KR101929009B1 - composition for diagnosing stroke and method for diagnosing stroke - Google Patents

composition for diagnosing stroke and method for diagnosing stroke Download PDF

Info

Publication number
KR101929009B1
KR101929009B1 KR1020160040948A KR20160040948A KR101929009B1 KR 101929009 B1 KR101929009 B1 KR 101929009B1 KR 1020160040948 A KR1020160040948 A KR 1020160040948A KR 20160040948 A KR20160040948 A KR 20160040948A KR 101929009 B1 KR101929009 B1 KR 101929009B1
Authority
KR
South Korea
Prior art keywords
mir
hsa
arg1
stroke
mirna
Prior art date
Application number
KR1020160040948A
Other languages
Korean (ko)
Other versions
KR20170114099A (en
Inventor
오승헌
김진권
Original Assignee
의료법인 성광의료재단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 의료법인 성광의료재단 filed Critical 의료법인 성광의료재단
Priority to KR1020160040948A priority Critical patent/KR101929009B1/en
Publication of KR20170114099A publication Critical patent/KR20170114099A/en
Application granted granted Critical
Publication of KR101929009B1 publication Critical patent/KR101929009B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

개체의 뇌졸중을 진단하기 위한 진단용 조성물 및 키트, 및 뇌졸중을 진단하기 위한 방법에 의하면 시료 내 miRNA 등의 유전적 변화를 이용하여 뇌졸중을 효율적으로 진단할 수 있고, 허혈성 질환 또는 염증성 질환을 치료하기 위한 후보물질을 스크리닝하는 방법에 따르면 miR-340-5p 및 ARG1 유전자 서열을 포함하는 뉴클레오티드 사이의 결합을 저해하는 물질을 선별하여 상기 허혈성 질환 또는 염증성 질환을 치료하기 위한 후보물질을 효율적으로 스크리닝할 수 있다.According to the diagnostic composition and kit for diagnosing stroke of an individual, and the method for diagnosing stroke, it is possible to efficiently diagnose a stroke using genetic changes such as miRNA in a sample, and to treat ischemic diseases or inflammatory diseases According to the screening method for a candidate substance, a substance that inhibits binding between nucleotides including the miR-340-5p and ARG1 gene sequences can be screened to efficiently screen candidates for treating the ischemic diseases or inflammatory diseases .

Description

뇌졸중 진단용 조성물 및 이를 진단하는 방법{composition for diagnosing stroke and method for diagnosing stroke}TECHNICAL FIELD The present invention relates to a composition for diagnosing stroke and a method of diagnosing stroke,

개체의 뇌졸중을 진단하기 위한 진단용 조성물 및 진단하는 방법에 관한 것이다.A diagnostic composition for diagnosing a stroke of an individual, and a diagnostic method.

뇌허혈이 진행되면 뇌의 혈액 세포들이 손상을 입어 뇌졸중의 병태에 빠진다. 중추 신경계(CNS)의 손상은 혈액-유래 염증 세포의 활성화와, 이에 의한 순환 염증 유발성(circulating pro-inflammatory) 사이토카인(cytokine) 및 케모카인(chemokine)의 생성 및 방출을 유도한다. 활성화된 백혈구는 허혈성 뇌로 이동하고 염증을 악화시켜, 결국 신경 세포가 사멸에 이르게 한다. 그러나, 이러한 말초 혈액 세포의 뇌에 손상을 입히는 급성 면역 반응의 메커니즘에 대한 분자 수준의 메커니즘은 알려지지 않았다. As the cerebral ischemia progresses, the blood cells of the brain are damaged and fall into the condition of stroke. Damage of the central nervous system (CNS) induces the activation of blood-derived inflammatory cells and thereby the production and release of circulating pro-inflammatory cytokines and chemokines. Activated leukocytes migrate to the ischemic brain and exacerbate inflammation, leading to neuronal cell death. However, a molecular-level mechanism for the mechanism of acute immune response that damages the brain of these peripheral blood cells is unknown.

최근 마이크로어레이 기술의 개발로 인해 뇌졸중을 포함하는 다양한 질병들의 분자적 징후들을 알 수 있게 되었다. 여러 마이크로 어레이 연구에서 뇌졸중을 겪는 도중 말초 혈액 세포에서의 분명한 유전적 변화가 보고되었다. 말초 혈액의 유전적 프로파일링은 뇌졸중과 뇌졸중의 서브타입, 또는 신규한 뇌졸중의 분자적 병태 생리를 확인하는데 이용될 수 있다. 이러한 유전적 변화 중 miRNA의 변화에 대한 연구 역시 활발히 진행되고 있다.Recent developments in microarray technology have made it possible to identify molecular manifestations of various diseases, including stroke. Several microarray studies have reported a clear genetic change in peripheral blood cells during stroke. Genetic profiling of peripheral blood can be used to identify subtypes of strokes and strokes, or the molecular pathophysiology of novel strokes. Studies of miRNA changes during these genetic changes are also actively underway.

miRNA는 비-암호화된 18-25 뉴클레오티드 길이의 작은 RNA로서, 유전자 발현의 주요한 내생적 조절자이다. miRNA는 표적 mRNA의 3' 비번역 영역(3'-UTR)에 결합하여 번역 억제 또는 mRNA 분해를 유도하여 표적 유전자의 발현을 저해한다. miRNA로 추정되는 약 1,500종의 RNA가 밝혀졌고, 포유류 유전자의 최대 30% 정도가 miRNA로 조절되는 것으로 예측된다. 많은 miRNA들이 세포 주기, 조혈 및 세포 대사에서 주요한 역할을 하고 있으며, 여러 연구에서 miRNA가 뇌허혈증의 진행 또는 재관류에서 뇌뿐만 아니라 말초 혈액에서도 일시적으로 조절되는 것을 밝혀내었다. 뇌졸중에서 발현이 변화하는 miRNA들은 염증, 내피(endothelial)/혈관 기능, 적혈구 생성(erythropoiesis), 혈관 신생(angiogenesis), 신경 기능 및 저산소증(hypoxia)과 관련있는 것으로 추정된다. 그러나 뇌졸중의 급성기(acute phase)에서의 혈액 miRNA의 발현 패턴에 대한 연구는 거의 수행되지 않았다. 그러므로, miRNA 프로파일링 및 이들의 표적 유전자에 대한 조절 역할에 관한 추가적인 연구가 필요한 실정이다.miRNAs are small RNAs of 18-25 nucleotide lengths that are unencrypted and are the major endogenous regulators of gene expression. miRNA binds to the 3 'untranslated region (3'-UTR) of the target mRNA and induces translation inhibition or mRNA degradation, thereby inhibiting the expression of the target gene. Approximately 1,500 RNAs that are estimated to be miRNAs have been identified, and up to 30% of the mammalian genes are predicted to be regulated by miRNAs. Many miRNAs play a major role in cell cycle, hematopoiesis, and cell metabolism, and several studies have shown that miRNAs are transiently regulated in brain as well as peripheral blood in the progression or reperfusion of cerebral ischemia. MiRNAs whose expression changes in stroke are presumed to be related to inflammation, endothelial / vascular function, erythropoiesis, angiogenesis, neurological function and hypoxia. However, little research has been done on the expression patterns of blood miRNAs in the acute phase of stroke. Therefore, additional studies are needed on miRNA profiling and their regulatory role on target genes.

특히 급성 허혈성 뇌졸중의 진단은 신경학적 이상의 임상적 진단과 CT, MRI등을 이용한 영상의학적 방법에 의존적으로 수행되고 있다. 그러나 신속한 진단이 필요한 급성 허혈성 뇌졸중의 특성상, 혈액에서 뇌졸중에 특이적인 유전적 변화를 찾기 위한 노력이 계속되고 있다.In particular, the diagnosis of acute ischemic stroke is based on neurological abnormalities and imaging modalities using CT and MRI. However, due to the nature of acute ischemic stroke requiring rapid diagnosis, efforts are underway to find a genetic change specific to stroke in the blood.

일 양상은 개체의 뇌졸중을 진단하기 위한 진단용 조성물 및 키트를 제공한다.One aspect provides diagnostic compositions and kits for diagnosing stroke in an individual.

다른 양상은 개체의 뇌졸중을 진단하기 위한 방법을 제공한다.Another aspect provides a method for diagnosing stroke in an individual.

다른 양상은 허혈성 질환 또는 염증성 질환을 치료하기 위한 후보물질을 스크리닝하는 방법을 제공한다.Another aspect provides a method of screening candidate substances for treating ischemic diseases or inflammatory diseases.

일 양상은 hsa-miR-579-3p, hsa-miR-140-5p, hsa-miR-186-5p, hsa-miR-301a-3p, hsa-miR-18b-5p, hsa-miR-19a-3p, hsa-miR-362-3p, hsa-miR-32-5p, hsa-miR-340-5p, hsa-miR-142-3p, hsa-miR-144-3p, hsa-miR-660-5p, hsa-miR-335-5p, hsa-miR-517b-3p, hsa-miR-664a-5p, hsa-miR-1301-3p, solexa-7534-111, hsa-miR-1270, hsa-miR-628-5p, HS_22.1, HS_10, hsa-miR-1294, hsa-miR-1229-3p, hsa-let-7e, hsa-miR-877-5p, hsa-miR-505-5p, HS_108.1, hsa-miR-1238-5p, solexa-3464-254 및 hsa-miR-544a로 이루어진 군으로부터 선택된 하나 이상의 miRNA의 수준을 측정하기 위한 제제를 포함하는, 개체의 뇌졸중 진단용 조성물을 제공한다.Hsa-miR-18a-3p, hsa-miR-18b-5p, hsa-miR-19a-3p , hsa-miR-362-3p, hsa-miR-32-5p, hsa-miR-340-5p, hsa-miR-142-3p, hsa-miR-144-3p, HSA-miR-335-5p, hsa-miR-517b-3p, hsa-miR-664a-5p, hsa-miR-1301-3p, solexa-7534-111, hsa-miR-1270, Hs-miR-877-5p, hsa-miR-505-5p, hs-miR-1294, hsa-miR-1229-3p, hsa-let-7e, hs-miR- -1238-5p, solexa-3464-254, and hsa-miR-544a. The present invention also provides a composition for diagnosing stroke of an individual, comprising an agent for measuring the level of one or more miRNAs selected from the group consisting of -1238-5p, solexa-3464-254 and hsa-miR-544a.

용어 "miRNA"는 microRNA 또는 miRs로 지칭될 수 있다. miRNA의 길이는 약 10 내지 30, 또는 21 내지 25개의 뉴클레오티드인 RNA 가닥일 수 있다. miRNA는 DNA로부터 전사되지만 단백질로 번역되지 않으므로, 비-코딩 RNA를 포함하는 유전자에 의해 코딩된다. miRs는 공지의 원발성 전사체 pri-miRNA로부터 pre-miRNA라고 불리는 짧은 스템-루프 (stem-loop) 구조로 프로세스되고, 최종적으로 생성된 단일 가닥 miRNA로 프로세스된다. pre-miRNA는 자가-상보 영역내에서 자체적으로 안으로 접히는 구조를 형성할 수 있다. 그 후 상기 구조는 동물에서는 뉴클레아제에 의해 프로세스된다. 성숙 miRNA 분자는 하나 이상의 mRNA 분자에 부분적으로 상보적이며, 단백질의 전사를 조절하는 기능을 할 수 있다. miRNA의 확인된 서열은 www.microRNA.org, www.mirbase.org, 또는 www.mirz.unibas.ch/cgi/miRNA.cgi.와 같은 공개된 이용가능한 데이터베이스에서 평가할 수 있다. miRNAs는 "mir-[숫자]"와 같은 작명 협정에 따라 일반적으로 번호를 할당받는다. miRNA의 숫자는 이미 확인된 miRNA 종에 대해 발견된 순서에 따라 할당된다. miRNA가 상이한 유기체의 공지의 miRNA에 유사한 것으로 발견되었다면, 이름은 [유기체 확인자]- mir-[숫자]의 형태로, 선택적 유기체 확인자 이름이 제공된다. 성숙한 microRNA는 보통 접두사 "miR"가 붙고, 유전자 또는 전구물질 miRNA는 접두사 "mir"가 붙는다. 본 발명의 내용에서, 접두사 mir-* 또는 miR-*를 가진 임의의 microRNA (miRNA 또는 miR)는 명시적으로 다른 언급이 없는 한, 전구물질 및/또는 성숙 종을 모두 포함하는 것으로 이해해야 한다. miR 명명에 대한 상세한 내용은 www.mirbase.org 또는 Ambros et al., A uniform system for microRNA annotation, RNA 9:277-279 (2003)을 참고한다.The term " miRNA " can be referred to as microRNA or miRs. The length of the miRNA may be about 10 to 30, or 21 to 25 nucleotides of RNA strands. Because miRNAs are transcribed from DNA but not translated into proteins, they are encoded by genes that contain non-coding RNAs. miRs are processed from a known primary transcript pri-miRNA into a short stem-loop structure called pre-miRNA and finally processed with the resulting single-stranded miRNA. The pre-miRNA can form a self-folding structure within the self-complementary region. The structure is then processed by the nuclease in the animal. A mature miRNA molecule is partially complementary to one or more mRNA molecules and can function to regulate transcription of the protein. Identified sequences of miRNAs can be evaluated in publicly available databases such as www.microRNA.org, www.mirbase.org, or www.mirz.unibas.ch/cgi/miRNA.cgi. miRNAs are generally numbered according to a naming convention such as "mir- [number]". The number of miRNAs is assigned according to the sequence found for miRNA species that have already been identified. If the miRNA is found to be similar to a known miRNA of a different organism, the name is provided in the form of [organism identifier] - mir- [number], the name of the selector organism identifier. Mature microRNAs usually have the prefix "miR" attached, and gene or precursor miRNAs are prefixed with "mir". In the context of the present invention, any microRNA (miRNA or miR) with the prefix mir- * or miR- * should be understood to include both precursors and / or mature species unless explicitly stated otherwise. For more information on miR nomenclature, see www.mirbase.org or Ambros et al., A uniform system for microRNA annotation, RNA 9: 277-279 (2003).

상기 hsa-miR-579-3p, hsa-miR-140-5p, hsa-miR-186-5p, hsa-miR-301a-3p, hsa-miR-18b-5p, hsa-miR-19a-3p, hsa-miR-362-3p, hsa-miR-32-5p, hsa-miR-340-5p, hsa-miR-142-3p, hsa-miR-144-3p, hsa-miR-660-5p, hsa-miR-335-5p, hsa-miR-517b-3p, hsa-miR-664a-5p, hsa-miR-1301-3p, solexa-7534-111, hsa-miR-1270, hsa-miR-628-5p, HS_22.1, HS_10, hsa-miR-1294, hsa-miR-1229-3p, hsa-let-7e, hsa-miR-877-5p, hsa-miR-505-5p, HS_108.1, hsa-miR-1238-5p, solexa-3464-254 및 hsa-miR-544a은 각각 서열번호 17 내지 46의 뉴클레오티드 서열을 포함하거나 또는 서열번호 17 내지 46의 뉴클레오티드 서열로 구성된 miRNA일 수 있다. 상기 miRNA들은 뇌졸중 환자의 말초 혈액 내에서 정상인과 비교하여 그 수준이 변화하는 것으로 밝혀졌다. 따라서 상기 miRNA들의 개체 내 수준 변화를 측정하여 뇌졸중을 진단할 수 있다. 또한 개체로부터 분리된 시료 중 상기 miRNA들의 수준을 2종 이상 측정하는 것으로서 뇌졸중 진단의 민감도 또는 특이도를 증가시킬 수 있다.Hsa-miR-18b-5p, hsa-miR-19a-3p, hsa-miR-189-5p, hsa-miR- miR-362-3p, hsa-miR-32-5p, hsa-miR-340-5p, hsa-miR-142-3p, hsa-miR-144-3p, hsa-miR-660-5p, hsa-miR Hs-miR-624-5p, hs-miR-625-5p, hs-miR-624-5p, Hs-miR-1275, hs-miR-1294, hsa-miR-1294 -5p, solexa-3464-254 and hsa-miR-544a may be miRNAs comprising the nucleotide sequences of SEQ ID NOS: 17 to 46 or consisting of the nucleotide sequences of SEQ ID NOS: 17 to 46, respectively. These miRNAs were found to vary in the peripheral blood of stroke patients compared to normal individuals. Therefore, it is possible to diagnose a stroke by measuring the intra-individual level of the miRNAs. It is also possible to increase the sensitivity or specificity of the diagnosis of stroke by measuring two or more levels of the miRNAs in samples isolated from an individual.

