KR102545543B1

KR102545543B1 - Urinary exosome-derived miRNA gene biomarkers for diagnosis of BK virus nephropathy in kidney allografts and use thereof

Info

Publication number: KR102545543B1
Application number: KR1020190104725A
Authority: KR
Inventors: 신성; 김미정
Original assignee: 울산대학교 산학협력단; 재단법인 아산사회복지재단
Priority date: 2019-08-26
Filing date: 2019-08-26
Publication date: 2023-06-20
Also published as: KR20210024919A

Abstract

본 발명은 BK 바이러스 신병증의 진단을 위한 소변 엑소좀 유래 miRNA 유전자 바이오마커 및 이의 용도에 관한 것으로, 보다 상세하게는 BK 바이러스 신병증 (BK virus nephropathy, BKVN)과 관련된 바이오마커, BK 바이러스 신병증 진단용 조성물, 키트, 이를 이용한 BK 바이러스 신병증의 진단을 위한 정보제공방법 및 BK 바이러스 신병증 치료제의 스크리닝 방법에 관한 것이다.The present invention relates to a urine exosome-derived miRNA gene biomarker for the diagnosis of BK virus nephropathy and its use, and more particularly, to biomarkers related to BK virus nephropathy (BKVN), BK virus nephropathy It relates to a diagnostic composition, a kit, a method for providing information for diagnosing BK virus nephropathy using the same, and a screening method for a therapeutic agent for BK virus nephropathy.

Description

Urine exosome-derived miRNA gene biomarkers for diagnosis of BK virus nephropathy in kidney allografts and use thereof}

장기이식 분야는 서서히 정밀 의료의 일부가 되고 있다. 현재의 표준 면역 억제 치료를 사용할 때 여전히 신장 이식을 받은 환자의 15 ~ 20%에서 급성 거부 반응이 발생하며, 현재까지는 혈청 크레아티닌의 농도 증가 또는 새로운 단백뇨의 발현 등이 생길 경우 조직 생검을 통해 진단된다. 혈청 크레아티닌 농도 증가 또는 새로운 단백뇨 발현이 있는 시점에서의 신장 상태는 이미 염증이 꽤 진행된 상태이기 때문에, 무증상의 거부반응(subclinical acute rejection)을 조기 발견할 수 있는 바이오마커의 필요성이 대두된다. 선천적/후천적 면역 반응은 조직학적 수준에서 나타나기 전에 분자 수준에서 먼저 나타난다고 알려져 있다. 따라서 신장이식 후에 임상적 상태를 미리 진단하고 모니터링하기 위한 비침습적 바이오마커의 개발은 정밀 의료에 필수적인 단계이다.The field of organ transplantation is slowly becoming part of precision medicine. When using the current standard immunosuppressive treatment, acute rejection still occurs in 15 to 20% of kidney transplant patients, and so far, increased serum creatinine concentration or new proteinuria is diagnosed through tissue biopsy. . Since the renal condition at the time of an increase in serum creatinine concentration or a new expression of proteinuria is already in an advanced state of inflammation, the need for a biomarker capable of early detection of subclinical acute rejection is emerging. It is known that innate/acquired immune responses first appear at the molecular level before appearing at the histological level. Therefore, the development of non-invasive biomarkers for prediagnosing and monitoring clinical conditions after kidney transplantation is an essential step for precision medicine.

BK 바이러스(BKV)는 파포바바이러스(papovavirus)에 속하는 바이러스로서, 원숭이의 파포바이러스인 SV40과 형태적으로 유사하며, 유전체의 유전자구성은 SV40과 동일하다. BK 바이러스는 면역이상이 있는 환자에서 주로 분리되는데, 질환과의 관련성은 분명하지 않다. 그러나, 혈청역학적조사에 따르면 BK 바이러스는 세계 각국에서 광범위하게 침음하고 있다고 한다.BK virus (BKV) is a virus belonging to papovavirus, and is morphologically similar to monkey papovavirus SV40, and has the same genetic composition as SV40. BK virus is mainly isolated from patients with immune disorders, but its relevance to the disease is not clear. However, according to seroepidemiological studies, the BK virus is widely infiltrated in countries around the world.

