-ELISA, inhibition or hardwood analysis, sandwich analysis, flow cytometry, immunofluorescence staining, and immunohistochemistry. Including, but not limited to, chemical tablets. The immunoassay method was described in Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbentassay (ELISA), in Methodsin Molecular Biology, Vol. 1, Walker, J.M. ed., Humana Press, NJ, 1984; And Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, which is incorporated herein by reference.

The information providing method of the present invention can be implemented by a gene amplification method. The detection of miRNA using the gene amplification method may be performed using various methods known in the art, and in this case, a miRNA primer or probe may be used. In the case of using a primer, a gene amplification reaction is performed to examine the level of expression of the miRNA gene. Since the present invention analyzes the level of expression of the miRNA gene, the level of expression of the gene of the marker is determined by examining the amount of mRNA of the marker in a sample to be analyzed (eg, exosomes derived from urine). Therefore, in principle, the present invention performs a gene amplification reaction using mRNA in a biological sample as a template and using a primer that binds to mRNA or cDNA.

First, total RNA is isolated from the sample to obtain mRNA. Isolation of total RNA can be carried out according to conventional methods known in the art (see: Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold pring Harbor Press (2001); Tesniere, C. et al., PlantMol. Biol. Rep., 9:242 (1991); Ausubel, FM et al., Current Protocol in Molecular Biology, John Willey & Sons (1987); And Chomczynski, P. et al., Anal. Biochem. 162:156 (1987)). For example, it is possible to easily isolate total RNA in cells using Trizol.

Then, cDNA is synthesized from the isolated mRNA, and this cDNA is amplified. Since the total RNA of the present invention is isolated from a human sample, it has a poly-A tail at the end of the mRNA, and cDNA can be easily synthesized using oligo dT primers and reverse transcriptase using such sequence properties ( See: PNAS USA, 85:8998 (1988); Libert F, et al., Science, 244:569 (1989); And Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press. (2001)). Then, the synthesized cDNA is amplified through a gene amplification reaction. The primer used in the present invention is hybridized or annealed at one site of the template to form a double-chain structure. Conditions for nucleic acid hybridization suitable for forming such a double-stranded structure are Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, DC (1985).

Various DNA polymerases can be used for the amplification of the present invention, and include the "Klenow" fragment of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase. Polymerases are thermostable DNA polymerases that can be obtained from various bacterial species, including Thermus aquaticus (Taq), Thermusthermophilus (Tth), Thermusfiliformis, Thermisflavus, Thermococcus literalis, and Pyrococcusfuriosus (Pfu). When carrying out the polymerization reaction, it is preferable to provide the reaction vessel with the components necessary for the reaction in excess. The excessive amount of components required for the amplification reaction means an amount such that the amplification reaction is not substantially limited to the concentration of the component. Cofactors such as Mg2+, dATP, dCTP, dGTP and dTTP are preferably provided to the reaction mixture to the extent that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, the buffer allows all enzymes to approach optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reactant without changing conditions such as addition of reactants.

In the present invention, annealing or hybridization is performed under stringent conditions that allow specific binding between the target nucleotide sequence and the primer. Stringent conditions for annealing are sequence-dependent and vary according to environmental variables.

As used herein, the term "amplification reaction" refers to a reaction to amplify a nucleic acid molecule. Various amplification reactions have been reported in the art, which are polymerase chain reaction (hereinafter referred to as PCR) (U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcription-polymerase chain reaction (hereinafter referred to as RT-PCR). (Sambrook et al., Molecular Cloning.A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329,822), ligase chain reaction (ligase chain reaction; LCR) (17, 18), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA) (19) (WO 88/10315), self sustained sequence replication (20) (WO 90/06995), selective amplification of target polynucleotide sequences (U.S. Patent No. 6,410,276), Consensus sequence primed polymerase chain reaction (CP-PCR) (U.S. Patent No. 4,437,975) and loop-mediated isothermal amplification (LAMP). Other amplification methods that can be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617 and U.S. Patent No. 09/854,317. The gene amplification method of the present invention may be carried out according to a polymerase chain reaction (PCR) disclosed in U.S. Patent Nos. 4,683,195, 4,683,202 and 4,800,159.

PCR is the most well-known nucleic acid amplification method, and its many modifications and applications have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction chain reaction (IPCR), vectorette PCR, thermal asymmetric interlaced PCR (TAIL-PCR), and multiplex PCR have been developed for specific applications. For more information on PCR, see McPherson, M.J., and Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000), the teachings of which are incorporated herein by reference.

The primer used in the gene amplification method in the present invention is an oligonucleotide having a sequence complementary to the cDNA sequence of the miRNA. Suitable lengths of primers are typically 15-30 nucleotides, although varying depending on various factors such as temperature and application of the primer. Short primer molecules generally require lower temperatures to form sufficiently stable hybrid complexes with the template.

The sequence of the primer does not need to have a sequence that is completely complementary to some of the sequences of the template, and it is sufficient to have sufficient complementarity within the range capable of hybridizing with the template to perform a unique function of the primer. Therefore, the primer set in the present invention does not need to have a sequence that is completely complementary to the cDNA sequence of the marker, which is a template, and it is sufficient if it has sufficient complementarity within a range capable of hybridizing to this sequence and acting as a primer. Preferably, the primer used in the present invention may have a sequence perfectly complementary to the cDNA sequence of the marker.

The design of such a primer can be easily carried out by a person skilled in the art by referring to the cDNA sequence of the miRNA, for example, it can be done using a primer design program (eg, PRIMER 3 program).