본 명세서에 있어서, 모든 miRNA는 천연적으로 존재하는 miRNA 및 그의 기능적 변이체를 포함하는 것으로 해석된다.As used herein, all miRNAs are interpreted to include naturally occurring miRNAs and functional variants thereof.

상기 시료는 개체로부터 분리된 혈액, 혈장, 혈청, 뇨, 대변, 타액, 눈물, 뇌척수액, 세포, 조직 또는 그 조합일 수 있다. 상기 시료는 개체의 염색체를 포함하는 것일 수 있다. 상기 조직은 뇌, 뇌신경 또는 말초 혈관일 수 있다. 상기 혈액은 말초 혈액일 수 있다.The sample may be blood, plasma, serum, urine, feces, saliva, tears, cerebrospinal fluid, cells, tissue or a combination thereof separated from an individual. The sample may include a chromosome of an individual. The tissue may be brain, cranial nerve or peripheral blood vessels. The blood may be peripheral blood.

상기 개체는 포유동물일 수 있다. 또한 상기 개체는 그로부터 분리된 조직 또는 세포를 포함하는 의미로 사용된다. 상기 포유동물은 인간, 영장류, 마우스, 랫, 소, 돼지, 말, 양, 개, 고양이 또는 그 조합일 수 있다.The subject may be a mammal. It is also meant to include a tissue or cell isolated therefrom. The mammal may be a human, a primate, a mouse, a rat, a cow, a pig, a horse, a sheep, a dog, a cat, or a combination thereof.

본 명세서에 있어서, 용어 "뇌졸중"은 다른 설명이 없는 한 허혈성 뇌졸중 및 출혈성 뇌졸중 모두를 포함하는 의미로 사용된다.As used herein, the term " stroke " is used to include both ischemic stroke and hemorrhagic stroke, unless otherwise indicated.

상기 개체의 뇌졸중 진단용 조성물은 상기 하나 이상의 miRNA의 양을 측정하기 위한 제제를 포함하는 것일 수 있다. 상기 제제는 상기 하나 이상의 miRNA에 특이적으로 결합하는 물질일 수 있다. 상기 miRNA에 특이적으로 결합하는 물질은 프라이머, 프로브, 뉴클레오티드, 항체 또는 이의 항원 결합 단편, 리간드, 수용체, 작용제(agonist) 또는 길항체(antagonist), 폴리뉴클레오티드 또는 그 조합일 수 있다. 상기 miRNA에 특이적으로 결합하는 물질은 고속 대량 스크리닝(high throughput screening: HTS) 등 당업계에 알려진 방법에 따라 선별할 수 있고, 또는 상업적으로 구매 가능한 것일 수 있다. The composition for diagnosing stroke of the subject may be one comprising an agent for measuring the amount of the at least one miRNA. The agent may be a substance that specifically binds to the one or more miRNAs. The substance that specifically binds to the miRNA may be a primer, a probe, a nucleotide, an antibody or an antigen-binding fragment thereof, a ligand, a receptor, an agonist or an antagonist, a polynucleotide or a combination thereof. The substance specifically binding to the miRNA may be selected according to methods known in the art such as high throughput screening (HTS), or may be commercially available.

상기 프라이머는 중합효소에 의한 중합 반응에서 중합개시점을 제공하는 것일 수 있다. 상기 프라이머는 핵산 증폭 반응에서 사용되는 것일 수 있다. 용어 "증폭 (amplification)"은 표적 서열 또는 그의 상보적인 서열의 카피 수를 증가시키는 것을 나타낸다. 상기 핵산 증폭 반응은 당업계에 알려진 임의의 방법에 의하여 이루어질 수 있다. 핵산의 증폭은 증폭 동안 복수의 사이클을 필요로 하는 방법 또는 단일 온도에서 수행되는 방법을 포함한다. 순환 방법 (cycling techniques)의 예는 열 순환을 필요로 하는 방법을 포함한다. 열 순환을 필요로 하는 방법은 중합효소 연쇄반응 (PCR)을 포함한다. PCR은 당업계에 알려져 있다. PCR은 보통 열변성에 의하여 이중가닥 DNA를 단일가닥 DNA으로 변성시키는 단계, 프라이머를 상기 단일가닥 DNA에 어닐링하는 단계; 및 상기 프라이머로부터 상보적 가닥을 합성하는 단계를 포함한다. 등온 증폭 방법은 단일 온도 또는 증폭 과정의 주요 양상이 단일 온도에서 수행되는 방법이다. 이중가닥을 분리하기 위하여 반응 산물을 가열하여 추가적 프라이머가 결합할 수 있도록 하는 PCR과는 대조적으로, 등온 방법은 이중가닥을 분리하고 주형을 재카피하기 위하여 가닥 치환 폴리머라제 (strand displacing polymerase)에 의존한다. 등온 방법은 반복 주형 카피 (reiterative template copying)를 개시하기 위하여 프라이머의 치환에 의존하는 방법과 단일 프라이머 분자의 연속된 재사용 또는 신규 합성에 의존하는 방법으로 구분할 수 있다. 프라이머의 치환에 의존하는 방법은 헬리카제 의존적 증폭 (helicase dependant amplification: HDA), 엑소뉴클레아제 의존적 증폭 (exonuclease dependant amplification), 리콤비나제 중합효소증폭 (recombinase polymerase amplification: RPA) 및 루프 매개된 증폭 (loop mediated amplification: LAMP)로 구성된 군으로부터 선택된 방법을 포함한다. 단일 프라이머 분자의 연속된 재사용 또는 신규 합성에 의존하는 방법은 가닥치환증폭 (strand displacement amplification: SDA) 및 핵산 기반 증폭 (nucleic acid based amplification : NASBA 및 TMA)로 구성된 군으로부터 선택된 방법을 포함한다. 상기 프라이머는 선택되는 증폭 방법에 따라 하나, 2, 3, 4, 5, 6 이상의 세트로 포함될 수 있다. 상기 프라이머는 PCR용 프라이머일 수 있다.The primer may be one which provides a polymerization initiation point in a polymerization reaction with a polymerase. The primer may be one used in a nucleic acid amplification reaction. The term " amplification " refers to increasing the number of copies of the target sequence or its complementary sequence. The nucleic acid amplification reaction can be performed by any method known in the art. Amplification of nucleic acids involves either a method requiring multiple cycles during amplification or a method performed at a single temperature. Examples of cycling techniques include those that require thermal cycling. Methods that require thermocycling include polymerase chain reaction (PCR). PCR is known in the art. PCR typically involves denaturing double stranded DNA to single stranded DNA by thermal degradation, annealing the primer to the single stranded DNA; And synthesizing a complementary strand from the primer. An isothermal amplification method is a method in which a single temperature or a major aspect of the amplification process is performed at a single temperature. In contrast to PCR, in which the reaction product is heated to allow additional primers to bind in order to separate the double strands, the isothermal method relies on a strand displacing polymerase to separate the double strands and rescopy the template do. Isothermal methods can be distinguished by methods that rely on substitution of primers to initiate reiterative template copying and methods that rely on sequential reuse or novel synthesis of single primer molecules. Methods that rely on primer substitution include helicase dependent amplification (HDA), exonuclease dependent amplification, recombinase polymerase amplification (RPA) and loop mediated amplification and loop mediated amplification (LAMP). Methods that rely on sequential reuse or novel synthesis of single primer molecules include those selected from the group consisting of strand displacement amplification (SDA) and nucleic acid based amplification (NASBA and TMA). The primers may be included in one, two, three, four, five, six or more sets according to the selected amplification method. The primer may be a PCR primer.

miRNA 수준 측정은 뇌졸중 유무 및 정도를 진단하기 위하여 개체의 miRNA의 존재 여부와 수준을 확인하는 과정으로서 miRNA 양의 측정일 수 있다. 이는 miRNA를 직접 분리하거나, 상기 miRNA에 대한 프라이머 또는 프로브를 이용하여 측정할 수 있다. 이를 위한 분석방법은 RT-PCR, 경쟁적 RT-PCR (competitive RT-PCR), 실시간 RT-PCR (Real-time RT-PCR), RNase 보호 분석법 (RPA: RNase protection assay), 노던 블랏팅 (Northern blotting), DNA를 포함한 핵산 마이크로어레이 또는 그 조합을 이용하는 것을 포함할 수 있다. RT-PCR은 RNA를 분석하는 방법으로, miRNA를 역전사하여 얻어진 cDNA를 PCR로 증폭하여 분석하는 방법이다. 상기 RT-PCR 중 증폭 단계에서 상기 유전자에 특이적으로 제조된 프라이머 쌍을 사용하며, RT-PCR 후 전기영동하여 밴드 패턴과 밴드의 두께를 확인함으로써 상기 유전자의 miRNA 발현 여부와 발현 수준을 확인할 수 있고 이를 정상대조군과 비교함으로써, 개체의 뇌졸중의 유무 또는 그 발병 정도를 간편하게 판단할 수 있다.The miRNA level measurement can be a measure of the amount of miRNA as a process of identifying the presence and level of the miRNA of an individual to diagnose the presence and degree of stroke. This can be done by isolating the miRNA directly or by using a primer or probe for the miRNA. Analysis methods include RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting ), Nucleic acid microarrays comprising DNA, or combinations thereof. RT-PCR is a method of analyzing RNA. It is a method of amplifying and analyzing cDNA obtained by reverse transcription of miRNA by PCR. After the RT-PCR, a pair of primers prepared specifically for the gene was used in the amplification step of the RT-PCR, and the band pattern and the band thickness were confirmed by the RT-PCR, thereby confirming the miRNA expression and the expression level of the gene And comparing it with the normal control group, it is possible to easily determine the presence or absence of the stroke or the degree of the stroke of the individual.

본 명세서에 있어서 용어 "프라이머"는 자유 3-말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 상보적인 주형 (template)과 염기쌍을 형성할 수 있고 주형 가닥 복사을 위한 시작 지점으로서 작용하는 핵산 서열을 말한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응을 위한 시약 (즉, DNA 폴리머라제 또는 역전사효소) 및 상이한 4 가지의 뉴클레오사이드 트리포스페이트의 존재 하에서 DNA 합성을 개시할 수 있다. 예를 들면 상기 하나 이상의 miRNA에 대한 특이적인 프라이머로서 7개 내지 50개의 뉴클레오티드 서열을 가진 센스 및 안티센스 프라이머를 이용하여 PCR 증폭을 실시하여 원하는 생성물의 생성량의 측정을 통해 개체의 뇌졸중의 유무 또는 그 발병 정도를 확인할 수 있다. PCR 조건, 센스 및 안티센스 프라이머의 길이는 당업계에 공지된 기술에 따라 적절히 선택될 수 있다. 상기 프라이머는 10 내지 100, 15 내지 100, 10 내지 80, 10 내지 50, 10 내지 30, 15 내지 80, 15 내지 50, 15 내지 30, 20 내지 100, 20 내지 80, 20 내지 50, 또는 20 내지 30 nt를 갖는 것일 수 있다. As used herein, the term " primer " refers to a nucleic acid sequence that can form base pairs with a complementary template with a free 3 'hydroxyl group and serves as a starting point for template strand replication . Primers can initiate DNA synthesis in the presence of reagents for polymerization (i. E., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at appropriate buffer solutions and temperatures. For example, PCR amplification is performed using a sense and antisense primer having 7 to 50 nucleotide sequences as a specific primer for the above-mentioned one or more miRNAs to determine the presence or absence of a stroke of the individual Can be confirmed. The PCR conditions, the lengths of the sense and antisense primers can be appropriately selected according to techniques known in the art. The primers may be used in an amount of 10 to 100, 15 to 100, 10 to 80, 10 to 50, 10 to 30, 15 to 80, 15 to 50, 15 to 30, 20 to 100, 20 to 80, 20 to 50, 30 nt. ≪ / RTI >

본 명세서에 있어서 용어 "프로브"란 표적 핵산 예를 들면, miRNA와 특이적으로 결합을 이룰 수 있는 RNA 또는 DNA 등의 핵산 단편을 의미하며 라벨링되어 있어서 특정 miRNA의 존재 유무, 함량 및 발현량을 확인할 수 있다. 프로브는 올리고뉴클레오티드(oligonucleotide) 프로브, 단쇄 DNA(single strand DNA) 프로브, 이중쇄 DNA(double strand DNA) 프로브, RNA 프로브 등의 형태로 제작될 수 있다. 예를 들면 상기 miRNA와 상보적인 프로브를 이용하여 혼성화를 실시하여, 혼성화 정도를 통해 miRNA의 발현량을 측정함으로써 개체의 뇌졸중의 유무 또는 그 발병 정도를 확인할 수 있다. 적절한 프로브의 선택 및 혼성화 조건은 당해 기술분야에 공지된 기술에 따라 적절히 선택할 수 있다. 상기 프로브는 10 내지 100, 15 내지 100, 10 내지 80, 10 내지 50, 10 내지 30, 15 내지 80, 15 내지 50, 15 내지 30, 20 내지 100, 20 내지 80, 20 내지 50, 또는 20 내지 30 nt를 갖는 것일 수 있다.As used herein, the term " probe " refers to a target nucleic acid, for example, a nucleic acid fragment such as RNA or DNA capable of specifically binding to miRNA, and is labeled to confirm the presence, amount and amount of specific miRNA. . The probe may be prepared in the form of an oligonucleotide probe, a single strand DNA probe, a double strand DNA probe, or an RNA probe. For example, the hybridization is performed using a probe complementary to the miRNA, and the presence or absence of the stroke or the incidence of the stroke can be confirmed by measuring the expression level of the miRNA through the degree of hybridization. Selection of suitable probes and hybridization conditions can be appropriately selected according to techniques known in the art. Wherein said probe is selected from the group consisting of 10 to 100, 15 to 100, 10 to 80, 10 to 50, 10 to 30, 15 to 80, 15 to 50, 15 to 30, 20 to 100, 20 to 80, 20 to 50, 30 nt. ≪ / RTI >

또한, 프라이머 또는 프로브는 포스포아미다이트(phosphoramidite) 고체 지지체 합성법이나 기타 널리 공지된 방법을 이용하여 화학적으로 합성될 수 있다. 또한 이러한 핵산 서열은 당해 기술분야에 공지된 다양한 방법을 통해 변형시킬 수 있다. 이러한 변형의 예는 메틸화, 캡화, 천연 뉴클레오티드 하나 이상의 동족체로의 치환, 또는 뉴클레오티드 간의 변형, 예를 들면 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체 (예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형을 포함할 수 있다. 또한 프라이머 또는 프로브는 검출 가능한 신호를 직접적으로 또는 간접적으로 제공할 수 있는 표지를 이용하여 변형될 수 있다. 상기 표지의 예는 방사성 동위원소, 형광성 분자, 또는 바이오틴을 포함할 수 있다.In addition, the primer or probe can be chemically synthesized using a phosphoramidite solid support synthesis method or other well-known methods. Such nucleic acid sequences may also be modified through a variety of methods known in the art. Examples of such modifications include, but are not limited to, methylation, capping, substitution with one or more of the natural nucleotide analogs, or modifications between nucleotides such as uncharged linkers (e.g., methylphosphonate, phosphotriester, phosphoramidate, carbamate Etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.). The primer or probe may also be modified using a label that can provide a detectable signal directly or indirectly. Examples of such labels may include radioactive isotopes, fluorescent molecules, or biotin.