특히, 신장이식환자에서는 신병증(nephropathy) 및 출혈성 방광염(hemorrhagic cystitis)을 야기하는 주요 원인인데, BK 바이러스성 신병증(BKVN)은 이식된 신장의 기능 약화 및 이식 실패를 야기한다(Pakfetrat M. et al., Int J Organ Transplant Med 2015; 6: 77-84). 신장이식환자에서 BK 바이러스의 감염 비율은 1 내지 10% 사이이며, 이식 결손 빈도는 10 내지 80%로 알려져 있다. 이에, 초기 치료를 위한 BKV 감염의 적절하고 정확한 진단이 매우 중요한 실정이다. 현재, BKV 신병증(BK virus nephropathy; BKVN)은 생체검사 표본에서 얻은 신장 동종이식 조직에서 BKV의 존재를 확인함으로써 진단한다. 그러나, BKVN의 조직학적 특성은 급성 거부반응과 비슷하여(Li JY. et al, Am J Transplant 2014; 14: 1183-1190), 생체검사를 통한 BKVN의 진단은 약 2/3 정도만의 정확도를 갖는 단점이 있었다.In particular, it is a major cause of nephropathy and hemorrhagic cystitis in kidney transplant patients, and BK viral nephropathy (BKVN) causes functional weakness and transplant failure of the transplanted kidney (Pakfetrat M. et al., Int J Organ Transplant Med 2015;6: 77-84). The infection rate of BK virus in kidney transplant patients is between 1 and 10%, and the frequency of transplant defects is known to be between 10 and 80%. Accordingly, proper and accurate diagnosis of BKV infection for initial treatment is very important. Currently, BK virus nephropathy (BKVN) is diagnosed by confirming the presence of BKV in renal allograft tissue obtained from a biopsy specimen. However, the histological characteristics of BKVN are similar to those of acute rejection (Li JY. et al, Am J Transplant 2014; 14: 1183-1190), so the diagnosis of BKVN through biopsy has only about two-thirds of the accuracy. There were downsides.

한편, 엑소좀(exosome)은 세포에서 유래하는 소포체로서 표면에 마커를 가지며 그의 내부에는 지질, 단백질, 마이크로RNA 등의 핵산 등을 함유하고 있어서 이를 이용한 정상적인 기능과 질병에 대한 기능을 연구가 활발히 진행되고 있다. 엑소좀은 세뇨관 내강 (renal tubule lumen)에 존재하는 상피세포 혹은 사구체 발세포 (glomerular podocyte)에서 분비되어 엑소좀에 있는 특이 인자가 이식된 신장세포의 상태를 반영하여 신장 이식 후 거부반응을 진단하기 위한 바이오마커로의 활용 가치가 높은 것으로 알려져 있다 (Hua Zhou, Peter S. T. Yuen, Trairak Pisitkum et al. Collection, storage, preservation, and normalization of human urinary exosomes for biomarker discovery. Kidney International, 2006, 69(8) 1471-76).On the other hand, exosomes are cell-derived endoplasmic reticulum that have markers on their surface and contain nucleic acids such as lipids, proteins, and microRNAs. It is becoming. Exosomes are secreted from epithelial cells or glomerular podocytes present in the renal tubule lumen, and specific factors in exosomes reflect the state of transplanted kidney cells to diagnose rejection after kidney transplantation. It is known to have high utilization value as a biomarker for biomarkers (Hua Zhou, Peter S. T. Yuen, Trairak Pisitkum et al. Collection, storage, preservation, and normalization of human urinary exosomes for biomarker discovery. Kidney International, 2006, 69(8) 1471-76).

이러한 배경 하에, 본 발명자들은 신장이식 후 BK 바이러스 신병증을 진단할 수 있는 miRNA 유전자 바이오마커 및/또는 BK 바이러스 신병증을 신장이식 후 항체 매개성 거부반응 및 T 세포 매개성 거부반응과 같은 신장이식 거부반응과 구분하여 진단할 수 있는 miRNA 유전자 바이오마커를 선별 및 확인함으로써 본 발명을 완성하였다.Under this background, the present inventors have developed miRNA gene biomarkers and/or BK virus nephropathy capable of diagnosing BK virus nephropathy after kidney transplantation, such as antibody-mediated rejection and T cell-mediated rejection after kidney transplantation. The present invention was completed by selecting and confirming miRNA gene biomarkers that can be diagnosed separately from rejection.