The cDNA of the marker thus amplified is analyzed by a suitable method to examine the level of expression of the gene of the marker. For example, gel electrophoresis is performed on the result of the amplification reaction described above, and the resulting band is observed and analyzed to examine the level of expression of the gene of the marker.

The normal control group is a normal person who has not received a kidney transplant or a person who has received a kidney transplant, but exhibits stable kidney function, has no major abnormal findings on histologic examination, antibody-mediated rejection, T cell-mediated rejection, mixed rejection or BK virus. Gene expression levels or expression patterns in samples collected from kidney transplant patients, etc. who do not show nephropathy, and samples collected from patients who want to know the presence or prognosis of kidney transplant rejection or BK virus nephropathy. By obtaining and comparing, it is possible to accurately predict the prognosis of the patient.

The information providing method related to the first aspect of the present invention includes (c) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa- measured in step (a). With miR-455-3p, hsa-miR-103a-3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p When the expression level of any one or more miRNA genes selected from the group consisting of is higher than the expression level in the normal control sample, the step of diagnosing antibody-mediated rejection after kidney transplantation may be further included.

Specifically, hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p, hsa-miR-192-5p , hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485, and the expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-221-3p is the expression level in the normal control sample If it is upregulated by more than 100%, preferably more than 200%, it can be diagnosed as antibody-mediated rejection.

With respect to the first aspect, the present invention also provides a method of screening for a therapeutic agent for antibody mediated rejection after kidney transplant comprising the following steps:

(a) treating the sample with a candidate substance for an antibody-mediated rejection treatment after kidney transplantation; And

(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p in the sample treated with the candidate substance , hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and the expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-221-3p Steps to measure.

In the therapeutic agent screening method of the present invention, the "sample" used for analysis is the same as the sample used in the information providing method.

The terms of the present invention, "candidate for the treatment of antibody-mediated rejection reaction", "candidate for the treatment of T cell-mediated rejection reaction", "candidate for the treatment of kidney transplant rejection", or "candidate for the treatment of BK virus nephropathy" Is a substance expected to treat antibody-mediated rejection, T cell-mediated rejection, kidney transplant rejection, or BK virus nephropathy, and directly or indirectly ameliorates or ameliorates kidney transplant rejection or BK virus nephropathy. It can be used without limitation as long as it is expected to be able to be made, and includes all expected therapeutic substances such as compounds, genes or proteins.

In the therapeutic agent screening method of the present invention, the step (b) of measuring the expression level of the miRNA gene may be performed by any method known to those skilled in the art. Specific examples include PCR, ligase chain reaction (LCR), transcription amplification, self-maintained sequence replication, nucleic acid-based sequence amplification (NASBA), co-immunoprecipitation assay, ELISA (Enzyme Linked Immunosorbent Assay), real-time RT-PCR, and the like may be used, but are not limited thereto.

The therapeutic agent screening method related to the first aspect of the present invention includes (c) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa- measured in step (b). With miR-455-3p, hsa-miR-103a-3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p When the expression level of any one or more miRNA genes selected from the group consisting of is suppressed in a sample not treated with a candidate material, the candidate material treated in step (a) is determined as an antibody-mediated rejection treatment after kidney transplantation. It may further include steps.

The second aspect of the present invention is from the group consisting of hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p. Diagnosis of antibody-mediated rejection (ABMR) by distinguishing from kidney transplantation, T cell mediated rejection (TCMR) or BK virus nephropathy, including any one or more selected miRNA genes. It relates to a biomarker composition for the following.

Information on the five kinds of miRNA gene biomarkers is as described in Table 1 above.

The term of the present invention, "BK virus nephropathy (BKVN)" means kidney disease caused by the BK virus, and is referred to as BK virus nephropathy or nephropathy. Nephropathy refers to a condition in which a lesion has occurred in the kidney, and it refers to all cases in which the unit of the disease is not established or the lesion is unclassified. Mainly, it occurs as a complication of the administration of immunosuppressants in kidney transplant patients, and the BK virus invades epithelial cells of the graft gland, causing inflammation, and eventually causing a decrease in the function of the transplanted kidney.

As used herein, the term "BK virus (BKV)" refers to a virus belonging to papovavirus. It is mainly isolated from the urine of cancer patients undergoing chemotherapy and patients with Wiskott-Aldrich syndrome.

Among kidney transplant patients, the present inventors compared antibody mediated with no major abnormality (NOMOA), T cell mediated rejection group (TCMR) and BK virus nephropathy group (BKVN) among kidney transplant patients. In the urine of patients with rejection reaction (ABMR), the expression of the aforementioned 5 miRNA genes was increased by more than 2 times, and the p-value value was less than 0.05 as a result of statistical analysis, so these miRNA gene biomarkers were used as T cells. It was found that it can be used as a diagnostic marker for antibody-mediated rejection without mediated rejection and/or BK virus nephropathy.

With respect to the second aspect, the present invention also provides hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p. A composition for diagnosing antibody-mediated rejection by distinguishing from T cell mediated rejection or BK virus nephropathy after kidney transplant, comprising an agent measuring the expression level of any one or more miRNA genes selected from the group consisting of, and A kit containing this is provided.

According to a preferred embodiment of the present invention, the hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p or hsa-miR-103a-3p The agent for measuring the expression level of the miRNA gene may include a primer or probe that specifically binds to the gene.