다른 양상은 개체로부터 분리된 시료 중 hsa-miR-579-3p, hsa-miR-140-5p, hsa-miR-186-5p, hsa-miR-301a-3p, hsa-miR-18b-5p, hsa-miR-19a-3p, hsa-miR-362-3p, hsa-miR-32-5p, hsa-miR-340-5p, hsa-miR-142-3p, hsa-miR-144-3p, hsa-miR-660-5p, hsa-miR-335-5p, hsa-miR-517b-3p, hsa-miR-664a-5p, hsa-miR-1301-3p, solexa-7534-111, hsa-miR-1270, hsa-miR-628-5p, HS_22.1, HS_10, hsa-miR-1294, hsa-miR-1229-3p, hsa-let-7e, hsa-miR-877-5p, hsa-miR-505-5p, HS_108.1, hsa-miR-1238-5p, solexa-3464-254 및 hsa-miR-544a로 이루어진 군에서 선택된 하나 이상의 miRNA의 발현 수준을 측정하기 위한 제제를 포함하는, 개체의 뇌졸중 진단용 키트를 제공한다. Hsa-miR-186-5p, hsa-miR-18a-3p, hsa-miR-18b-5p, hsa-miR- -mR-19a-3p, hsa-miR-362-3p, hsa-miR-32-5p, hsa-miR-340-5p, hsa-miR-142-3p, hsa-miR-144-3p, hsa-miR Hs-miR-1375b-3p, hsa-miR-664a-5p, hsa-miR-1301-3p, solexa-7534-111, hsa-miR-1270, hsa hs-miR-877-5p, hsa-miR-505-5p, HS_108, hsa-miR-1229-3p, hsa-let-7e, hs-miR-628-5p, HS_22.1, HS_10, hsa-miR- Comprising an agent for measuring the expression level of one or more miRNAs selected from the group consisting of hsa-miR-1238-5p, solexa-3464-254 and hsa-miR-544a. .

상기 키트는 예를 들면 miRNA의 발현량을 측정할 수 있는, 뇌졸중 진단용 마이크로어레이일 수 있다. 상기 뇌졸중 진단용 마이크로어레이는 상기 miRNA를 이용하여 당해 기술분야에 공지된 방법에 따라 당업자가 용이하게 제조할 수 있다. 상기 마이크로어레이는 상술한 miRNA 또는 그와 상보적 서열, 또는 그에 대응되는 핵산 서열이 프로브로서 기판에 부착되어 있는 것일 수 있다. 상기 핵산 서열은 DNA, PNA (peptide nucleic acids), LNA (locked nucleic acids), 이들의 조합, 및 이들의 유사체로 구성된 군으로부터 선택될 수 있다. The kit may be, for example, a microarray for stroke diagnosis capable of measuring the expression level of miRNA. The microarray for stroke diagnosis can be easily produced by a person skilled in the art according to a method known in the art using the miRNA. The microarray may be one in which the above-described miRNA, a complementary sequence thereof, or a nucleic acid sequence corresponding thereto is attached to a substrate as a probe. The nucleic acid sequence may be selected from the group consisting of DNA, PNA (peptide nucleic acids), LNA (locked nucleic acids), combinations thereof, and analogs thereof.

상기 키트가 예를 들면 상술한 유전자의 miRNA의 발현량을 측정하기 위한 경우, RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. 상기 RT-PCR 키트는 마커 유전자의 miRNA에 대한 특이적인 각각의 프라이머 이외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액, 데옥시리보뉴클레오티드(dNTPs), Taq-폴리머라제 및 역전사효소와 같은 효소, DNase, RNase 억제제, DEPC-수(dEPC-water), 또는 멸균수를 포함할 수 있다. 또한, 정량 대조군으로 사용되는 유전자에 특이적인 프라이머 쌍을 포함할 수 있다. For example, when the kit is used for measuring the expression level of the miRNA of the gene described above, it may be a kit containing essential elements necessary for conducting RT-PCR. In addition to the respective primers specific for the miRNA of the marker gene, the RT-PCR kit may also contain enzymes such as test tubes or other appropriate containers, reaction buffers, deoxyribonucleotides (dNTPs), Taq polymerase and reverse transcriptase, DNase, RNase Inhibitor, DEPC-water (dEPC-water), or sterile water. It may also contain a primer pair specific for the gene used as a quantitative control.

상기 키트에 대한 설명에서 언급된 용어 또는 요소 중 이미 다른 것에 대한 설명에서 언급된 것과 동일한 것은 이미 언급된 바와 같다.The terms or elements mentioned in the description of the kit are the same as those already mentioned in the description of the others.

다른 양상은 개체로부터 분리된 시료 중의 hsa-miR-579-3p, hsa-miR-140-5p, hsa-miR-186-5p, hsa-miR-301a-3p, hsa-miR-18b-5p, hsa-miR-19a-3p, hsa-miR-362-3p, hsa-miR-32-5p, hsa-miR-340-5p, hsa-miR-142-3p, hsa-miR-144-3p, hsa-miR-660-5p, hsa-miR-335-5p, hsa-miR-517b-3p, hsa-miR-664a-5p, hsa-miR-1301-3p, solexa-7534-111, hsa-miR-1270, hsa-miR-628-5p, HS_22.1, HS_10, hsa-miR-1294, hsa-miR-1229-3p, hsa-let-7e, hsa-miR-877-5p, hsa-miR-505-5p, HS_108.1, hsa-miR-1238-5p, solexa-3464-254 및 hsa-miR-544a로 이루어진 군에서 선택된 하나 이상의 miRNA의 수준을 측정하는 단계, 및 상기 측정된 하나 이상의 miRNA의 발현 수준을 대조군에서 측정된 동일한 miRNA의 수준과 비교하는 단계를 포함하는, 개체의 뇌졸중을 진단하는 방법을 제공한다. Hs-miR-18b-5p, hsa-miR-18b-5p, hsa-miR-18a-5p, -mR-19a-3p, hsa-miR-362-3p, hsa-miR-32-5p, hsa-miR-340-5p, hsa-miR-142-3p, hsa-miR-144-3p, hsa-miR Hs-miR-1375b-3p, hsa-miR-664a-5p, hsa-miR-1301-3p, solexa-7534-111, hsa-miR-1270, hsa hs-miR-877-5p, hsa-miR-505-5p, HS_108, hsa-miR-1229-3p, hsa-let-7e, hs-miR-628-5p, HS_22.1, HS_10, hsa-miR- Determining the level of one or more miRNAs selected from the group consisting of hsa-miR-1238-5p, solexa-3464-254 and hsa-miR-544a, Comparing the measured level of the same miRNA to the level of the same miRNA.

상기 진단하는 방법은 개체로부터 분리된 시료와 hsa-miR-579-3p, hsa-miR-140-5p, hsa-miR-186-5p, hsa-miR-301a-3p, hsa-miR-18b-5p, hsa-miR-19a-3p, hsa-miR-362-3p, hsa-miR-32-5p, hsa-miR-340-5p, hsa-miR-142-3p, hsa-miR-144-3p, hsa-miR-660-5p, hsa-miR-335-5p, hsa-miR-517b-3p, hsa-miR-664a-5p, hsa-miR-1301-3p, solexa-7534-111, hsa-miR-1270, hsa-miR-628-5p, HS_22.1, HS_10, hsa-miR-1294, hsa-miR-1229-3p, hsa-let-7e, hsa-miR-877-5p, hsa-miR-505-5p, HS_108.1, hsa-miR-1238-5p, solexa-3464-254 및 hsa-miR-544a로 이루어진 군에서 선택된 하나 이상의 miRNA에 특이적으로 결합하는 물질을 접촉시켜 상기 miRNA와 상기 물질의 복합체를 형성시키는 단계; 상기 복합체로부터 상기 시료 중의 상기 miRNA의 수준을 측정하는 단계; 상기 측정된 수준을 대조군에서의 동일한 miRNA의 수준과 비교하는 단계; 및 상기 분리된 시료에서 측정된 상기 miRNA의 수준이 대조군의 수준과 비교하여 변화한 경우 개체가 뇌졸중에 걸린 것으로 결정하는 단계를 포함하는 것일 수 있다.Hsa-miR-186-5p, hsa-miR-301a-3p, and hsa-miR-18b-5p , hsa-miR-19a-3p, hsa-miR-362-3p, hsa-miR-32-5p, hsa-miR-340-5p, hsa-miR-142-3p, hs-miR-660-5p, hsa-miR-335-5p, hsa-miR-517b-3p, hsa-miR-664a-5p, hsa-miR-1301-3p, solexa-7534-111, hs-miR-625-5p, HS_22.1, HS_10, hsa-miR-1294, hsa-miR-1229-3p, hsa-let-7e, hsa-miR-877-5p, hsa-miR-505-5p , HS_108.1, hsa-miR-1238-5p, solexa-3464-254, and hsa-miR-544a to form a complex of said miRNA and said substance ; Measuring the level of the miRNA in the sample from the complex; Comparing the measured level with a level of the same miRNA in a control; And determining that the individual has a stroke if the level of the miRNA measured in the separated sample is changed in comparison with the level of the control group.

상기 방법은 또한 상기 복합체의 수준을 측정하여 시료 중의 상기 miRNA의 수준을 측정하는 단계를 포함할 수 있다. 상기 복합체의 수준을 측정하는 것은 상기 miRNA에 특이적으로 결합하는 물질에 부착된 검출 가능한 표지로부터 나오는 신호를 검출함으로써 이루어지는 것일 수 있다. 상기 복합체의 수준을 측정하는 것은 복합체를 다시 분리하여 miRNA의 수준을 측정하는 것, 또는 miRNA에 특이적으로 결합하는 물질의 수준을 측정하는 것 또는 상기 복합체를 분리하지 않고 그 수준을 측정하는 것일 수 있다. 상기 측정은 RT-PCR, 경쟁적 RT-PCR(competitive RT-PCR), 실시간 RT-PCR(Real-time RT-PCR), RNase 보호 분석법(RNase protection assay: RPA), 노던 블롯팅 (Northern blotting), DNA를 포함한 핵산 마이크로어레이, 웨스턴블롯팅, ELISA(enzyme linked immunosorbent assay), 방사선 면역분석(Radioimmunoassay: RIA), 방사 면역 확산법(radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케트(rocket) 면역전기영동, 조직면역 염색, 면역침전 분석법 (Immunoprecipitation Assay), 보체 고정 분석법(Complement Fixation Assay), FACS, 질량분석, 자석비드-항체 면역 침강법, 단백질 칩(protein chip), 또는 그 조합으로 수행할 수 있다.The method may also include measuring the level of the complex to determine the level of the miRNA in the sample. Measuring the level of the complex may be by detecting a signal from a detectable marker attached to a substance that specifically binds to the miRNA. Measuring the level of the complex can be accomplished by separating the complex and measuring the level of the miRNA, or measuring the level of the substance that specifically binds to the miRNA, or measuring the level without separating the complex have. The assay can be performed using RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting, A nucleic acid microarray including DNA, Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunization Immunoprecipitation assay, Complement Fixation Assay, FACS, mass spectrometry, magnetic bead-antibody immunoprecipitation, protein chip, or a combination thereof. .

상기 방법은 상기 측정된 miRNA의 수준을 대조군에서 측정된 동일한 miRNA의 수준과 비교하는 단계를 포함할 수 있다. 상기 대조군은 뇌졸중에 걸리지 않은 개체일 수 있다. The method can include comparing the level of the measured miRNA to the level of the same miRNA measured in the control. The control group may be an individual not suffering stroke.

상기 방법은 또한 상기 개체의 상기 miRNA의 수준이 대조군의 수준에 비교하여 변화한 경우 개체를 뇌졸중에 걸린 것으로 결정하는 단계를 포함할 수 있다. 상기 수준의 변화는 개체의 상기 miRNA 수준이 대조군에 비하여 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900% 및 1000% 이상 증가하거나, 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% 및 100% 이상 감소하는 것을 포함할 수 있다.The method may also include determining that the subject is suffering from a stroke if the level of the miRNA of the subject is altered relative to the level of the control. The level of change may be in the range of 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70% 1%, 2%, 3%, 4%, or more than 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900% , 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% and 100% or more.

상기 방법은 또한 상기 결정하는 단계는 상기 miRNA의 수준이 양성 대조군 또는 정상 대조군에서 측정된 동일한 miRNA의 수준보다 낮은 경우, 상기 개체는 뇌졸중이 있는 것으로 결정하는 단계를 포함하는 것일 수 있다. 또한, 상기 결정하는 단계는 상기 측정된 상기 miRNA의 수준이 양성 대조군 또는 정상 대조군에서 측정된 동일한 miRNA의 수준과 동등하거나 높은 경우, 상기 개체는 뇌졸중에 걸리지 않은 것으로 결정하는 단계를 포함하는 것일 수 있다.The method may also include determining that the subject has a stroke if the level of the miRNA is lower than the level of the same miRNA as measured in a positive control or a normal control. In addition, the determining may comprise determining that the subject is not suffering from a stroke if the measured level of the miRNA is equal to or higher than the level of the same miRNA measured in the positive control or the normal control .

상기 진단하는 방법에 대한 설명에서 언급된 용어 또는 요소 중 이미 언급된 것과 동일한 것은 이미 언급된 바와 같다.The same terms already mentioned among the terms or elements mentioned in the description of the diagnostic method are already mentioned.

다른 양상은 개체로부터 분리된 시료 중의 ARG1 유전자의 발현 수준을 측정하는 단계, 및 상기 측정된 발현 수준을 대조군에서 측정된 ARG1 유전자의 발현 수준과 비교하는 단계를 포함하는 개체의 뇌졸중을 진단하는 방법을 제공한다.Another aspect is a method for diagnosing stroke in an individual comprising measuring the level of expression of the ARG1 gene in a sample isolated from the subject, and comparing the measured expression level to the level of expression of the ARG1 gene measured in the control to provide.

본 발명자들은 뇌졸중 환자의 말초 혈액에서 miR-340-5p의 수준이 유의하게 감소하고, miR-340-5p가 ARG1의 발현을 억제하는 것을 밝혀내었다. 따라서 뇌졸중 환자의 감소한 miR-340-5p의 수준에 따라 ARG1의 수준은 증가할 것이므로, ARG1의 수준을 측정하여 뇌졸중을 진단할 수 있다.상기 방법은 ARG1 단백질의 수준을 측정하는 단계를 포함할 수 있다. 상기 ARG1 단백질의 수준이 대조군의 수준에 비교하여 변화한 경우 개체를 뇌졸중에 걸린 것으로 결정하는 단계를 포함할 수 있다. 또한, 상기 ARG1 단백질의 수준이 음성 대조군 또는 정상 대조군에서 측정된 ARG1 수준보다 높은 경우, 상기 개체는 뇌졸중에 걸린 것으로 결정하는 단계를 포함하는 것일 수 있다.The present inventors have found that the level of miR-340-5p is significantly decreased in the peripheral blood of stroke patients, and miR-340-5p inhibits the expression of ARG1. Thus, the level of ARG1 will increase with a reduced level of miR-340-5p in stroke patients, so that the level of ARG1 can be measured to diagnose a stroke. The method can include measuring the level of ARG1 protein have. And determining that the subject has suffered a stroke if the level of the ARG1 protein is altered relative to the level of the control. In addition, when the level of the ARG1 protein is higher than the level of ARG1 measured in the negative control group or the normal control group, it may be determined that the individual has a stroke.