본 발명의 목적은 BK 바이러스 신병증을 진단하기 위한 miRNA 유전자 바이오마커, 이를 이용하여 BK 바이러스 신병증을 진단하기 위한 조성물, 키트, 정보제공방법 및 BK 바이러스 신병증의 치료제 스크리닝 방법을 제공하는 것이다.An object of the present invention is to provide a miRNA gene biomarker for diagnosing BK virus nephropathy, a composition for diagnosing BK virus nephropathy using the same, a kit, an information providing method, and a method for screening a therapeutic agent for BK virus nephropathy.

본 발명의 다른 목적은 신장이식 거부반응과 구분하여 BK 바이러스 신병증을 진단하기 위한 바이오마커 조성물, 이를 이용하여 신장이식 거부반응과 구분하여 BK 바이러스 신병증을 진단하기 위한 조성물, 키트, 정보제공방법 및 BK 바이러스 신병증의 치료제 스크리닝 방법을 제공하는 것이다.Another object of the present invention is a biomarker composition for diagnosing BK virus nephropathy in distinction from kidney transplant rejection, and a composition, kit, and information providing method for diagnosing BK virus nephropathy in distinction from kidney transplant rejection using the same. And to provide a method for screening a therapeutic agent for BK virus nephropathy.

상술한 과제를 해결하기 위한 제1 양태로, 본 발명은 hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자를 포함하는, BK 바이러스 신병증 (BK virus nephropathy)을 진단하기 위한 바이오마커 조성물을 제공한다.As a first aspect for solving the above problems, the present invention provides hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p , hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR Provided is a biomarker composition for diagnosing BK virus nephropathy, including any one or more miRNA genes selected from the group consisting of -125b-5p.

제1 양태와 관련하여, 본 발명은 또한 hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준을 측정하는 제제를 포함하는, BK 바이러스 신병증을 진단하기 위한 조성물 및 이를 포함하는 키트를 제공한다.Regarding the first aspect, the present invention also provides hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR -31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p Provided is a composition for diagnosing BK virus nephropathy, including an agent for measuring the expression level of any one or more miRNA genes selected from the group consisting of, and a kit containing the same.

본 발명의 바람직한 일실시예에 따르면, 상기 hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준을 측정하는 제제는 상기 유전자에 특이적으로 결합하는 프라이머 또는 프로브를 포함할 수 있다.According to a preferred embodiment of the present invention, the hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR -31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p An agent for measuring the expression level of one or more miRNA genes selected from the group consisting of may include a primer or probe that specifically binds to the gene.

제1 양태와 관련하여, 본 발명은 또한 다음의 단계를 포함하는 BK 바이러스 신병증을 진단하기 위한 정보 제공방법을 제공한다:Regarding the first aspect, the present invention also provides an information providing method for diagnosing BK virus nephropathy, comprising the following steps:

(a) 개체로부터 분리된 생물학적 시료에서 hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준을 측정하는 단계; 및(a) hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-3p in biological samples isolated from individuals 31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p Measuring the expression level of any one or more miRNA genes selected from the group consisting of; and

(b) 상기 (a) 단계에서 측정된, hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준을 정상 대조군 시료와 비교하는 단계.(b) measured in step (a), hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa- miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b- Comparing the expression level of one or more miRNA genes selected from the group consisting of 5p with a normal control sample.

본 발명의 바람직한 일실시예에 따르면, 상기 정보제공방법은 (c) 상기 (a) 단계에서 측정된, hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준이 정상 대조군 시료에서의 발현 수준보다 증가하는 경우, BK 바이러스 신병증으로 진단하는 단계를 추가로 포함할 수 있다.According to a preferred embodiment of the present invention, the information providing method comprises (c) hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa measured in step (a). -miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p If the expression level of one or more miRNA genes selected from the group consisting of hsa-miR-514a-3p and hsa-miR-125b-5p is higher than that in the normal control sample, BK virus nephropathy is diagnosed. Additional steps may be included.

제1 양태와 관련하여, 본 발명은 또한 다음의 단계를 포함하는 BK 바이러스 신병증 치료제의 스크리닝 방법을 제공한다:Regarding the first aspect, the present invention also provides a method for screening a therapeutic agent for BK virus nephropathy, comprising the following steps:

(a) 시료에 BK 바이러스 신병증 치료제의 후보물질을 처리하는 단계; 및(a) treating the sample with a candidate substance for treating BK virus nephropathy; and

(b) 상기 후보물질이 처리된 시료에서 hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준을 측정하는 단계.(b) hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR in samples treated with the candidate substances -31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p Measuring the expression level of any one or more miRNA genes selected from the group consisting of.