With respect to the second aspect, the present invention also provides a method for diagnosing antibody-mediated rejection after kidney transplantation, distinct from T cell mediated rejection or BK virus nephropathy, comprising the following steps:

(a) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p in biological samples isolated from individuals Measuring the expression level of any one or more miRNA genes selected from the group consisting of; And

(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a- measured in step (a) Comparing the expression level of any one or more miRNA genes selected from the group consisting of 3p with a normal control sample.

According to a preferred embodiment of the present invention, the information providing method comprises (c) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p measured in step (a). , When the expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-455-3p and hsa-miR-103a-3p is higher than that in the normal control sample, T cell mediated after kidney transplantation It may further comprise the step of diagnosing rejection or antibody mediated rejection not accompanied by BK virus nephropathy.

Specifically, any one selected from the group consisting of hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p When the expression level of the above miRNA gene is upregulated by 100% or more, preferably 200% or more than the expression level in the normal control sample, T cell mediated rejection and/or antibody mediated without BK virus nephropathy It can be diagnosed as sexual rejection.

With respect to the second aspect, the present invention also provides a method of screening for a therapeutic agent for antibody-mediated rejection after kidney transplant comprising the following steps:

(a) treating the sample with a candidate substance for a therapeutic agent for kidney transplant rejection; And

(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p in the sample treated with the candidate substance Measuring the expression level of any one or more miRNA genes selected from the group consisting of.

According to a preferred embodiment of the present invention, the screening method comprises (c) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, measured in step (a), When the expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-455-3p and hsa-miR-103a-3p is suppressed than in the sample not treated with the candidate substance, the treatment in step (a) above. It may further include the step of determining one candidate substance as a therapeutic agent for antibody-mediated rejection after kidney transplantation.

With respect to the second aspect of the present invention, descriptions of the same portions as those of the first aspect are omitted.

The third aspect of the present invention is hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR -126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p It relates to a miRNA gene biomarker composition for distinguishing and diagnosing kidney transplant rejection and BK virus nephropathy, including any one or more miRNA genes.

Among the 11 kinds of miRNA gene biomarkers, information on biomarkers not listed in Table 1 is shown in Table 2.

Mature miRNA gene order Sequence number Accession Number hsa-miR-345-5p GCUGACUCCUAGUCCAGGGCUC 11 MIMAT0000772 hsa-miR-215-5p AUGACCUAUGAAUUGACAGAC 12 MIMAT0000272 hsa-miR-1273g-3p ACCACUGCACUCCAGCCUGAG 13 MIMAT0022742 hsa-miR-19a-3p UGUGCAAAUCUAUGCAAAACUGA 14 MIMAT0000073 hsa-miR-223-3p UGUCAGUUUGUCAAAUACCCCA 15 MIMAT0000280

The present inventors compared an antibody-mediated rejection group (ABMR) and a T cell-mediated rejection group (TCMR) to a no major abnormality (NOMOA) among kidney transplant patients. In the urine of the indicated patient, the expression of the aforementioned 11 miRNA genes increased more than twice, and the p-value value was 0.05 or less as a result of statistical analysis, but these 11 miRNA genes were found in the BK virus nephropathy group (BKVN). Since there was no significant increase in expression, it was found that these miRNA gene biomarkers can be used as markers to differentiate between kidney transplant rejection and BK virus nephropathy.

Regarding the third aspect, the present invention also provides hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p , hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p It provides a composition for diagnosing and diagnosing kidney transplant rejection and BK virus nephropathy, including an agent for measuring the expression level of any one or more miRNA genes selected from the group, and a kit including the same.

According to a preferred embodiment of the present invention, the hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p , hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p The agent for measuring the expression level of any one or more miRNA genes selected from the group may include a primer or probe that specifically binds to the gene.

With respect to the third aspect, the present invention also provides a method for providing information for distinguishing and diagnosing kidney transplant rejection and BK virus nephropathy, comprising the following steps:

(a) hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p, in biological samples isolated from individuals The group consisting of hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p Measuring the expression level of any one or more miRNA genes selected from; And

(b) hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455- measured in step (a) 3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p Comparing the expression level of any one or more miRNA genes selected from the group consisting of a normal control sample.

According to a preferred embodiment of the present invention, the information providing method is (c) hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, measured in step (a). , hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa -If the expression level of any one or more miRNA genes selected from the group consisting of miR-19a-3p and hsa-miR-223-3p is higher than that in the normal control sample, kidney not accompanied by BK virus nephropathy It may further comprise the step of diagnosing transplant rejection.

Specifically, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p , hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and any one or more miRNAs selected from the group consisting of hsa-miR-223-3p When the expression level of the gene is upregulated by 100% or more, preferably 200% or more than the expression level in the normal control sample, it can be diagnosed as kidney transplant rejection without BK virus nephropathy.

In connection with the third aspect, the present invention also provides a method of screening for a therapeutic agent for renal transplant rejection, comprising the steps of:

(a) treating the sample with a candidate substance for a therapeutic agent for kidney transplant rejection; And

(b) hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p in the sample treated with the candidate substance , hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p Measuring the expression level of any one or more miRNA genes selected from the group.

According to a preferred embodiment of the present invention, the screening method is (c) measured in step (b), hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa- When the expression level of any one or more miRNA genes selected from the group consisting of miR-19a-3p and hsa-miR-223-3p is more suppressed in the sample not treated with the candidate substance, the candidate treated in step (a) above It may further include the step of determining the substance as a treatment for kidney transplant rejection.

With respect to the third aspect of the present invention, descriptions of the same parts as those of the first aspect are omitted.