상기 ARG1 단백질의 수준을 측정하여 뇌졸중을 진단하는 방법은 상기 miRNA들의 수준을 측정하는 방법과 함께 수행하여 뇌졸중을 진단하는데 이용될 수 있다.The method for diagnosing stroke by measuring the level of the ARG1 protein can be used for diagnosing a stroke by performing the method together with a method for measuring the level of the miRNA.

상기 진단하는 방법에 대한 설명에서 언급된 용어 또는 요소 중 이미 언급된 것과 동일한 것은 이미 언급된 바와 같다.The same terms already mentioned among the terms or elements mentioned in the description of the diagnostic method are already mentioned.

다른 양상은 miR-340-5p 및 ARG1 유전자 서열을 포함하는 뉴클레오티드 또는 ARG1 mRNA 서열을 포함하는 뉴클레오티드를 포함하는 시료에 피검 물질을 접촉시키는 단계; 상기 피검 물질과 접촉한 시료에서 miR-340-5p 및 ARG1 유전자 서열을 포함하는 뉴클레오티드 또는 ARG1 mRNA 서열을 포함하는 뉴클레오티드의 결합 수준을 측정하는 단계; 상기 측정된 결합 수준을 피검 물질을 접촉시키지 않은 대조군의 결합 수준과 비교하는 단계; 및 상기 대조군의 결합 수준과 비교하여 상기 피검 물질이 처리된 시료의 결합 수준을 변화시킨 물질을 선별하는 단계를 포함하는 허혈성 질환 또는 염증성 질환을 치료하기 위한 후보물질을 스크리닝하는 방법을 제공한다.Another aspect relates to a method of detecting a test substance comprising contacting a test substance with a sample comprising a nucleotide comprising miR-340-5p and an ARG1 gene sequence or a nucleotide comprising an ARG1 mRNA sequence; Measuring the binding level of a nucleotide comprising miR-340-5p and an ARG1 gene sequence or a nucleotide including an ARG1 mRNA sequence in a sample contacted with the test substance; Comparing the measured binding level to a binding level of a control group not contacting the test substance; And a step of screening a substance having the binding level of the sample to which the test substance is treated in comparison with the binding level of the control group, thereby screening the candidate substance for treating an ischemic disease or an inflammatory disease.

ARG1은 대식세포에 의해 생성되는 단백질로서, 염증에 대해 항 염증 활성을 발휘한다. 본 발명자들은 뇌졸중 환자에서 miR-340-5p의 수준이 유의하게 감소하는 것과, miR-340-5p가 ARG1 mRNA 및 이에 경쟁적인 효소인 NO를 조절한다는 것을 밝혀내었다. 따라서 miR-340-5p 및 ARG1 유전자 서열을 포함하는 뉴클레오티드의 결합을 저해하는 물질은 허혈성 질환 또는 염증성 질환을 치료하기 위한 후보물질이 될 수 있다. 상기 허혈성 질환 또는 염증성 질환은 뇌졸중일 수 있다.ARG1 is a protein produced by macrophages that exhibit anti-inflammatory activity against inflammation. We have found that the levels of miR-340-5p are significantly reduced in stroke patients and that miR-340-5p modulates ARG1 mRNA and its competitor enzyme NO. Thus, a substance that inhibits the binding of nucleotides comprising the miR-340-5p and ARG1 gene sequences may be a candidate for treating ischemic or inflammatory diseases. The ischemic or inflammatory disease may be stroke.

상기 스크리닝하는 방법에 있어서, 상기 피검 물질은 저분자 화합물, 항체, 안티센스 뉴클레오티드, 작은 간섭 RNA(short interfering RNA), 짧은 헤어핀 RNA(short hairpin RNA), 핵산, 단백질, 펩티드, 기타 추출물 및 천연물로 구성된 군으로부터 선택되는 어느 하나일 수 있다.In the screening method, the test substance is composed of a low molecular compound, an antibody, an antisense nucleotide, a short interfering RNA, a short hairpin RNA, a nucleic acid, a protein, a peptide, . ≪ / RTI >

상기 시료는 개체로부터 분리된 혈액, 혈장, 혈청, 뇨, 대변, 타액, 눈물, 뇌척수액, 세포, 조직 또는 그 조합일 수 있다. 상기 시료는 인공적으로 miR-340-5p 및 ARG1 유전자 서열을 포함하는 뉴클레오티드 또는 ARG1 mRNA 서열을 포함하는 뉴클레오티드를 첨가한 시료일 수 있다. 상기 시료는 miR-340-5p 및 ARG1 유전자를 발현하는 세포를 포함하는 것일 수 있다.The sample may be blood, plasma, serum, urine, feces, saliva, tears, cerebrospinal fluid, cells, tissue or a combination thereof separated from an individual. The sample may be artificially added with a nucleotide comprising the miR-340-5p and ARG1 gene sequences or a nucleotide containing an ARG1 mRNA sequence. The sample may include cells expressing the miR-340-5p and ARG1 genes.

상기 피검물질, ARG1 유전자 서열을 포함하는 뉴클레오티드 또는 ARG1 mRNA 서열을 포함하는 뉴클레오티드는 검출 가능한 표지가 부착되어 있는 것일 수 있다. 상기 표지는 상기 피검 물질 또는 뉴클레오티드에 유전자 재조합 기술을 이용하여 뉴클레오티드 서열 내부에 연결되어 있는 것일 수 있다. 상기 결합 수준의 측정은 표지의 종류 또는 측정 방식에 따라 RT-PCR, 경쟁적 RT-PCR(competitive RT-PCR), 실시간 RT-PCR(Real-time RT-PCR), RNase 보호 분석법(RNase protection assay: RPA), 노던 블롯팅 (Northern blotting), DNA를 포함한 핵산 마이크로어레이, 웨스턴블롯팅, ELISA(enzyme linked immunosorbent assay), 방사선 면역분석(Radioimmunoassay: RIA), 방사 면역 확산법(radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케트(rocket) 면역전기영동, 조직면역 염색, 면역침전 분석법 (Immunoprecipitation Assay), 보체 고정 분석법(Complement Fixation Assay), FACS, 질량분석, 자석비드-항체 면역 침강법, 단백질 칩(protein chip), 또는 이들의 조합으로 수행할 수 있다. 또는 당업계에 알려진 방법을 이용하여, ARG1 유전자 또는 ARG1의 유전자 서열을 조작하여 표지가 연결된 ARG1 mRNA 또는 ARG1 융합 단백질을 발현하는 벡터 및 miR-340-5p를 세포에 형질 주입한 후, 피검물질을 처리하고 변화하는 ARG1 mRNA 수준 또는 ARG1 단백질 수준을 측정하는 것으로써, 상기 결합 수준을 측정할 수 있다.The test substance, the nucleotide including the ARG1 gene sequence or the nucleotide including the ARG1 mRNA sequence may have a detectable label attached thereto. The label may be linked to the test substance or the nucleotide inside the nucleotide sequence using a gene recombination technique. The binding level can be determined by RT-PCR, competitive RT-PCR, real-time RT-PCR, or RNase protection assay, depending on the type or method of labeling. RPA), Northern blotting, nucleic acid microarrays including DNA, Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Immunoprecipitation Assay, Complement Fixation Assay, FACS, Mass Spectrometry, Magnetized Bead-antibody Immunoassay, Protein Chip, Immunoprecipitation Assay, Ouchterlony Immunoprecipitation, Rocket Immunoelectrophoresis, Tissue Immunostaining, Immunoprecipitation Assay, a protein chip, or a combination thereof. Or by using a method known in the art, a gene expressing the ARG1 gene or the ARG1 gene is manipulated to express a marker-bound ARG1 mRNA or ARG1 fusion protein, and miR-340-5p are transfected into the cells, By measuring the level of ARG1 mRNA or ARG1 protein that is treated and changed, the level of binding can be measured.

상기 방법은 상기 피검 물질이 처리된 시료의 결합 수준이 무처리 대조군의 결합 수준과 비교하여 변화한 경우, 상기 피검 물질을 허혈성 질환 또는 염증성 질환의 치료에 효과적인 것으로 결정하는 단계를 포함할 수 있다. 상기 피검 물질은 상기 결합 수준을 증가시키거나 또는 감소시키는 것일 수 있다. 상기 수준의 변화는 결합 수준이 대조군에 비하여 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900% 및 1000% 이상 증가하거나, 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% 및 100% 이상 감소하는 것을 포함할 수 있다. The method may include determining that the test substance is effective in treating an ischemic disease or an inflammatory disease when the test substance has a level of binding of the treated sample compared to the level of binding of the untreated control group. The test substance may be one that increases or decreases the binding level. The change in the level was observed in the control group at 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% 2%, 3%, 4%, 5%, 5%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900% , 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% and 100% or more.

개체의 뇌졸중을 진단하기 위한 진단용 조성물 및 키트, 및 뇌졸중을 진단하기 위한 방법에 따르면 뇌졸중을 시료 내 유전적 변화를 이용하여 효율적으로 진단할 수 있다. According to the diagnostic composition and kit for diagnosing stroke of an individual, and the method for diagnosing stroke, the stroke can be efficiently diagnosed using genetic changes in the sample.

또한 허혈성 질환 또는 염증성 질환을 치료하기 위한 후보물질을 스크리닝하는 방법에 따르면 상기 질환을 치료하기 위한 후보물질을 효율적으로 스크리닝할 수 있다.In addition, according to the method of screening candidate substances for treating ischemic diseases or inflammatory diseases, candidates for treating the diseases can be efficiently screened.

도 1a는 뇌졸중 환자 및 대조군의 miRNA 마이크로어레이에서 그 발현이 FD≥2인 miRNA의 히트맵을 나타낸다(비수정 p 값<0.05).
도 1b는 TaqMan 분석으로 찾아낸 뇌졸중 환자 및 대조군의 말초 혈액 내에서 그 수준이 변화하는 8개 miRNA를 나타낸다.
도 2a는 단백질 및 miRNA 쌍을 이용하여 이중 루시퍼라제 리포터 분석을 실시하고, ARG1의 3'UTR 구조체의 루시퍼라제 활성이 miR-340-5p 모방체의 형질주입 이후 유의하게 감소하는 것을 나타낸다.
도 2b는 ARG1 3'UTR 선행 영역의 돌연변이 구조체(ARG1_3'UTR_mut1), 및 후행 영역의 돌연변이 구조체(ARG1_3'UTR_mut2)의 유전자 서열을 나타낸다.
도 2c는 ARG1_3'UTR_mut1, ARG1_3'UTR_mut2, 및 ARG1_3'UTR_mut1&2와 miR-340-5p를 이용하여 이중 루시퍼라제 리포터 분석을 실시하고, ARG1_3'UTR_mut1의 경우에만 루시퍼라제 활성이 감소하는 것을 나타낸다.
도 3a는 뇌졸중 환자에서 ARG1 mRNA가 유의하게 증가하는 것을 나타낸다.
도 3b는 miR-340-5p를 형질 주입한 세포 내에서 miR-340-5p의 수준이 약 1100배 증가하여 형질주입이 제대로 수행되었음을 나타낸다.
도 3c는 miR-340-5p를 형질 주입한 U937 세포 내에서 ARG1 mRNA가 대조군에 비해 거의 변화하지 않았음을 실시간 PCR로 확인한 것을 나타낸다.
도 3d는 miR-340-5p를 형질 주입한 U937 세포 내에서 ARG1 단백질의 양이 유의하게 줄었음을 웨스턴 블롯으로 측정한 것을 나타낸다.
도 4는 miR-340-5p를 형질 주입한 Raw 264.7 세포로부터 분비되는 일산화질소(NO)의 양이 증가함을 NO 어세이로 측정한 것을 나타낸다.
Figure 1a shows a heat map of miRNAs whose expression is FD &gt; 2 in the miRNA microarray of stroke patients and controls (unmodified p value <0.05).
FIG. 1B shows 8 miRNAs whose levels were changed in the peripheral blood of stroke patients and controls found by TaqMan analysis.
Figure 2a shows dual luciferase reporter assays using protein and miRNA pairs and shows that the luciferase activity of the 3'UTR construct of ARG1 is significantly reduced after transfection of the miR-340-5p mimic.
2B shows the gene sequence of the mutation construct (ARG1_3'UTR_mut1) of the ARG1 3'UTR preceding region and the mutation construct (ARG1_3'UTR_mut2) of the rear region.
FIG. 2C shows a dual luciferase reporter assay using ARG1_3'UTR_mut1, ARG1_3'UTR_mut2, and ARG1_3'UTR_mut1 & 2 and miR-340-5p, indicating that luciferase activity decreases only in the case of ARG1_3'UTR_mut1.
Figure 3A shows that ARG1 mRNA is significantly increased in stroke patients.
Figure 3b shows that the level of miR-340-5p increased about 1100 fold in miR-340-5p transfected cells, indicating that the transfection was successful.
FIG. 3C shows that real-time PCR confirmed that ARG1 mRNA was not substantially changed in miR-340-5p-transfected U937 cells compared with the control group.
FIG. 3D shows Western blotting that the amount of ARG1 protein was significantly reduced in miR-340-5p transfected U937 cells.
Fig. 4 shows that the amount of nitrogen monoxide (NO) secreted from Raw 264.7 cells transfected with miR-340-5p was increased by NO assay.

이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

실시예Example 1.  One. miRmiR -340-5p의 -340-5p ARG1ARG1 억제 및 이의 메커니즘 확인 Identify Suppression and its Mechanism

1. 실험 방법1. Experimental Method

(1) 피험자(1) Subjects

최초의 급성 허혈성 뇌졸중을 겪고 24시간 내에 센터로 방문한 환자들로부터 10개의 시료를 채취하였다. 나이 및 성별이 맞는 대조군(n=11) 또한 miRNA 마이크로어레이 분석에 이용되었다. 피험자들의 임상적 특성은 하기 표 1과 같다.Ten samples were taken from the patients who visited the center within 24 hours after experiencing the first acute ischemic stroke. Age and gender matched controls (n = 11) were also used for miRNA microarray analysis. The clinical characteristics of the subjects are shown in Table 1 below.

miRNA 마이크로어레이 실험에 참여한 허혈성 뇌졸중 환자 및 대조군의 임상적 특성Clinical characteristics of ischemic stroke patients and control group participating in miRNA microarray experiment 뇌졸중 (n=10)Stroke (n = 10) 대조군 (n=11)Control group (n = 11) pp 나이 (세)Age (years) 73 (61-72)73 (61-72) 73 (60-77)73 (60-77) 0.340.34 남성 (%)male (%) 44 55 0.840.84 고혈압 (%)High blood pressure (%) 77 55 0.490.49 당뇨병 (%)diabetes (%) 1One 00 0.960.96 고지혈증 (%)Hyperlipidemia (%) 00 1One 0.960.96 흡연 (%)smoking (%) 44 1One 0.250.25 뇌졸중의 병인
LAA
CE
The etiology of stroke
LAA
CE

5
5

5
5

-
-

-
-

-
-

-
-
시료 채취 시간 (hrs)Sample collection time (hrs) 13.5 (10.0-18.0)13.5 (10.0-18.0) -- --

연속적 변수들은 중앙값 및 사분위 범위(괄호)로 나타냄.Continuous variables are expressed in median and quartile range (parentheses).

약기: LAA; 큰 동맥 죽상경화증(large-artery atherosclerosis), CE: 심장색전증(cardioembolism)Abbreviation: LAA; Large-artery atherosclerosis, CE: cardioembolism,

뇌졸중 그룹에서, 허혈성 뇌졸중은 뇌졸중과 관련한 급성 신경학적 결손을 기반으로 진단하였고, 자기 공명 촬영한 뇌 확산-강조 영상에서의 급성 뇌경색이 존재하는 것으로 확정하였다. 모든 피험자의 혈관위험인자(vascular risk factor)(예를 들면, 고혈압, 당뇨병, 고지혈증 및 흡연) 과거 병력에 대하여 동일한 신경학자가 조사하였다. 혈관위험인자의 빈도는 두 그룹 사이에 유사하였다(표 1). 모든 피험자들로부터 동의서를 얻었으며, CHA 분당 메디컬 센터(IRB no.: BD2011-121D)의 임상 시험 심사위원회로부터 임상 시험 계획서를 승인 받았다.In the stroke group, ischemic stroke was diagnosed based on acute neurological deficits related to stroke, and acute cerebral infarction was confirmed on magnetic resonance imaging brain diffusion - weighted images. The same neurologist investigated past history of vascular risk factors (eg, hypertension, diabetes, hyperlipemia and smoking) in all subjects. The frequency of vascular risk factors was similar between the two groups (Table 1). Consent was obtained from all subjects and the clinical trial protocol was approved by the Clinical Trials Board of CHA Bundang Medical Center (IRB no .: BD2011-121D).

(2) RNA 분리(2) Isolation of RNA

증상 발현 후 24시간 내에 전주 정맥(antecubital vein)으로부터 총 5 mL의 전혈을 채취하였다(채취 시간 중앙값: 13.5h, 사분 범위(IQR): 뇌졸중 증상 발현 후 10.0 - 18.0h). 혈액 시료는 PaxGene 혈액 RNA 튜브(Qiagen, CA, USA)에 저장하였다. 총 RNA는 Trizol(Invitrogen Life Technologies, CA, USA)을 이용하여 추출하였고 RNeasy 칼럼(Qiagen, CA, USA)를 이용하여 정제하였다. DNase 소화 및 정리 절차가 완료된 후, RNA 시료를 정량화하고 분취하여 -80℃에서 사용할 때까지 저장하였다. RNA 순도 및 무결성(integrity)은 변성 겔 전기영동으로 평가하였고, 260 및 280 nm에서의 광학 밀도 비(OD260/280)는 Agilent 2100 Bioanalyzer를 이용하여 측정하였다(Agilent Technologies, CA, USA). 모든 시료의 OD260/280 비는 1.8 내지 2.2 범위 안이었다. 음성 대조군, 백그라운드(background), 및 노이즈 신호는 모든 어레이에서 낮았던(<200) 반면, 하우스키핑(housekeeping)(>15,000) 및 비오틴(biotin)(>30,000) 신호는 높았다.A total of 5 mL of whole blood was collected from the antecubital vein within 24 h of the onset of symptoms (median time taken: 13.5 h, quadrant (IQR): 10.0 - 18.0 h after stroke). Blood samples were stored in PaxGene blood RNA tubes (Qiagen, CA, USA). Total RNA was extracted with Trizol (Invitrogen Life Technologies, CA, USA) and purified using RNeasy column (Qiagen, CA, USA). After the DNase digestion and clearance procedure was completed, RNA samples were quantified, aliquoted and stored at -80 ° C until use. RNA purity and integrity were assessed by denaturing gel electrophoresis and optical density ratios at 260 and 280 nm (OD 260/280 ) were measured using an Agilent 2100 Bioanalyzer (Agilent Technologies, CA, USA). The OD 260/280 ratio of all samples ranged from 1.8 to 2.2. The negative control, background, and noise signals were low (<200) in all arrays while housekeeping (> 15,000) and biotin (> 30,000) signals were high.

(3) (3) miRNAmiRNA 마이크로어레이Microarray

miRNA 마이크로어레이는 Illumina Human Micro RNA Expression Profiling Assay V2(Illumina, CA, USA)를 이용하여 수행하였고, 이는 1,146 개의 인간 miRNA를 표적으로 한다. 비오틴화(biotinylated) cDNA는 제조사의 프로토콜(Illumina, CA, USA)에 따라 고-효율 유전자 발현 프로파일링(cDNA-매개 어닐링, 선별, 연장 및 결찰 분석: DASL)을 이용하여 0.2 - 1 μg 총 RNA로부터 제조하였다. 혼성화를 위해, 형광 라벨된 cDNA PCR 산물을 제조사의 프로토콜에 따라 Illumina Sentrix Beadchip U1536-16과 혼성화하였다. 그 어레이는 BeadArray Reader 상에서 스캔하였고, 자동 이미지 등록 및 강도 추출 소프트웨어를 각각의 miRNA에 대해 상응하는 비드 유형별 강도 데이터를 도출하기 위해 사용하였다.miRNA microarrays were performed using Illumina Human Micro RNA Expression Profiling Assay V2 (Illumina, CA, USA), which targets 1,146 human miRNAs. Biotinylated cDNA was amplified using 0.2-1 μg total RNA (cDNA-mediated annealing, selection, extension and ligation analysis: DASL) according to the manufacturer's protocol (Illumina, CA, USA) Lt; / RTI &gt; For hybridization, fluorescently labeled cDNA PCR products were hybridized with Illumina Sentrix Beadchip U1536-16 according to the manufacturer's protocol. The array was scanned on a BeadArray Reader, and automatic image registration and intensity extraction software was used to derive the corresponding bead type intensity data for each miRNA.

(4) (4) 마이크로어레이Microarray 시험의 데이터 처리 Data processing of tests

혼성화의 질 및 전반적인 어레이의 성과는 내부 질 관리 검사(internal quality control check) 및 최초(raw) 스캔된 데이터 모두를 육안으로 검사하여 모니터링하였다. 최초 데이터는 제조사로부터 제공된 소프트웨어(Illumina BeadStudio v3.1.3; Gene Expression Module v3.3.8)를 이용하여 추출하였다. 선별된 유전자 신호 값은 분위 방법(quantile method)을 이용하여 대수적으로(logarithmically) 전환 및 정규화(normailized)하였다. Student's t-test를 수행하고 배수차(FD)를 계산하였다. 통계적 유의성은 다중 비교 가설에 대한 오류 발견율(false discovery rate: FDR) 수정을 이용하여 조정하였다.The quality of hybridization and overall array performance were visually inspected and monitored for both internal quality control check and raw scanned data. Initial data was extracted using software provided by the manufacturer (Illumina BeadStudio v3.1.3; Gene Expression Module v3.3.8). Selected gene signal values were logarithmically transformed and norma- lized using the quantile method. Student's t-test was performed and the drainage difference (FD) was calculated. Statistical significance was adjusted using a false discovery rate (FDR) correction for multiple comparison hypotheses.

허혈성 뇌졸중 특이 miRNA는 어레이 분석 결과에서 정상 대조군에 비해 발현 차이가 2배 이상으로 유의한 통계적 수준(p<0.05)을 보이는 miRNA로 정의하였다.The ischemic stroke specific miRNAs were defined as miRNAs with a statistically significant difference (p <0.05) in the expression of the expression between the normal control and the control.

완전 연결법(complete linkage) 및 유사도의 척도로서 유클리드 거리(Euclidean distance)를 이용하여 계층적 군집 분석(Hierarchical cluster analysis)을 수행하였다. 다르게 발현되는 유전자들의 모든 데이터 분석 및 영상화는 ArrayAssist(Stratagene, CA, USA) 및 R statistical language v. 2.4.1을 이용하여 수행하였다.Hierarchical cluster analysis was performed using Euclidean distance as a measure of complete linkage and similarity. All data analysis and imaging of differentially expressed genes was performed using ArrayAssist (Stratagene, CA, USA) and R statistical language v. 2.4.1.

(5) (5) TaqManTaqMan miRNAmiRNA 분석 analysis

마이크로어레이 데이터로부터 얻은 선별된 miRNA들의 발현은 마이크로어레이 데이터의 검증을 위해 TaqMan miRNA 분석(Applied Biosystems, CA, USA)을 이용하여 정량화하였다. 그 중 miRNA 마이크로어레이에서 발현차를 보인 특이 miRNA들 중 miR-186-5p, miR-19a-3p, miR-32-5p, miR-340-5p, miR-579-3p, let-7e, miR-362-3p, 및 miR-1238-5p를 대상으로 TaqMan 분석을 시행하여 다시 한번 발현차를 확인하였다. 이용된 프라이머들은 하기 표 2와 같다.Expression of selected miRNAs from microarray data was quantified using TaqMan miRNA assay (Applied Biosystems, CA, USA) for the verification of microarray data. Among miRNA-186-5p, miR-19a-3p, miR-32-5p, miR-340-5p, miR-579-3p, let-7e and miR- 362-3p, and miR-1238-5p, respectively. The primers used are shown in Table 2 below.

miRNA 분석에 이용된 프라이머The primers used for miRNA analysis 프라이머primer 서열order miR-186-5p miR-186-5p 5'-CAAAGAAUUCUCCUUUUGGGCU-3' (서열번호 1)5'-CAAAGAAUUCUCCUUUUGGGCU-3 '(SEQ ID NO: 1) miR-19a-3p miR-19a-3p 5'-UGUGCAAAUCUAUGCAAAACUGA-3' (서열번호 2)5'-UGUGCAAAUCUAUGCAAAACUGA-3 '(SEQ ID NO: 2) miR-32-5p miR-32-5p 5'-UAUUGCACAUUACUAAGUUGCA-3' (서열번호 3)5'-UAUUGCACAUUACUAAGUUGCA-3 '(SEQ ID NO: 3) miR-340-5p miR-340-5p 5'-UUAUAAAGCAAUGAGACUGAUU-3' (서열번호 4)5'-UUAUAAAGCAAUGAGACUGAUU-3 '(SEQ ID NO: 4) miR-579-3p miR-579-3p 5'-UUCAUUUGGUAUAAACCGCGAUU-3' (서열번호 5)5'-UUCAUUUGGUAUAAACCGCGAUU-3 '(SEQ ID NO: 5) let-7e let-7e 5'- UGAGGUAGGAGGUUGUAUAGUU-3' (서열번호 6)5'-UGAGGUAGGAGGUUGUAUAGUU-3 '(SEQ ID NO: 6) miR-362-3p miR-362-3p 5'-AACACACCUAUUCAAGGAUUCA-3' (서열번호 7)5'-AACACACCUAUUCAAGGAUUCA-3 '(SEQ ID NO: 7) miR-1238-5p miR-1238-5p 5'-GUGAGUGGGAGCCCCAGUGUGUG-3' (서열번호 8)5'-GUGAGUGGGAGCCCCAGUGUGUG-3 '(SEQ ID NO: 8)

miRNA 발현 분석을 위해서, 10 ng의 총 RNA를 miRNA-특이적 프라이머와 함께 TaqMan miRNA 분석에 이용하였다. 맞춤형 역전사 프라이머들을 성숙 miRNA 서열에 상보적으로 합성하였다. 상보적인 DNA 주형은 RNA6에 표준화하였고 제조사의 지시에 따라 40 PCR 사이클을 수행하였다. 데이터는 CFX Manager 소프트웨어(Bio-Rad, CA, USA)를 이용하여 얻었다. 각 실험은 각각의 miRNA에 대해서 3회 수행하였고, 통계적 분석에는 그 평균 값을 이용하였다. FD는 상대적 임계 사이클 방법(comparative threshold (CT) cycle method)을 이용하여 계산한 2- ddCt 값으로 나타냈다. 유효성(validation)은 비모수적 Mann-Whitney U 테스트를 이용하여 검증하였고, 유의성(significance)은 p<0.05인 것으로 간주하였다.For miRNA expression analysis, 10 ng of total RNA was used for TaqMan miRNA analysis with miRNA-specific primers. Customized reverse transcription primers were complementarily synthesized into mature miRNA sequences. The complementary DNA template was standardized to RNA6 and 40 PCR cycles were performed according to the manufacturer's instructions. Data were obtained using CFX Manager software (Bio-Rad, CA, USA). Each experiment was performed three times for each miRNA and the mean value was used for statistical analysis. FD is the relative threshold (C T ) calculated using the method cycle) 2 - shown with ddCt value. Validation was validated using a non-parametric Mann-Whitney U test, with a significance of p <0.05.

(6) 선별된 (6) Selected miRNA들의miRNAs 표적 유전자 예측 Target gene prediction

마이크로어레이 데이터로부터 31 miRNA들(FD≥2, 수정 p<0.05)의 추정되는 표적들을 선별하기 위해 먼저 miRBase(miRBase Release ver. 20., http://www.mirbase.org/), TargetScan(TargetScan Human ver. 6.2, http://www.targetscan.org/), 또는 MicroCosm Target (MicroCosm Targets ver. 5., http://microrna.sanger.ac.uk/targets/v5)와 같은 표적 예측 소프트웨어에서 적어도 7 mer의 시드 매치(seed match)가 있는 표적 후보군을 탐색하였다. 문헌 등을 통해 급성 뇌졸중의 병태 생리와 연관이 있다고 알려진 후보군 유전자들을 탐색하였고, 특히 이전의 마이크로어레이 연구에서 말초 혈액 내에서 발현이 달라지는 유전자들에 초점을 두었다.(MiRBase Release ver. 20., http://www.mirbase.org/), TargetScan (TargetScan) was used to select from the microarray data the estimated targets of 31 miRNAs (FD 2, modified p <0.05) Human ver. 6.2, http://www.targetscan.org/), or MicroCosm Target (MicroCosm Targets ver. 5., http://microrna.sanger.ac.uk/targets/v5). We have searched for candidate targets with at least 7 mer seed matches. The literature has sought candidate genes that are known to be associated with the pathophysiology of acute stroke. In particular, previous microarray studies focused on genes whose expression varies in peripheral blood.

(7) 이중(dual) (7) Dual 루시퍼라제Luciferase 리포터 분석 Reporter Analysis

XbaI가 부착된 ARG1의 3'UTR 서열 또는 인터류킨-18 리셉터1(IL18R1) mRNA를 HiPiTM Plus Taq(ELPIS biotech, Korea)를 이용하여 증폭시키고 pmirGLO 벡터(Promega, WI, USA)로 클로닝 하였다. miRNA 모방체(mimic)(모의품(mock), 음성 대조군[N.C.], miR-186-5p, miR-340-5p, miR-19a-3p)들은 Genolution Pharmaceuticals, Inc.(Genolution, Korea)로부터 구매하였다. 형질주입 24시간 전에 HeLa 세포(ATCC, VA, USA) 500만개를 24웰 배양 디시에 플레이팅하였다. pmirGLO-3'UTR 벡터 80 ng(ARG1 및 IL18R1에 대한) 및 상응하는 miRNA 모방체 80 nM을 리포펙타민 3000(Invitrogen, Ca, USA)을 이용하여 세포에 형질주입하였다. miR-340-5p는 ARG1의 3'UTR(ARG1 mRNA의 3'UTR의 396-402 nt(선행 영역) 및 409-416 nt(후행 영역))에 대한 두 개의 결합 부위를 가지고 있는 것으로 추정되었고, 본 발명자들은 ARG1 3'UTR의 돌연변이 구조체의 형질 주입 후 ARG1의 루시퍼라제 활성을 측정하였다. pmirGLO-ARG1 돌연변이는 하기 표 3의 프라이머와 Muta-direct site-directed Mutagenesis kit(Intron biotechnology, korea)를 이용하여 만들었다.The 3'UTR sequence of XbaI-attached ARG1 or interleukin-18 receptor 1 (IL18R1) mRNA was amplified using HiPi Plus Taq (ELPIS biotech, Korea) and cloned into pmirGLO vector (Promega, WI, USA). miRNA mimics (mock, negative control [NC], miR-186-5p, miR-340-5p, miR-19a-3p) were purchased from Genolution Pharmaceuticals, Inc. (Genolution, Respectively. Twenty-four hours before transfection, 5 million HeLa cells (ATCC, VA, USA) were plated in a 24-well culture dish. 80 nM of the pmirGLO-3'UTR vector (for ARG1 and IL18R1) and 80 nM of the corresponding miRNA mimic were transfected into cells using lipofectamine 3000 (Invitrogen, Ca, USA). miR-340-5p was presumed to have two binding sites for the 3'UTR of ARG1 (396-402 nt of the 3'UTR of ARG1 mRNA (leading region) and 409-416 nt (trailing region) The present inventors measured the luciferase activity of ARG1 after transfection of the mutant construct of ARG1 3'UTR. The pmirGLO-ARG1 mutation was made using the primers and Muta-direct site-directed mutagenesis kit (Intron biotechnology, korea) shown in Table 3 below.