The fourth aspect of the present invention is hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p , hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa -miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p, hsa-miR -205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p It relates to a biomarker composition for predicting prognosis after transplantation.

Among the 23 kinds of miRNA gene biomarkers, information on biomarkers not listed in Tables 1 and 2 is shown in Table 3.

Mature miRNA gene order Sequence number Accession Number hsa-miR-19b-3p UGUGCAAAUCCAUGCAAAACUGA 16 MIMAT0000074 hsa-miR-31-5p AGGCAAGAUGCUGGCAUAGCU 17 MIMAT0000089 hsa-miR-17-5p CAAAGUGCUUACAGUGCAGGUAG 18 MIMAT0000070 hsa-miR-205-5p UCCUUCAUUCCACCGGAGUCUG 19 MIMAT0000266 hsa-miR-4449 CGUCCCGGGGCUGCGCGAGGCA 20 MIMAT0018968 hsa-miR-106a-5p AAAAGUGCUUACAGUGCAGGUAG 21 MIMAT0000103 hsa-miR-514a-3p AUUGACACUUCUGUGAGUAGA 22 MIMAT0002883 hsa-miR-125b-5p UCCCUGAGACCCUAACUUGUGA 23 MIMAT0000423

The present inventors compared to the normal control group (no major abnormality, NOMOA) without major abnormalities on histological examination among kidney transplant patients, antibody-mediated rejection (ABMR), T cell-mediated rejection (TCMR) and BK virus. In the urine of patients with nephropathy (BKVN), the expression of the aforementioned 23 miRNA genes increased by more than 2 times, and the p-value value was less than 0.05 as a result of statistical analysis, so these miRNA gene biomarkers were renal transplanted. It was found that it can be used as a marker for predicting the posterior prognosis.

With respect to the fourth aspect, the present invention provides hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR- 31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455- 3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p, Expression of any one or more miRNA genes selected from the group consisting of hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p It provides a composition for predicting prognosis after kidney transplantation, including an agent for measuring the level, and a kit including the same.

According to a preferred embodiment of the present invention, the hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR -31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455 -3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p , hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p of any one or more miRNA genes selected from the group consisting of The agent for measuring the expression level may include a primer or probe that specifically binds to the gene.

With respect to the fourth aspect, the present invention also provides a method of providing information for predicting prognosis after kidney transplantation comprising the following steps:

(a) hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR- in biological samples isolated from individuals 31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455- 3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p, Expression of any one or more miRNA genes selected from the group consisting of hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p Measuring the level; And

(b) measured in the step (a), hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa- miR-31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR- 455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223- Any one or more miRNA genes selected from the group consisting of 3p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p Comparing the expression level of the normal control sample.

According to a preferred embodiment of the present invention, the information providing method is (c) measured in step (a), hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa -miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328 -5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p , hsa-miR-19a-3p, hsa-miR-223-3p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR When the expression level of any one or more miRNA genes selected from the group consisting of -125b-5p is higher than the expression level in the normal control sample, predicting that a kidney transplant has a poor prognosis may be further included.

Specifically, hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR -17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126 -3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p, hsa-miR-205-5p , hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p. When the expression level is upregulated by 100% or more, preferably 200% or more, it can be predicted to have a poor prognosis after kidney transplantation.

In the information providing method of the fourth aspect, "poor prognosis after kidney transplantation" means that kidney transplant rejection including antibody-mediated rejection and T cell-mediated rejection and/or BK virus nephropathy appear.

In connection with the fourth aspect, the present invention also provides a method of screening for a treatment for kidney transplant rejection and/or a treatment for BK virus nephropathy in a patient with a poor prognosis after a kidney transplant, comprising the steps of:

(a) treating the sample with a candidate substance for the treatment of kidney transplant rejection and/or the treatment of BK virus nephropathy; And

(b) hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR in the sample treated with the candidate substance -31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-103a-3p, hsa-miR-455 -3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p , hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p of any one or more miRNA genes selected from the group consisting of Measuring the expression level.

According to a preferred embodiment of the present invention, the screening method is (c) measured in step (b), hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa- miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-192-5p, hsa-miR-126-5p, hsa-miR-328- 5p, hsa-miR-103a-3p, hsa-miR-455-3p, hsa-miR-126-3p, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p, hsa-miR-223-3p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR- When the expression level of any one or more miRNA genes selected from the group consisting of 125b-5p is more suppressed in the sample not treated with the candidate material, the candidate material treated in step (a) is used as a kidney transplant rejection treatment agent and/or It may further include the step of determining as a therapeutic agent for BK virus nephropathy.

With respect to the fourth aspect of the present invention, descriptions of the same parts as those of the first aspect are omitted.

Hereinafter, the present invention will be described in more detail through examples. However, since the present invention can be modified in various ways and has various forms, specific examples and descriptions described below are only to aid understanding of the present invention, and limit the present invention to a specific disclosure form. I'm not trying to do it. It is to be understood that the scope of the present invention includes all changes, equivalents, and substitutes included in the spirit and scope of the present invention.