ARG1 돌연변이를 제조하기 위한 프라이머Primers for making ARG1 mutations 프라이머primer 서열order ARG1 3'UTR_mut 1
(선행 영역)
ARG1 3'UTR_mut 1
(Leading area)
정방향Forward GTCATTCAAAAAATGTGATTTCCCGCGATAAACTCTTTATAAC (서열번호 9)GTCATTCAAAAAATGTGATTTCCCGCGATAAACTCTTTATAAC (SEQ ID NO: 9) 역방향Reverse GTTATAAAGAGTTTATCGCGGGAAATCACATTTTTTGAATGAC (서열번호 10)GTTATAAAGAGTTTATCGCGGGAAATCACATTTTTTGAATGAC (SEQ ID NO: 10) ARG1 3'UTR_mut 2
(후행 영역)
ARG1 3'UTR_mut 2
(Trailing area)
정방향Forward TTTTTTATAATAAACTGCCCGCGACAATCTAGAGTCGACCTGC (서열번호 11)TTTTTTATAATAAACTGCCCGCGACAATCTAGAGTCGACCTGC (SEQ ID NO: 11) 역방향Reverse GCAGGTCGACTCTAGATTGTCGCGGGCAGTTTATTATAAAAAA (서열번호 12)GCAGGTCGACTCTAGATTGTCGCGGGCAGTTTATTATAAAAAA (SEQ ID NO: 12) ARG1_3' UTR_mut 1&2
(두 영역 모두)
ARG1_3 'UTR_mut 1 & 2
(Both areas)
정방향Forward CCCGCGATAAACTGCCCGCGACAATCTAGAGTCG (서열번호 13)CCCGCGATAAACTGCCCGCGACAATCTAGAGTCG (SEQ ID NO: 13) 역방향Reverse CGACTCTAGATTGTCGCGGGCAGTTTATCGCGGG (서열번호 14)CGACTCTAGATTGTCGCGGGCAGTTTATCGCGGG (SEQ ID NO: 14)

형질 주입 24시간 후, 반딧불이 및 레닐라 루시퍼라제 활성을 이중-루시퍼라제 분석 시스템(Promega, WI, USA)를 이용하여 측정하였고, 발광(luminescence)을 VICTOR 분석기(PerkinElmer, CA, USA)를 이용하여 측정하였다. 이들 시험은 다른 날에 3번 독립적으로 수행하였다.Luciferase activity was measured using a dual-luciferase assay system (Promega, Wis., USA) 24 hours after transfection, and luminescence was measured using a VICTOR analyzer (PerkinElmer, CA, USA) Respectively. These tests were performed three times on different days independently.

(8) 실시간 (8) Real time PCRPCR 분석 analysis

5백만 U937 세포(ATCC, VA, USA)를 24웰 배양 디시에 플레이팅하고, 단핵구를 대식세포로 분화시키기 위해 PMA(5 μg)를 처리하였다. PMA 처리 48시간 후, hU937 세포는 대식 세포의 마커인 CD11b mRNA가 11배 증가하여 대식 세포의 전형적인 형태를 나타냈다. 대식 세포 분화 후 miR-340-5p 모방체(100 μg)를 리포펙타민 3000을 이용하여 U937 세포에 형질주입하였다. 형질 주입 24시간 후, 총 RNA를 SuperScript® II First-Strand Synthesis System(Invitrogen, CA, USA)을 이용하여 상보적 DNA 가닥으로 역전사하였다. ARG1 mRNA의 발현은 CFXTM 실시간 시스템(Bio-Rad, CA, USA) 및 Quantitect® SYBR Green PCR kit(Qiagen, CA, USA)를 이용하여 정량화하였다. ARG1 mRNA의 RT 프라이머는 하기 표 4와 같다.Five million U937 cells (ATCC, VA, USA) were plated in a 24-well culture dish and treated with PMA (5 μg) to differentiate monocytes into macrophages. Forty-eight hours after PMA treatment, hU937 cells showed an 11-fold increase in CD11b mRNA, which is a marker of macrophages, and showed a typical morphology of macrophages. After macrophage differentiation, miR-340-5p mimic (100 μg) was transfected into U937 cells using lipofectamine 3000. Twenty-four hours after transfection, total RNA was reverse transcribed into complementary DNA strands using the SuperScript ® II First-Strand Synthesis System (Invitrogen, CA, USA). ARG1 mRNA expression was quantified using a CFX TM Real-Time System (Bio-Rad, CA, USA ) and Quantitect ® SYBR Green PCR kit (Qiagen , CA, USA). RT primers of ARG1 mRNA are shown in Table 4 below.

ARG1 mRNA RT 프라이머ARG1 mRNA RT primer 프라이머primer 서열order ARG1 mRNA RT 프라이머ARG1 mRNA RT primer 정방향Forward TCTGTGGGAAAAGCAAGCGA (서열번호 15)TCTGTGGGAAAAGCAAGCGA (SEQ ID NO: 15) 역방향Reverse TTGCCAAACTGTGGTCTCCG (서열번호 16)TTGCCAAACTGTGGTCTCCG (SEQ ID NO: 16)

데이터는 GAPDH에 대해 정규화하였고 사이클 임계(2- ddct) 방법을 이용하여 계산하였다. 각각의 실험은 다른 날에 3번 수행하였다.Data were normalized to GAPDH and calculated using the cycle - critical (2 - ddct ) method. Each experiment was performed three times on different days.

(9) (9) 웨스턴Western 블롯Blot 분석 analysis

miR-340-5p 모방체 형질 주입 48시간 후, 단백질 용해 버퍼(PRO-PREP™, Intron Biotechnology, Korea)로 U937 세포를 용해시켰고, 제조사의 프로토콜에 따라 면역 블롯 분석을 수행하였다. 모든 단백질을 SDS-PAGE 겔에서 분리하고 ARG1의 1차 항체(Abcam, Cambridge, UK) 및 내부 대조군(internal control)으로서 GAPDH를 이용하여 면역 블롯하였다. 밴드의 정량화는 NIH 이미지 J 프로그램을 이용하여 수행하였다. 각각의 실험은 다른 날에 3번 수행하였다.U937 cells were lysed with protein lysis buffer (PRO-PREP (TM), Intron Biotechnology, Korea) 48 hours after miR-340-5p mimic trait injection and immunoblot analysis was performed according to the manufacturer's protocol. All proteins were separated on SDS-PAGE gels and immunoblotted using GAPDH as the primary antibody of ARG1 (Abcam, Cambridge, UK) and internal control. Band quantification was performed using the NIH Image J program. Each experiment was performed three times on different days.

(10) 일산화질소(NO) 분석(10) Analysis of nitrogen monoxide (NO)

miR-340-5p 또는 miR-340-5p의 안티 센스를 마우스 대식 세포에 24시간 형질 주입한 후, NO 분석을 수행하였다. 형질 주입 후, 세포를 지질다당류(LPS) 200 ng/ml를 포함하는 새로운 배양액으로 더 처리한 후, 각각 0, 6, 24 및 24시간 동안 배양하였다. 각 시간에서 총 3 mL의 배양액을 채취하였다. 채취한 배양액은 Griess 분석 키트(Promega, WI, USA)를 이용하여 제조사의 지시에 따라 존재하는 NO의 양을 측정하였다. 요약하면, 50 μL의 배지를 50 μL의 Griess 시약 Ⅰ(설파닐아미드)를 포함하는 96 웰 플레이트로 이동시켰다. 그 혼합물을 혼합하고 10분간 배양하였다. 상기 배양 이후, 50 μL의 Griess 시약 Ⅱ(N-1-나프틸에틸렌디아민 디히드로클로리드)를 더 추가하고 상온에서 10분간 반응하게 두었다. 그 혼합물의 540 nm에서의 흡광도를 플레이트 리더기를 이용하여 판독하였다. 표준 곡선은 0.1 M 아질산 나트륨(sodium nitrite)의 2배 희석도로 작성하였다.An antisense of miR-340-5p or miR-340-5p was injected into mouse macrophages for 24 hours, and NO analysis was performed. After transfection, cells were further treated with fresh medium containing 200 ng / ml of lipopolysaccharide (LPS) and cultured for 0, 6, 24 and 24 hours, respectively. A total of 3 mL of culture was collected at each time. The collected culture was assayed for the amount of NO present according to the manufacturer's instructions using a Griess assay kit (Promega, Wis., USA). Briefly, 50 μL of the medium was transferred to a 96 well plate containing 50 μL of Griess Reagent I (sulfanilamide). The mixture was mixed and incubated for 10 minutes. After the incubation, 50 μL of Griess reagent II ( N -1-naphthylethylenediamine dihydrochloride) was further added and allowed to react at room temperature for 10 minutes. The absorbance of the mixture at 540 nm was read using a plate reader. The standard curve was prepared with a 2-fold dilution of 0.1 M sodium nitrite.

(11) 통계적 분석(11) Statistical analysis

정량적 실시간 PCR 데이터 및 웨스턴 블롯에서 얻은 모든 데이터는 평균±SEM으로 나타냈다. Mann-Whitney U 검사로 실험 결과 및 대조군 값을 비교하였다. 0.05 미만의 p 값(p<0.05)을 통계적으로 유의한 것으로 간주하였다. 통계적 분석은 MedCalc 통계 소프트웨어(MedCalc software, ver. 11.6., Mariakerke, Belgium)를 이용하여 검사하였다. Quantitative real-time PCR data and all data from western blots were expressed as mean ± SEM. Mann-Whitney U test was used to compare the experimental results and the control values. P values less than 0.05 (p < 0.05) were considered statistically significant. Statistical analysis was performed using the MedCalc statistical software (MedCalc software, version 11.6., Mariakerke, Belgium).

2. 급성 뇌졸중 환자의 말초 혈액 내 2. In the peripheral blood of patients with acute stroke miRNA들의miRNAs 발현 변화 확인 Identification of expression changes

miRNA 마이크로어레이에서 1,146 중 810 miRNA가 말초 혈액에서 탐지되었다. 도 1a는 대조군 및 뇌졸중군 사이에서 그 발현이 FD≥2인 miRNA의 히트맵을 나타낸다(비수정 p 값<0.05). FDR 수정 후, 하기 표 5와 같이 총 30 miRNA가 급성 허혈성 뇌졸중 환자 및 대조군의 말초 혈액에서 이들의 발현이 유의하게 다른 것으로 나타났다.Of the 1,146 miRNA microarrays, 810 miRNAs were detected in peripheral blood. Figure 1a shows a heat map of miRNAs whose expression is FD &gt; 2 between the control and stroke groups (unmodified p-value <0.05). After FDR modification, total 30 miRNAs were significantly different in the peripheral blood of patients with acute ischemic stroke and control as shown in Table 5 below.

뇌졸중 환자 및 대조군의 miRNA 마이크로어레이에서 유의한 수준의 변화를 나타낸 miRNAMiRNAs showing significant changes in miRNA microarray in stroke patients and controls miRNAmiRNA FDa FD a p* p * hsa-miR-579-3phsa-miR-579-3p -4.43 -4.43 0.021 0.021 hsa-miR-140-5phsa-miR-140-5p -3.00 -3.00 0.033 0.033 hsa-miR-186-5phsa-miR-186-5p -2.80 -2.80 0.005 0.005 hsa-miR-301a-3phsa-miR-301a-3p -2.57 -2.57 0.042 0.042 hsa-miR-18b-5phsa-miR-18b-5p -2.56 -2.56 0.015 0.015 hsa-miR-19a-3phsa-miR-19a-3p -2.49 -2.49 0.012 0.012 hsa-miR-362-3phsa-miR-362-3p -2.43 -2.43 0.026 0.026 hsa-miR-32-5phsa-miR-32-5p -2.43 -2.43 0.014 0.014 hsa-miR-340-5phsa-miR-340-5p -2.27 -2.27 0.036 0.036 hsa-miR-142-3phsa-miR-142-3p -2.24 -2.24 0.026 0.026 hsa-miR-144-3phsa-miR-144-3p -2.24 -2.24 0.047 0.047 hsa-miR-660-5phsa-miR-660-5p -2.10 -2.10 0.033 0.033 hsa-miR-335-5phsa-miR-335-5p -2.08 -2.08 0.026 0.026 hsa-miR-517b-3phsa-miR-517b-3p -2.01 -2.01 0.018 0.018 hsa-miR-664a-5phsa-miR-664a-5p 2.04 2.04 0.045 0.045 hsa-miR-1301-3phsa-miR-1301-3p 2.08 2.08 0.021 0.021 solexa-7534-111solexa-7534-111 2.09 2.09 0.025 0.025 hsa-miR-1270hsa-miR-1270 2.11 2.11 0.026 0.026 hsa-miR-628-5phsa-miR-628-5p 2.11 2.11 0.009 0.009 HS_22.1HS_22.1 2.15 2.15 0.039 0.039 HS_10HS_10 2.20 2.20 0.017 0.017 hsa-miR-1294hsa-miR-1294 2.25 2.25 0.017 0.017 hsa-miR-1229-3phsa-miR-1229-3p 2.34 2.34 0.026 0.026 hsa-let-7ehsa-let-7e 2.44 2.44 0.004 0.004 hsa-miR-877-5phsa-miR-877-5p 2.51 2.51 0.021 0.021 hsa-miR-505-5phsa-miR-505-5p 2.54 2.54 0.034 0.034 HS_108.1HS_108.1 2.78 2.78 0.017 0.017 hsa-miR-1238-5phsa-miR-1238-5p 3.08 3.08 0.016 0.016 solexa-3464-254solexa-3464-254 3.40 3.40 0.013 0.013 hsa-miR-544ahsa-miR-544a 3.40 3.40 0.032 0.032

a 상기 대조군은 기준(reference)으로 간주된다The control group is regarded as a reference a said control group is considered as a reference (reference) The control group is regarded as a reference

b 오류발견율 수정 후 통계적으로 유의(FDR-p < 0.05) b Statistical significance after correction of error rate (FDR-p <0.05)

약기: FD: 배수 차이Abbreviation: FD: Multiple difference

이들 중, 16개 miRNA(miR-544a, solexa-3464-254, miR-1238-5p, HS_108.1, miR-505-5p, miR-877-5p, let-7e, miR-1229-3p, miR-1294, HS_10, HS_22.1, miR-628-5p, miR-1270, solexa-7534-111, miR-1301-3p, 및 miR-664a-5p)가 뇌졸중 환자에서 높은 발현을 보였고, 14개 miRNA(miR-579-3p, miR-140-5p, miR-186-5p, miR-301a-3p, miR-18b-5p, miR-19a-3p, miR-362-3p, miR-32-5p, miR-340-5p, miR-142-3p, miR-144-3p, miR-660-5p, miR-335-5p, 및 miR-517b-3p)가 뇌졸중 환자에서 낮은 발현을 나타냈다.Of these, 16 miRNAs (miR-544a, solexa-3464-254, miR-1238-5p, HS_108.1, miR-505-5p, miR-877-5p, let-7e, miR- -1294, HS_10, HS_22.1, miR-628-5p, miR-1270, solexa-7534-111, miR-1301-3p and miR-664a-5p) 18b-5p, miR-19a-3p, miR-362-3p, miR-32-5p, miR-186-5p, miR- -345-5p, miR-142-3p, miR-144-3p, miR-660-5p, miR-335-5p, and miR-517b-3p) showed low expression in stroke patients.

마이크로어레이 데이터의 발현 패턴을 확인하기 위해 8개 miRNA(miR-186-5p, miR-19a-3p, miR-32-5p, miR-340-5p, miR-579-3p, let-7e, miR-362-3p, 및 miR-1238-5p)에 대한 TaqMan 분석을 수행하였다. 도 1b와 같이 miR-186-5p(뇌졸중 vs. 대조군: 1.83 vs. 2.89, p=0.024), miR-32-5p(뇌졸중 vs. 대조군: 2.04 vs. 3.10, p=0.024), miR-340-5p(뇌졸중 vs. 대조군: 2.38 vs. 3.39, p=0.049), 및 miR-579-3p(뇌졸중 vs. 대조군: 2.67 vs. 3.52, p=0.029)의 발현이 뇌졸중 그룹에서 대조군에 비해 유의하게 감소하였다. 반면, let-7e(뇌졸중 vs. 대조군: 2.34 vs. 1.63, p=0.012)의 발현은 뇌졸중 그룹에서 대조군에 비해 높았다.In order to confirm the expression pattern of microarray data, 8 miRNAs (miR-186-5p, miR-19a-3p, miR-32-5p, miR-340-5p, miR- 362-3p, and miR-1238-5p). (Stroke vs. control: 1.83 vs. 2.89, p = 0.024), miR-32-5p (stroke vs control: 2.04 vs. 3.10, p = 0.024), miR-340- (Stroke vs. control: 2.38 vs. 3.39, p = 0.049), and miR-579-3p (stroke versus control: 2.67 vs. 3.52, p = 0.029) were significantly reduced in the stroke group compared to the control Respectively. On the other hand, the expression of let-7e (stroke vs. control: 2.34 vs. 1.63, p = 0.012) was higher in the stroke group than in the control group.

miR-19a-3p, miR-362-3p, 및 miR-1238-5p은 급성 허혈성 뇌졸중 및 대조군 사이에서 발현의 차이를 보이지 않았다.miR-19a-3p, miR-362-3p, and miR-1238-5p showed no difference in expression between acute ischemic stroke and the control group.

3. 3. miRNAmiRNA 및 이들의 표적 유전자 선별 And their target gene selection

표적 유전자 예측 프로그램을 이용하여 유의하게 변화하는 miRNA들의 추정되는 표적들을 선별하여, 하기 표 6과 같이 4개의 miRNA 및 이들의 추정되는 표적 유전자들을 선별하였다.Estimated targets of miRNAs that changed significantly using a target gene prediction program were selected and four miRNAs and their putative target genes were selected as shown in Table 6 below.

miRNA 및 표적 유전자 예측 프로그램을 이용하여 추정되는 miRNA의 표적Target of miRNA estimated using miRNA and target gene prediction program miRNAmiRNA 유전자gene 결합 부위
(3'UTR 내)
Binding site
(Within 3'UTR)
시드 매치a
Seed match a
mirSVR 점수b
mirSVR score b
이름name 이름name miR-340-5pc miR-340-5p c ARG1ARG1 409-416409-416 8 mer8 mer -1.2384-1.2384 396-402396-402 7 mer-1A7 mer-1A -0.3382-0.3382 miR-186-5pmiR-186-5p ARG1ARG1 93-9993-99 7 mer-1A7 mer-1A -0.0758-0.0758 miR-19a-5pmiR-19a-5p IL18R1IL18R1 1246-12531246-1253 8 mer8 mer -0.2746-0.2746 miR-186-5pmiR-186-5p IL18R1IL18R1 229-235229-235 7 mer-8 mer7 mer-8 mer -0.3496-0.3496

a TargetScanHuman software (http://www.targetscan.org)를 이용하여 얻음obtained by using a software TargetScanHuman (http://www.targetscan.org)

b microRNA.org (http://www.microrna.org/microrna/home.do)로부터 얻음 b Obtained from microRNA.org ( http://www.microrna.org/microrna/home.do )

c two binding sites present in ARG1의 3' UTR 영역 내 존재하는 두 결합 부위 c two binding sites present in two binding sites present in the 3 'UTR region of ARG1

약기: ARG1: arginase-1, IL18R1: interleukin-18 receptor 1Abbreviations: ARG1: arginase-1, IL18R1: interleukin-18 receptor 1

표적 유전자들은 그에 상응하는 miRNA와 적어도 7 mer의 시드 매치 부위를 갖는 것으로 예측되었다. 상기 기재한 바와 같이, ARG1의 3'UTR에 miR-340-5p가 결합할 수 있는 두 개의 부위가 있고, ARG1의 후행 영역은 선행 영역보다 miR-340-5p와의 결합력이 더 강할 것으로 예측되었다. 또한, ARG1의 후행 영역은 포유류에서 진화적으로 보존된 영역으로 예측되었다. Target genes were predicted to have a corresponding miRNA and at least 7 mer seed match sites. As described above, the 3'UTR of ARG1 had two sites in which miR-340-5p could bind, and the rear region of ARG1 was predicted to have a stronger binding force with miR-340-5p than the preceding region. In addition, the posterior region of ARG1 was predicted to be an evolutionarily conserved region in mammals.

ARG1은 대식 세포에 의해 생성되며, 항-염증 활성을 나타낸다. ARG1 mRNA는 마이크로어레이 연구를 통해 말초 혈액 내에서 지속적으로 상향 조절되는 것으로 보고되었다. IL18R1은 IL-1 상과(superfamily)에 속하는 인터류킨-18(IL-18)에 대한 수용체이다. IL-18은 염증 촉진성 사이토카인의 하나로서 염증 및 죽상경화증(atherosclerosis)을 유도한다. 혈청의 IL-18 및 IL18R1은 뇌졸중 환자에서 증가한다. 이러한 발견은 뇌졸중으로 유도되는 말초 염증 반응에서의 ARG1 및 IL18R1의 주요한 역할을 암시한다.ARG1 is produced by macrophages and exhibits anti-inflammatory activity. ARG1 mRNA has been reported to be continuously upregulated in peripheral blood through microarray studies. IL18R1 is a receptor for interleukin-18 (IL-18), which belongs to the IL-1 phase and (superfamily). IL-18 is one of the inflammatory-promoting cytokines that induces inflammation and atherosclerosis. Serum IL-18 and IL18R1 are increased in stroke patients. These findings suggest a major role for ARG1 and IL18R1 in stroke-induced peripheral inflammatory responses.

4. 4. miRmiR -340-5p의 표적 유전자가 -340-5p of the target gene ARG1임을ARG1 확인 Confirm

선별된 miRNA들의 표적을 확인하기 위하여 4개의 후보군 쌍(ARG1 및 miR-340-5p, ARG1 및 miR-186-5p, IL18R1 및 miR-19-3p, ARG1 및 miR-186-5p)에 대한 이중 루시퍼라제 리포터 분석을 실시하였다. 그 결과, 도 2a와 같이 ARG1의 3'UTR 구조체의 루시퍼라제 활성은 miR-340-5p 모방체의 형질주입 이후 유의하게 감소하였다. Double Lucifer for ARG1 and miR-340-5p, ARG1 and miR-186-5p, IL18R1 and miR-19-3p, ARG1 and miR-186-5p) to identify the target of selected miRNAs Lase reporter assay was performed. As a result, as shown in FIG. 2A, the luciferase activity of the 3'UTR structure of ARG1 was significantly decreased after the transfection of the miR-340-5p mimetic.

ARG1 mRNA의 3'UTR은 두 개의 결합 부위를 가지는 것으로 예측되었기 때문에, 도 2b와 같은 ARG1 3'UTR 선행 영역의 돌연변이 구조체(ARG1_3'UTR_mut1), 후행 영역의 돌연변이 구조체(ARG1_3'UTR_mut2) 및 선행 영역 및 후행 영역 모두의 돌연변이 구조체(ARG1_3'UTR_mut1&2)로 상기와 동일하게 루시퍼라제 활성을 측정하였다. 그 결과 도 2c와 같이 ARG1_3'UTR_mut1의 형질 주입이후에만 루시퍼라제 활성이 감소하였다. 대조적으로 ARG1_3'UTR_mut2 및 ARG1_3'UTR_mut1&2의 형질주입 후에는 루시퍼라제의 활성이 변하지 않았다. 이로서 miR-340-5p은 ARG1 mRNA의 3'UTR의 후행 영역(409-416)에 결합함을 확인하였다.Since the 3'UTR of the ARG1 mRNA is predicted to have two binding sites, the mutation structure (ARG1_3'UTR_mut1) of the ARG1 3'UTR preceding region, the mutation structure (ARG1_3'UTR_mut2) of the rear region and the preceding region And the mutant constructs (ARG1_3'UTR_mut1 & 2) in both of the following regions were used to measure the luciferase activity in the same manner as described above. As a result, luciferase activity decreased only after the transfection of ARG1_3'UTR_mut1 as shown in Fig. 2c. In contrast, the activity of luciferase did not change after transfection of ARG1_3'UTR_mut2 and ARG1_3'UTR_mut1 & 2. This confirmed that miR-340-5p binds to the rear region (409-416) of the 3'UTR of ARG1 mRNA.

5. 5. miRmiR -340-5p가 -340-5p ARG1의Of ARG1 발현을 번역 억제(translational repression)로 조절함을 확인 Confirming that expression is regulated by translational repression

뇌졸중 환자의 혈액 내의 miR-340-5p 및 ARG1 유전자의 발현 패턴을 실시간 PCR로 측정하였다. 상기 기재된 바와 같이, miR-340-5p은 뇌졸중 환자의 말초 혈액에서 유의미하게 하향 조절된다. 반면, 도 3a와 같이 ARG1 유전자의 발현은 뇌졸중 환자의 말초 혈액에서 유의미하게 증가된다(뇌졸중 군 vs. 정상대조군: 1.79 vs. 0.67, p=0.024).The expression patterns of miR-340-5p and ARG1 genes in the blood of stroke patients were measured by real-time PCR. As noted above, miR-340-5p is significantly downregulated in the peripheral blood of stroke patients. On the other hand, the expression of the ARG1 gene is significantly increased in the peripheral blood of stroke patients (stroke vs. normal control: 1.79 vs. 0.67, p = 0.024), as shown in Figure 3a.

miR-340-5p이 ARG1의 발현을 mRNA 분해 또는 번역 억제 중 어떠한 방법으로 조절하는지 알아보기 위해, miR-340-5p 모방체를 U937 세포에 형질주입한 후 ARG1 mRNA와 ARG1 단백질의 양의 변화를 측정하였다. 먼저 형질주입 24시간 후, 도 3b와 같이 miR-340-5p의 양은 음성 대조군에 비해 약 1100배 증가하는 것을 확인하여(p<0.05), 형질주입이 제대로 수행되었음을 확인하였다. 동시에 도 3c와 같이 실시간 PCR로 ARG1 mRNA의 양이 대조군에 비해 거의 변화하지 않았음을 확인하였다. 반면 도 3d와 같이 ARG1 단백질의 양을 웨스턴 블롯으로 측정한 결과 유의하게 감소하였음을 확인하였다. 따라서 miR-340-5p은 ARG1 유전자의 발현을 번역 후 수준에서 번역 억제 메커니즘으로 조절함을 확인하였다.In order to investigate how miR-340-5p modulates the expression of ARG1 by mRNA degradation or translation inhibition, miR-340-5p mimic was transfected into U937 cells and changes in the amounts of ARG1 mRNA and ARG1 protein Respectively. As shown in FIG. 3B, 24 hours after the transfection, miR-340-5p was increased about 1100 times as compared with the negative control (p <0.05). At the same time, as shown in FIG. 3C, real-time PCR confirmed that the amount of ARG1 mRNA was hardly changed compared with the control group. On the other hand, as shown in FIG. 3D, the amount of ARG1 protein was measured by Western blotting, and it was confirmed that the amount of ARG1 protein was significantly decreased. Therefore, it was confirmed that miR-340-5p modulates the expression of ARG1 gene at the post-translational level by the translation inhibition mechanism.

6. 6. miRmiR -340-5p가 대식세포로부터의 NO 및 염증성 사이토카인의 방출을 조절함을 확인Confirming that -340-5p regulates the release of NO and inflammatory cytokines from macrophages

miR-340-5p가 염증 세포에서 ARG1-매개 염증 반응을 조절하는지 여부를 확인하기 위해 LPS 처리 대식세포에서의 NO 생성 및 염증성 사이토카인에 대한 miR-340-5p의 효과를 조사하였다.To investigate whether miR-340-5p regulates ARG1-mediated inflammatory responses in inflammatory cells, we examined the effect of miR-340-5p on NO production and inflammatory cytokines in LPS-treated macrophages.

NO 분석에서는, 도 4에서와 같이 LPS 처리 48시간 후 대식세포(Raw 264.7)에서 NO의 방출이 확실히 증가함을 확인하였다. LPS 처리 전 miR-340-5p으로 형질주입한 경우에는 LPS 처리 48시간 후 대조군보다 더 높은 NO 수준을 나타냈다. 그러나 LPS 처리 전 항-miR-340-5p을 형질주입한 경우에는 대조군과 비교하여 NO 수준에 변화가 나타나지 않았다. 이러한 결과는 대식세포에서의 miR-340-5p의 과발현이 NO 생성을 증가시킴을 나타내고, 또한 miR-340-5p를 녹다운 시키면 NO 생성 증가 효과가 사라졌다.In the NO analysis, it was confirmed that the release of NO was significantly increased in the macrophage (Raw 264.7) 48 hours after LPS treatment as shown in Fig. In the case of transfection with miR-340-5p before LPS treatment, the NO level was higher than that of the control group after 48 hours of LPS treatment. However, when the anti-miR-340-5p was transfected before the LPS treatment, the NO level was not changed compared with the control group. These results indicate that overexpression of miR-340-5p in macrophages increases NO production, and when miR-340-5p is knocked down, the effect of increasing NO production is lost.