Preparation of the sample

1-1. Selection of patients and preparation of urine samples

To find biomarkers for diagnosing antibody-mediated rejection in kidney transplant patients, urine samples were collected 2-3 hours before biopsy in 15 patients who underwent an indication biopsy within 5 years after kidney transplantation. Collected. In addition, urine samples were collected from living kidney donors immediately before kidney donation surgery. Patients were classified into 4 groups according to the pathological diagnosis of biopsy as shown in Table 4; 4 antibody-mediated rejection (ABMR) groups, 4 T cell mediated rejection (TCMR) groups, 3 BK virus nephropathy (BKVN) groups, and 4 no major abnormalities (NOMOA) groups, mixed homologs Urine from patients with heterologous lesions was excluded. The collected urine sample was centrifuged for 15 minutes at 4,000 rpm and 4° C. by putting the protease inhibitor mixture, and the supernatant was collected and stored frozen until use. This study was conducted with the approval of the Asan Hospital Medical Institution Evaluation Committee, and written consent was obtained from all patients.

Sample name group order One Bx579-1 NOMOA 1805KHP-0067 2 Bx613 NOMOA 1808AHP-0002 3 Bx623-1 NOMOA 1808AHP-0002 4 Bx632 NOMOA 1808AHP-0002 5 Bx144 TCMR 1805KHP-0067 6 Bx39-1 TCMR 1805KHP-0067 7 Bx201-1 TCMR 1805KHP-0067 8 Bx175 TCMR 1808AHP-0002 9 Bx107 BKVN 1805KHP-0067 10 Bx650 BKVN 1805KHP-0067 11 Bx98-1 BKVN 1805KHP-0067 12 Bx85 ABMR 1804AHP-0057 13 Bx376 ABMR 1804AHP-0057 14 Bx326 ABMR 1804AHP-0057 15 Bx605 ABMR 1804AHP-0057

1-2. Isolation of urine-derived exosomes and miRNA in exosomes

Urine in cryopreservation was dissolved at room temperature (RT) and centrifuged at 17,000xg at 4° C. for 15 minutes to remove cell debris, and the supernatant was filtered through a 450 nm filter. Centrifuge at 200,000xg for 1 hour using an ultra-high-speed centrifuge to obtain a precipitate, centrifuge for 1 hour at 200,000xg with PBS, wash, dissolve in 200ul of PBS, collect exosomes, and collect small RNA isolation kit (miRNeasy mini kit, Quiagen) was used to separate RNA according to the suggested method and stored at 80°C.

Selection and identification of miRNA gene biomarker candidates

In order to select a specific biomarker representing each pathological group, a t-test was used to select a miRNA gene that showed a difference of more than 2 times when compared with the NOMOA group, respectively, using a t-test. did. For RNA, using the RNA bioanalyzer pico 6000 chip, we commissioned an RNA-seq company to perform QC, and then produced a library with Illumnia smarter kit. RNA-seq was amplified by an adapter ligation to a genome of 20 nt size through size fractionation, amplified by RT-RCR, and then sequenced with Hi-seq. As a result of this, miRNAs that expressed statistically significant expression with more than twice the expression level compared to the normal group were selected.

A more specific process of selecting candidates for miRNA gene biomarkers is as follows.

As shown in FIG. 1, as a first step, 2,588 mature miRNAs were selected from the 15 samples prepared in Example 1 above. As a second step, for important data, a hierarchical cluster analysis (Uriclidean method, fully correlated) grouping samples with similar expression levels and mature miRNAs was performed, and this was shown as a heatmap in FIG. 2. For each mature miRNA, among a total of 2,588 mature miRNAs in a total of 15 samples, the mature miRNAs having a count value of 0 were excluded from the analysis. Statistical analysis was performed on 892 mature miRNAs.

Compared to NOMOA, ABMR, TCMR and compared to NOMOA by selecting genes with a p-value of 0.05 or less, and filtering genes by selecting genes whose expression increases or decreases by more than two times based on the NOMOA group through the first and second screening processes. Up- or down-regulated miRNAs were identified in BKVN patients. MiRNAs with increased expression levels are indicated in red, and miRNAs with decreased expression levels are indicated in green, as shown in FIG. 3(A). In particular, as shown in FIG. 3(B), 10 miRNA genes with increased expression levels in the ABMR group compared to the NOMOA group were selected, 11 from TCMR patients, and 12 from BKVN, and the list is shown in Table 5.

group Number of biomarkers Selected miRNA gene ABMR 10 hsa-miR-8485
hsa-miR-221-3p
hsa-miR-331-3p
hsa-miR-1290
hsa-miR-192-5p
hsa-miR-126-5p
hsa-miR-328-5p
hsa-miR-103a-3p
hsa-miR-455-3p
hsa-miR-126-3p TCMR 11 hsa-miR-8485
hsa-miR-221-3p
hsa-miR-19b-3p
hsa-miR-31-5p
hsa-miR-17-5p
hsa-miR-192-5p
hsa-miR-345-5p
hsa-miR-215-5p
hsa-miR-1273g-3p
hsa-miR-19a-3p
hsa-miR-223-3p BKVN 12 hsa-miR-8485
hsa-miR-221-3p
hsa-miR-331-3p
hsa-miR-1290
hsa-miR-19b-3p
hsa-miR-31-5p
hsa-miR-17-5p
hsa-miR-205-5p
hsa-miR-4449
hsa-miR-106a-5p
hsa-miR-514a-3p
hsa-miR-125b-5p

Identification of pathological groups according to selected miRNA gene biomarkers

3-1. Identification of miRNA gene biomarkers showing increased expression levels in the ABMR group compared to the TCMR group and the BKVN group

Among the miRNA genes whose expression levels were increased in the ABMR group compared to the NOMOA group selected in Example 2, five miRNA genes showing a significant difference in expression patterns compared to the TCMR group and the BKVN group were selected, and the results are shown in FIG. 4(A). Showed. 4(A), hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p There were significant differences in expression patterns of the 5 miRNA genes in the TCMR group and the BKVN group. In addition, as shown in Fig. 4(B) and Table 6, it was confirmed that the expression level of the five miRNA genes increased more than two times in the ABMR group compared to the NOMOA group, and had statistical significance as p<0.05.