<110> SUNGKWANG MEDICAL FOUNDATION <120> composition for diagnosing stroke and method for diagnosing stroke <130> PN113026 <160> 46 <170> KopatentIn 2.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-186-5p primer <400> 1 caaagaauuc uccuuuuggg cu 22 <210> 2 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miR-19a-3p primer <400> 2 ugugcaaauc uaugcaaaac uga 23 <210> 3 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-32-5p primer <400> 3 uauugcacau uacuaaguug ca 22 <210> 4 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-340-5p primer <400> 4 uuauaaagca augagacuga uu 22 <210> 5 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miR-579-3p primer <400> 5 uucauuuggu auaaaccgcg auu 23 <210> 6 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> let-7e primer <400> 6 ugagguagga gguuguauag uu 22 <210> 7 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-362-3p primer <400> 7 aacacaccua uucaaggauu ca 22 <210> 8 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miR-1238-5p primer <400> 8 gugaguggga gccccagugu gug 23 <210> 9 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> ARG1 3'UTR_mut 1 forward primer <400> 9 gtcattcaaa aaatgtgatt tcccgcgata aactctttat aac 43 <210> 10 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> ARG1 3'UTR_mut 1 reverse primer <400> 10 gttataaaga gtttatcgcg ggaaatcaca ttttttgaat gac 43 <210> 11 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> ARG1 3'UTR_mut 2 forward primer <400> 11 ttttttataa taaactgccc gcgacaatct agagtcgacc tgc 43 <210> 12 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> ARG1 3'UTR_mut 2 reverse primer <400> 12 gcaggtcgac tctagattgt cgcgggcagt ttattataaa aaa 43 <210> 13 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> ARG1 3'UTR_mut 1&2 forward primer <400> 13 cccgcgataa actgcccgcg acaatctaga gtcg 34 <210> 14 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> ARG1 3'UTR_mut 1&2 reverse primer <400> 14 cgactctaga ttgtcgcggg cagtttatcg cggg 34 <210> 15 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ARG1 mRNA RT forward primer <400> 15 tctgtgggaa aagcaagcga 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ARG1 mRNA RT reverse primer <400> 16 ttgccaaact gtggtctccg 20 <210> 17 <211> 23 <212> RNA <213> homo sapiens <400> 17 uucauuuggu auaaaccgcg auu 23 <210> 18 <211> 22 <212> RNA <213> homo sapiens <400> 18 cagugguuuu acccuauggu ag 22 <210> 19 <211> 22 <212> RNA <213> homo sapiens <400> 19 caaagaauuc uccuuuuggg cu 22 <210> 20 <211> 23 <212> RNA <213> homo sapiens <400> 20 cagugcaaua guauugucaa agc 23 <210> 21 <211> 23 <212> RNA <213> homo sapiens <400> 21 uaaggugcau cuagugcagu uag 23 <210> 22 <211> 23 <212> RNA <213> homo sapiens <400> 22 ugugcaaauc uaugcaaaac uga 23 <210> 23 <211> 22 <212> RNA <213> homo sapiens <400> 23 aacacaccua uucaaggauu ca 22 <210> 24 <211> 22 <212> RNA <213> homo sapiens <400> 24 uauugcacau uacuaaguug ca 22 <210> 25 <211> 22 <212> RNA <213> homo sapiens <400> 25 uuauaaagca augagacuga uu 22 <210> 26 <211> 23 <212> RNA <213> homo sapiens <400> 26 uguaguguuu ccuacuuuau gga 23 <210> 27 <211> 20 <212> RNA <213> homo sapiens <400> 27 uacaguauag augauguacu 20 <210> 28 <211> 22 <212> RNA <213> homo sapiens <400> 28 uacccauugc auaucggagu ug 22 <210> 29 <211> 23 <212> RNA <213> homo sapiens <400> 29 ucaagagcaa uaacgaaaaa ugu 23 <210> 30 <211> 22 <212> RNA <213> homo sapiens <400> 30 aucgugcauc ccuuuagagu gu 22 <210> 31 <211> 24 <212> RNA <213> homo sapiens <400> 31 acuggcuagg gaaaaugauu ggau 24 <210> 32 <211> 22 <212> RNA <213> homo sapiens <400> 32 uugugaagaa agaaauucuu ac 22 <210> 33 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> solexa-7534-111 <400> 33 uugugaagaa agaaauucuu ac 22 <210> 34 <211> 23 <212> RNA <213> homo sapiens <400> 34 cuggagauau ggaagagcug ugu 23 <210> 35 <211> 22 <212> RNA <213> homo sapiens <400> 35 augcugacau auuuacuaga gg 22 <210> 36 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> HS_22.1 <400> 36 ccaaggaagg cagcaggc 18 <210> 37 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> HS_10 <400> 37 acuggagaua uggaagagcu g 21 <210> 38 <211> 22 <212> RNA <213> homo sapiens <400> 38 ugugagguug gcauuguugu cu 22 <210> 39 <211> 23 <212> RNA <213> homo sapiens <400> 39 cucucaccac ugcccuccca cag 23 <210> 40 <211> 22 <212> RNA <213> homo sapiens <400> 40 ugagguagga gguuguauag uu 22 <210> 41 <211> 20 <212> RNA <213> homo sapiens <400> 41 guagaggaga uggcgcaggg 20 <210> 42 <211> 22 <212> RNA <213> homo sapiens <400> 42 gggagccagg aaguauugau gu 22 <210> 43 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> HS_108.1 <400> 43 ugagguagua gguggugug 19 <210> 44 <211> 23 <212> RNA <213> homo sapiens <400> 44 gugaguggga gccccagugu gug 23 <210> 45 <211> 17 <212> RNA <213> Artificial Sequence <220> <223> solexa-3464-254 <400> 45 uagcugguug uccaaga 17 <210> 46 <211> 22 <212> RNA <213> homo sapiens <400> 46 auucugcauu uuuagcaagu uc 22 <110> SUNGKWANG MEDICAL FOUNDATION <120> composition for diagnosing stroke and method for diagnosing          stroke <130> PN113026 <160> 46 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-186-5p primer <400> 1 caaagaauuc uccuuuuggg cu 22 <210> 2 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miR-19a-3p primer <400> 2 ugugcaaauc uaugcaaaac uga 23 <210> 3 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-32-5p primer <400> 3 uauugcacau uacuaaguug ca 22 <210> 4 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-340-5p primer <400> 4 uuauaaagca augagacuga uu 22 <210> 5 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miR-579-3p primer <400> 5 uucauuuggu auaaaccgcg auu 23 <210> 6 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> let-7e primer <400> 6 ugagguagga gguuguauag uu 22 <210> 7 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-362-3p primer <400> 7 aacacaccua uucaaggauu ca 22 <210> 8 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miR-1238-5p primer <400> 8 gugaguggga gccccagugu gug 23 <210> 9 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> ARG1 3'UTR_mut 1 forward primer <400> 9 gtcattcaaa aaatgtgatt tcccgcgata aactctttat aac 43 <210> 10 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> ARG1 3'UTR_mut 1 reverse primer <400> 10 gttataaaga gtttatcgcg ggaaatcaca ttttttgaat gac 43 <210> 11 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> ARG1 3'UTR_mut 2 forward primer <400> 11 ttttttataa taaactgccc gcgacaatct agagtcgacc tgc 43 <210> 12 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> ARG1 3'UTR_mut 2 reverse primer <400> 12 gcaggtcgac tctagattgt cgcgggcagt ttattataaa aaa 43 <210> 13 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> ARG1 3'UTR_mut 1 & 2 forward primer <400> 13 cccgcgataa actgcccgcg acaatctaga gtcg 34 <210> 14 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> ARG1 3'UTR_mut 1 & 2 reverse primer <400> 14 cgactctaga ttgtcgcggg cagtttatcg cggg 34 <210> 15 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ARG1 mRNA RT forward primer <400> 15 tctgtgggaa aagcaagcga 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ARG1 mRNA RT reverse primer <400> 16 ttgccaaact gtggtctccg 20 <210> 17 <211> 23 <212> RNA <213> homo sapiens <400> 17 uucauuuggu auaaaccgcg auu 23 <210> 18 <211> 22 <212> RNA <213> homo sapiens <400> 18 cagugguuuu acccuauggu ag 22 <210> 19 <211> 22 <212> RNA <213> homo sapiens <400> 19 caaagaauuc uccuuuuggg cu 22 <210> 20 <211> 23 <212> RNA <213> homo sapiens <400> 20 cagugcaaua guauugucaa agc 23 <210> 21 <211> 23 <212> RNA <213> homo sapiens <400> 21 uaaggugcau cuagugcagu uag 23 <210> 22 <211> 23 <212> RNA <213> homo sapiens <400> 22 ugugcaaauc uaugcaaaac uga 23 <210> 23 <211> 22 <212> RNA <213> homo sapiens <400> 23 aacacaccua uucaaggauu ca 22 <210> 24 <211> 22 <212> RNA <213> homo sapiens <400> 24 uauugcacau uacuaaguug ca 22 <210> 25 <211> 22 <212> RNA <213> homo sapiens <400> 25 uuauaaagca augagacuga uu 22 <210> 26 <211> 23 <212> RNA <213> homo sapiens <400> 26 uguaguguuu ccuacuuuau gga 23 <210> 27 <211> 20 <212> RNA <213> homo sapiens <400> 27 uacaguauag augauguacu 20 <210> 28 <211> 22 <212> RNA <213> homo sapiens <400> 28 uacccauugc auaucggagu ug 22 <210> 29 <211> 23 <212> RNA <213> homo sapiens <400> 29 ucaagagcaa uaacgaaaaa ugu 23 <210> 30 <211> 22 <212> RNA <213> homo sapiens <400> 30 aucgugcauc ccuuuagagu gu 22 <210> 31 <211> 24 <212> RNA <213> homo sapiens <400> 31 acuggcuagg gaaaaugauu ggau 24 <210> 32 <211> 22 <212> RNA <213> homo sapiens <400> 32 uugugaagaa agaaauucu ac 22 <210> 33 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> solexa-7534-111 <400> 33 uugugaagaa agaaauucu ac 22 <210> 34 <211> 23 <212> RNA <213> homo sapiens <400> 34 cuggagauau ggaagagcug ugu 23 <210> 35 <211> 22 <212> RNA <213> homo sapiens <400> 35 augcugacau auuuacuaga gg 22 <210> 36 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> HS_22.1 <400> 36 ccaaggaagg cagcaggc 18 <210> 37 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> HS_10 <400> 37 acuggagaua uggaagagcu g 21 <210> 38 <211> 22 <212> RNA <213> homo sapiens <400> 38 ugugagguug gcauuguugu cu 22 <210> 39 <211> 23 <212> RNA <213> homo sapiens <400> 39 cucucaccac ugcccuccca cag 23 <210> 40 <211> 22 <212> RNA <213> homo sapiens <400> 40 ugagguagga gguuguauag uu 22 <210> 41 <211> 20 <212> RNA <213> homo sapiens <400> 41 guagaggaga uggcgcaggg 20 <210> 42 <211> 22 <212> RNA <213> homo sapiens <400> 42 gggagccagg aaguauugau gu 22 <210> 43 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> HS_108.1 <400> 43 ugagguagua gguggugug 19 <210> 44 <211> 23 <212> RNA <213> homo sapiens <400> 44 gugaguggga gccccagugu gug 23 <210> 45 <211> 17 <212> RNA <213> Artificial Sequence <220> <223> solexa-3464-254 <400> 45 uagcugguug uccaaga 17 <210> 46 <211> 22 <212> RNA <213> homo sapiens <400> 46 auucugcauu uuuagcaagu uc 22

Claims (10)

삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 서열번호 25의 염기서열을 포함하는 22 내지 30 뉴클레오티드 및 알지네이즈 1(Arginase 1: ARG1) 유전자 서열을 포함하는 뉴클레오티드 또는 ARG1 mRNA 서열을 포함하는 뉴클레오티드를 포함하는 혈액 시료에 피검 물질을 접촉시키는 단계;
상기 피검 물질과 접촉한 혈액 시료에서 서열번호 25의 염기서열을 포함하는 22 내지 30 뉴클레오티드 및 ARG1 유전자 서열을 포함하는 뉴클레오티드 또는 ARG1 mRNA 서열을 포함하는 뉴클레오티드의 결합 수준을 측정하는 단계;
상기 측정된 결합 수준을 피검 물질을 접촉시키지 않은 대조군의 결합 수준과 비교하는 단계; 및
상기 대조군의 결합 수준과 비교하여 상기 피검 물질이 처리된 혈액 시료 내 결합 수준을 증가시키는 물질을 선별하는 단계를 포함하는 허혈성 질환 또는 염증성 질환을 치료하기 위한 후보물질을 스크리닝하는 방법.
Contacting a test substance with a blood sample comprising a nucleotide comprising a nucleotide sequence of 22 to 30 nucleotides including the nucleotide sequence of SEQ ID NO: 25 and an arginase 1 (ARG1) gene sequence or a nucleotide comprising an ARG1 mRNA sequence;
Measuring a binding level of a nucleotide comprising 22 to 30 nucleotides comprising the nucleotide sequence of SEQ ID NO: 25 and a nucleotide comprising the ARG1 gene sequence or an ARG1 mRNA sequence in a blood sample in contact with the test substance;
Comparing the measured binding level to a binding level of a control group not contacting the test substance; And
Selecting a substance that increases the level of binding in the blood sample treated with said test substance compared to the level of binding of said control group.
청구항 9에 있어서, 상기 질환은 뇌졸중인 것인 방법.The method according to claim 9, wherein the disease is stroke.
KR1020160040948A 2016-04-04 2016-04-04 composition for diagnosing stroke and method for diagnosing stroke KR101929009B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020160040948A KR101929009B1 (en) 2016-04-04 2016-04-04 composition for diagnosing stroke and method for diagnosing stroke

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020160040948A KR101929009B1 (en) 2016-04-04 2016-04-04 composition for diagnosing stroke and method for diagnosing stroke

Publications (2)

Publication Number Publication Date
KR20170114099A KR20170114099A (en) 2017-10-13
KR101929009B1 true KR101929009B1 (en) 2018-12-13

Family

ID=60139840

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020160040948A KR101929009B1 (en) 2016-04-04 2016-04-04 composition for diagnosing stroke and method for diagnosing stroke

Country Status (1)

Country Link
KR (1) KR101929009B1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102140581B1 (en) * 2019-08-13 2020-08-03 중앙대학교 산학협력단 Biomarker composition for diagnosing subtype of cerebral infarction
KR102359603B1 (en) * 2019-09-24 2022-02-08 건국대학교 글로컬산학협력단 Use of miR-5739 as a diagnostic marker for muscle disease and vascular disease
CN111733250A (en) * 2020-07-30 2020-10-02 上海思路迪医学检验所有限公司 Detection reagent of biomarker for differential diagnosis of metastatic and non-metastatic pancreatic cancer and application

Also Published As

Publication number Publication date
KR20170114099A (en) 2017-10-13

Similar Documents

Publication Publication Date Title
US11591655B2 (en) Diagnostic transcriptomic biomarkers in inflammatory cardiomyopathies
KR102029775B1 (en) Biomarkers for diagnosis of Non-muscle invasive bladder cancer and uses thereof
EP3421615A1 (en) Method and kit for the classification and prognosis of tissue or organ in a reparative or reactive process
EP2759602A1 (en) Non-invasive prenatal genetic diagnostic methods
KR102178922B1 (en) Biomarker microRNA let-7 or microRNA-150 for diagnosing diabetic nephropathy and use thereof
KR101929009B1 (en) composition for diagnosing stroke and method for diagnosing stroke
CN108949969B (en) Application of long-chain non-coding RNA in colorectal cancer
WO2019143828A2 (en) Biomarkers of cardiovascular status and uses therof
EP3093343B1 (en) Method for assessing lymph node metastatic potential of endometrial cancer
EP3775212A1 (en) Identification of muscular mirnas as molecular biomarkers and co-adjuvant for the treatment of spinal muscular atrophy
CA2790502A1 (en) Markers for obesity and methods of use thereof
KR102505618B1 (en) Urinary exosome-derived miRNA gene biomarkers for diagnosis of antibody-mediated rejection in kidney allografts and use thereof
CN112029864B (en) Breast cancer miRNA detection kit and application thereof
CN110777199B (en) Diagnosis and treatment of psoriasis arthritis and corresponding kit thereof
WO2012034189A1 (en) Methods of using mirnas transcribed from the 14q32 region of human chromosome 14 as biomarkers for schizophrenia or symptoms thereof
KR20210024918A (en) Urinary exosome-derived miRNA gene biomarkers for diagnosis of T cell-mediated rejection in kidney allografts and use thereof
JP2010502179A (en) Prognosis method
KR20190111845A (en) Markers for predicting or diagnosing stem cell senescence
US20240125766A1 (en) Method for determining suitability of a subject to anti tnf alpha therapy
KR101685107B1 (en) Composition and kit for detecting tissue or organ damage in a subject, method for predicting or detecting tissue or organ damage in a subject and method for screening a therapeutic agent for tissue or organ damage
US11525165B2 (en) Method of selection of an IRE1-inhibitor therapy for patient suffering from cancer
CN108588212B (en) Gene related to preeclampsia occurrence and development and application thereof
KR102545543B1 (en) Urinary exosome-derived miRNA gene biomarkers for diagnosis of BK virus nephropathy in kidney allografts and use thereof
KR101542934B1 (en) Composition and kit for detecting a laminitis in a subject, method for detecting a laminitis in a subject and method for screening a therapeutic agent for a laminitis
KR101619433B1 (en) Composition and kit for detecting a laminitis in a subject, method for detecting a laminitis in a subject and method for screening a therapeutic agent for a laminitis

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right