Fc and p values for 5 miRNA genes with increased expression levels in the ABMR group compared to the NOMOA group Mature miRNA ABMR/NOMOA.fc ABMR/NOMOA.
raw.pval hsa-miR-126-3p 68.50836132 0.001521504 hsa-miR-328-5p 18.95670412 0.028949512 hsa-miR-126-5p 6.349283058 0.04204756 hsa-miR-455-3p 4.462248233 0.030123151 hsa-miR-103a-3p 3.468801322 0.041345617

Through these results, it can be confirmed that the five miRNA genes can be used as a biomarker for diagnosing ABMR by distinguishing from TCMR or BKVN as well as normal groups.

3-2. Identification of miRNA gene biomarkers showing increased expression levels in TCMR group compared to ABMR group and BKVN group

Among the miRNA genes whose expression levels were increased in the TCMR group compared to the NOMOA group selected in Example 2, five miRNA genes showing a significant difference in expression patterns compared to the ABMR group and the BKVN group were selected, and the results are shown in FIG. 5(A). Showed. 5(A), hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p There were significant differences in expression patterns of the five miRNA genes in the ABMR group and the BKVN group. In addition, as shown in Fig. 5(B) and Table 7, the expression level of the 5 miRNA genes increased by more than 2 times in the TCMR group compared to the NOMOA group, and it was confirmed that there is statistical significance as p<0.05.

Fc and p values for 5 miRNA genes with increased expression levels in the TCMR group compared to the NOMOA group Mature miRNA TCMR/NOMOA.fc TCMR/NOMOA.
raw.pval hsa-miR-223-3p 32.74820417 0.048789474 hsa-miR-215-5p 15.7181011 0.000681271 hsa-miR-345-5p 4.382669986 0.027876534 hsa-miR-19a-3p 3.350489467 0.038075117 hsa-miR-1273g-3p 2.611936568 0.021783891

Through these results, it can be confirmed that the five miRNA genes can be used as a biomarker for diagnosing ABMR by distinguishing not only from the normal group but also from ABMR or BKVN.

3-3. Identification of miRNA gene biomarkers showing increased expression levels in the BKVN group compared to the ABMR group and the TCMR group

Among the miRNA genes whose expression levels were increased in the BKVN group compared to the NOMOA group selected in Example 2, five miRNA genes showing a significant difference in expression patterns compared to the ABMR group and the TCMR group were selected, and the results are shown in FIG. 6(A). Showed. 6(A), 5 of hsa-miR-4449, hsa-miR-514a-3p, hsa-miR-106a-5p, hsa-miR-205-5p and hsa-miR-125b-5p There were significant differences in the expression patterns of species miRNA genes compared to the ABMR group and TCMR group. In addition, as shown in Fig. 6(B) and Table 8, the expression level of the five miRNA genes increased more than twice in the BKVN group compared to the NOMOA group, and it was confirmed that there is statistical significance as p<0.05.

Fc and p values for 5 miRNA genes with increased expression levels in the BKVN group compared to the NOMOA group Mature miRNA BKVN/NOMOA.fc BKVN/NOMOA.
raw.pval hsa-miR-4449 97.73931542 0.002109469 hsa-miR-514a-3p 27.83153494 0.04499645 hsa-miR-106a-5p 10.65524582 0.02574265 hsa-miR-205-5p 5.24474511 0.035616063 hsa-miR-125b-5p 3.278234589 0.049386561

Through these results, it can be confirmed that the five miRNA genes can be used as biomarkers for diagnosing BKVN by distinguishing them from ABMR or TCMR as well as normal groups.

3-4. Grouping of biomarkers by pathological group

Based on the above results, the list of biomarkers in Table 2 was regrouped as shown in Table 9, and this is shown as a Venn diagram in FIG. 7.

group Number of biomarkers Selected miRNA gene ABMR BKVN TCMR 2 hsa-miR-8485
hsa-miR-221-3p ABMR BKVN 2 hsa-miR-331-3p
hsa-miR-1290 BKVN TCMR 3 hsa-miR-19b-3p
hsa-miR-31-5p
hsa-miR-17-5p ABMR TCMR One hsa-miR-192-5p ABMR 5 hsa-miR-126-5p
hsa-miR-328-5p
hsa-miR-103a-3p
hsa-miR-455-3p
hsa-miR-126-3p TCMR 5 hsa-miR-345-5p
hsa-miR-215-5p
hsa-miR-1273g-3p
hsa-miR-19a-3p
hsa-miR-223-3p BKVN 5 hsa-miR-205-5p
hsa-miR-4449
hsa-miR-106a-5p
hsa-miR-514a-3p
hsa-miR-125b-5p

Using the biomarkers grouped as described above, antibody-mediated rejection, T cell rejection, and BK virus nephropathy after kidney transplantation can be distinguished and diagnosed.

Validation of selected miRNA biomarkers

In the grouped biomarkers of Table 9, miRNA-445-3p and miRNA-126-3p, whose expression levels specifically increase in the ABMR group, and miRNA-221-3p, which increase expression levels in all of the ABMR, BKVN, and TCMR groups, The verification was carried out.

As in Example 1, urine samples were collected 2 to 3 hours before the biopsy from patients who underwent an indication biopsy within 5 years after kidney transplantation, and urine samples were collected immediately before kidney donation surgery from a living kidney donor. . As shown in Table 4, patients were classified into 4 groups according to the pathological diagnosis of biopsy, and urine of patients with mixed allopathic lesions were excluded. A living kidney donor was selected as a robust control, and urine samples were collected immediately before kidney donation surgery.

The number of samples used for verification of each biomarker is shown in Table 10.

miRNA Strong control NOMOA ABMR miR-445-3p 9 8 20 miR-126-3p 9 8 20 miR-221-3p 7 7 20

The collected urine sample was centrifuged at 4,000 rpm and 4° C. for 15 minutes by adding the protease inhibitor mixture, and the supernatant was collected and stored frozen until use. This study was conducted with the approval of the Asan Hospital Medical Institution Evaluation Committee, and written consent was obtained from all patients.

Thereafter, for separation of urine-derived exosomes and miRNAs in exosomes, samples were treated in the same manner as in Example 1-2, and then RT-PCR was performed on the three miRNAs of Table 10. Gene expression levels were analyzed using QuantStudio ^TM Real-Time PCR software (Applied Biosystems).

8, miRNA-445-3p, miRNA-126-3p, and miRNA-221-3p all showed significantly higher expression levels in the ABMR group than in the NOMOA group. For these results, a ROC (Receiver-Operating Characteristic) curve was drawn and the AUC (Area under the ROC curve; AUC) value was calculated. As shown in Table 11, miRNA-445-3p was 0.825 and miRNA-126-3p was 0.944. , miRNA-221-3p showed a very high value of 0.887, confirming that all three biomarkers are clinically very useful for ABMR diagnosis.

miRNA AUC Sensitivity (%) Specificity (%) Cut off value miR-445-3p 0.825 90 62.5 >29.91 miR-126-3p 0.944 85 100 >1.324 miR-221-3p 0.887 89.47 85.71 >12.30

SEQUENCE LISTING <110> THE ASAN FOUNDATION University of Ulsan Foundation For Industry Cooperation <120> Urinary exosome-derived miRNA gene biomarkers for diagnosis of antibody-mediated rejection in kidney allografts and use thereof <130> 1067970 <150> KR 10-2019-0104723 <151> 2019-08-26 <160> 23 <170> PatentIn version 3.2 <210> 1 <211> 22 <212> RNA <213> Artificial <220> <223> hsa-miR-126-3p <400> 1 ucguaccgug aguaauaaug cg 22 <210> 2 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-126-5p <400> 2 cauuauuacu uuugguacgc g 21 <210> 3 <211> 23 <212> RNA <213> Artificial <220> <223> hsa-miR-328-5p <400> 3 gggggggcag gaggggcuca ggg 23 <210> 4 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-455-3p <400> 4 gcaguccaug ggcauauaca c 21 <210> 5 <211> 23 <212> RNA <213> Artificial <220> <223> hsa-miR-103a-3p <400> 5 agcagcauug uacagggcua uga 23 <210> 6 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-192-5p <400> 6 cugaccuaug aauugacagc c 21 <210> 7 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-331-3p <400> 7 gccccugggc cuauccuaga a 21 <210> 8 <211> 19 <212> RNA <213> Artificial <220> <223> hsa-miR-1290 <400> 8 uggauuuuug gaucaggga 19 <210> 9 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-8485 <400> 9 cacacacaca cacacacgua u 21 <210> 10 <211> 23 <212> RNA <213> Artificial <220> <223> hsa-miR-221-3p <400> 10 agcuacauug ucugcugggu uuc 23 <210> 11 <211> 22 <212> RNA <213> Artificial <220> <223> hsa-miR-345-5p <400> 11 gcugacuccu aguccagggc uc 22 <210> 12 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-215-5p <400> 12 augaccuaug aauugacaga c 21 <210> 13 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-1273g-3p <400> 13 accacugcac uccagccuga g 21 <210> 14 <211> 23 <212> RNA <213> Artificial <220> <223> hsa-miR-19a-3p <400> 14 ugugcaaauc uaugcaaaac uga 23 <210> 15 <211> 22 <212> RNA <213> Artificial <220> <223> hsa-miR-223-3p <400> 15 ugucaguuug ucaaauaccc ca 22 <210> 16 <211> 23 <212> RNA <213> Artificial <220> <223> hsa-miR-19b-3p <400> 16 ugugcaaauc caugcaaaac uga 23 <210> 17 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-31-5p <400> 17 aggcaagaug cuggcauagc u 21 <210> 18 <211> 23 <212> RNA <213> Artificial <220> <223> hsa-miR-17-5p <400> 18 caaagugcuu acagugcagg uag 23 <210> 19 <211> 22 <212> RNA <213> Artificial <220> <223> hsa-miR-205-5p <400> 19 uccuucauuc caccggaguc ug 22 <210> 20 <211> 22 <212> RNA <213> Artificial <220> <223> hsa-miR-4449 <400> 20 cgucccgggg cugcgcgagg ca 22 <210> 21 <211> 23 <212> RNA <213> Artificial <220> <223> hsa-miR-106a-5p <400> 21 aaaagugcuu acagugcagg uag 23 <210> 22 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-514a-3p <400> 22 auugacacuu cugugaguag a 21 <210> 23 <211> 22 <212> RNA <213> Artificial <220> <223> hsa-miR-125b-5p <400> 23 ucccugagac ccuaacuugu ga 22

Claims (22)

hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p, hsa-miR-192-5p, hsa- Antibody mediated rejection, comprising any one or more miRNA genes selected from the group consisting of miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p ABMR) biomarker composition for diagnosis. hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p, hsa-miR-192-5p, hsa- After kidney transplantation, comprising an agent measuring the expression level of any one or more miRNA genes selected from the group consisting of miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p A composition for diagnosing antibody mediated rejection. The method of claim 2, wherein the hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p, hsa-miR A formulation measuring the expression level of any one or more miRNA genes selected from the group consisting of -192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p A composition for diagnosing antibody-mediated rejection after kidney transplantation, comprising a primer or probe that specifically binds to the gene. A kit for diagnosing antibody-mediated rejection after kidney transplantation, comprising the composition of claim 2 or 3. The kit for diagnosing antibody-mediated rejection after kidney transplantation according to claim 4, wherein the kit is a real-time PCR (RT-PCR) kit, a microarray kit, or a Serial Analysis of Gene Expression (SAGE) kit. (a) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p, in biological samples isolated from individuals The expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p Measuring;
(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a- measured in step (a) Expression of any one or more miRNA genes selected from the group consisting of 3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p A method of providing information for diagnosis of antibody-mediated rejection after kidney transplant, comprising the step of comparing the level with a normal control sample. The method of claim 6, wherein the biological sample in step (a) is urine or urine-derived exosomes. The method of claim 7, (c) measured in the step (a), hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, Any selected from the group consisting of hsa-miR-103a-3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p When the expression level of one or more miRNA genes is higher than that in the normal control sample, for diagnosis of antibody-mediated rejection after kidney transplantation, further comprising the step of diagnosing as antibody-mediated rejection after kidney transplantation. How to provide information. (a) treating the sample with a candidate substance for the treatment of antibody-mediated rejection after kidney transplantation; And
(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, hsa-miR-103a-3p in the sample treated with the candidate substance , hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and the expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-221-3p A method of screening for a therapeutic agent for antibody-mediated rejection after kidney transplant, comprising the step of measuring. The method of claim 9, wherein the sample in step (a) is urine or urine-derived exosomes. The method of claim 10, (c) measured in the step (b), hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, Any selected from the group consisting of hsa-miR-103a-3p, hsa-miR-192-5p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-8485 and hsa-miR-221-3p When the expression level of one or more miRNA genes is more suppressed in the sample not treated with the candidate substance, further comprising the step of determining the candidate substance treated in step (b) as a therapeutic agent for antibody-mediated rejection reaction after kidney transplantation. , Screening method for the treatment of antibody-mediated rejection after kidney transplantation. Any one or more miRNA genes selected from the group consisting of hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p A biomarker composition for diagnosing an antibody-mediated rejection (ABMR) after kidney transplantation, comprising a T cell mediated rejection (TCMR) or BK virus nephropathy. Any one or more miRNA genes selected from the group consisting of hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p A composition for diagnosing antibody-mediated rejection by distinguishing from T cell mediated rejection or BK virus nephropathy after kidney transplant, comprising an agent measuring the expression level of. The method of claim 13, wherein from the group consisting of hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p Agents for measuring the expression level of any one or more selected miRNA genes include primers or probes that specifically bind to the gene, and antibody-mediated after kidney transplantation, distinct from T cell-mediated rejection or BK virus nephropathy. A composition for diagnosing rejection. A kit for diagnosing antibody-mediated rejection by distinguishing from T cell mediated rejection or BK virus nephropathy after kidney transplant, comprising the composition of claim 13 or 14. The method of claim 15, wherein the kit is a real-time PCR (RT-PCR) kit, a microarray kit, or a Serial Analysis of Gene Expression (SAGE) kit, T cell mediated rejection after kidney transplantation or BK virus A kit for diagnosing antibody-mediated rejection in a distinction from nephropathy. (a) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p in biological samples isolated from individuals Measuring the expression level of any one or more miRNA genes selected from the group consisting of;
(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a- measured in step (a) Comprising the step of comparing the expression level of any one or more miRNA genes selected from the group consisting of 3p with a normal control sample, T cell mediated rejection after kidney transplantation or antibody-mediated rejection in distinction from BK virus nephropathy How to provide information for diagnosis. The method of claim 17, wherein the biological sample in step (a) is urine or urine-derived exosomes, and the diagnosis of antibody-mediated rejection is differentiated from T cell mediated rejection or BK virus nephropathy after kidney transplantation. How to provide information for. The method of claim 17, (c) measured in the step (a), hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, and When the expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-103a-3p is higher than that in the normal control sample, T cell mediated rejection or BK virus nephropathy is accompanied after kidney transplantation. A method of providing information for the diagnosis of antibody-mediated rejection, distinguishing from T cell-mediated rejection or BK virus nephropathy after kidney transplantation, further comprising the step of diagnosing an antibody-mediated rejection that does not do. (a) treating the sample with a candidate substance for a therapeutic agent for kidney transplant rejection; And
(b) hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p in the sample treated with the candidate substance A method for screening an antibody-mediated rejection therapeutic agent after kidney transplant, comprising measuring the expression level of any one or more miRNA genes selected from the group consisting of. The method of claim 20, wherein the sample in step (a) is urine or urine-derived exosomes. The method of claim 21, (c) measured in step (b), hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p, and When the expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-103a-3p is more suppressed in the sample not treated with the candidate material, the candidate material treated in step (a) is then transplanted to the antibody. A method for screening an antibody-mediated rejection treatment agent after kidney transplantation, further comprising the step of determining as a mediated rejection treatment agent.

Images