본 발명의 바람직한 일실시예에 따르면, 상기 스크리닝 방법은 (c) 상기 (b) 단계에서 측정된, hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준이 후보물질을 처리하지 않은 시료에서 보다 억제되는 경우, 상기 (a) 단계에서 처리한 후보물질을 BK 바이러스 신병증 치료제로 판단하는 단계를 추가로 포함할 수 있다.According to a preferred embodiment of the present invention, the screening method (c) measured in step (b), hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa- miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, When the expression level of one or more miRNA genes selected from the group consisting of hsa-miR-514a-3p and hsa-miR-125b-5p is suppressed more than in the sample not treated with the candidate substance, treatment in step (a) above. A step of determining one candidate substance as a therapeutic agent for BK virus nephropathy may be further included.

상술한 과제를 해결하기 위한 제2 양태로, 본 발명은 hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자를 포함하는, 신장이식 거부반응과 구분하여 BK 바이러스 신병증 (BK virus nephropathy, BKVN)을 진단하기 위한 바이오마커 조성물을 제공한다.As a second aspect for solving the above problems, the present invention provides hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b Provided is a biomarker composition for diagnosing BK virus nephropathy (BKVN), which includes one or more miRNA genes selected from the group consisting of -5p, in distinction from kidney transplant rejection.

제2 양태와 관련하여, 본 발명은 hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준을 측정하는 제제를 포함하는, 신장이식 거부반응과 구분하여 BK 바이러스 신병증을 진단하기 위한 조성물 및 이를 포함하는 키트를 제공한다.Regarding the second aspect, the present invention relates to a group consisting of hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p Provided is a composition for diagnosing BK virus nephropathy, including an agent for measuring the expression level of any one or more miRNA genes selected from, and a kit containing the same, as distinguished from kidney transplant rejection.

본 발명의 바람직한 일실시예에 따르면, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준을 측정하는 제제는 상기 유전자에 특이적으로 결합하는 프라이머 또는 프로브를 포함할 수 있다.According to a preferred embodiment of the present invention, the group consisting of hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p An agent for measuring the expression level of one or more miRNA genes selected from may include a primer or probe that specifically binds to the gene.

본 발명의 바람직한 다른 일실시예에 따르면, 상기 키트는 실시간 PCR (RT-PCR) 키트, 마이크로어레이 키트 또는 SAGE(Serial Analysis of Gene Expression) 키트일 수 있다.According to another preferred embodiment of the present invention, the kit may be a real-time PCR (RT-PCR) kit, a microarray kit, or a Serial Analysis of Gene Expression (SAGE) kit.

제2 양태와 관련하여, 본 발명은 또한 다음의 단계를 포함하는 신장이식 거부반응과 구분하여 BK 바이러스 신병증을 진단하기 위한 정보 제공방법을 제공한다:Regarding the second aspect, the present invention also provides an information providing method for diagnosing BK virus nephropathy separately from kidney transplant rejection, which includes the following steps:

(a) 개체로부터 분리된 생물학적 시료에서 hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준을 측정하는 단계; 및(a) a group consisting of hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p in a biological sample isolated from an individual; Measuring the expression level of any one or more miRNA genes selected from; and

(b) 상기 (a) 단계에서 측정된, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준을 정상 대조군 시료와 비교하는 단계.(b) hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p measured in step (a) above. Comparing the expression level of any one or more miRNA genes selected from the group consisting of normal control samples.

본 발명의 바람직한 일실시예에 따르면, 상기 (a) 단계의 생물학적 시료는 소변 또는 소변 유래 엑소좀일 수 있다.According to a preferred embodiment of the present invention, the biological sample in step (a) may be urine or urine-derived exosomes.

본 발명의 바람직한 다른 일실시예에 따르면, 상기 정보제공방법은 (c) 상기 (a) 단계에서 측정된, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준이 정상 대조군 시료에서의 발현 수준보다 증가하는 경우, 신장이식 거부반응을 동반하지 않는 BK 바이러스 신병증으로 진단하는 단계를 추가로 포함할 수 있다.According to another preferred embodiment of the present invention, the information providing method comprises (c) hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, measured in step (a), When the expression level of one or more miRNA genes selected from the group consisting of hsa-miR-514a-3p and hsa-miR-125b-5p is higher than the expression level in the normal control sample, it is not accompanied by renal transplant rejection. A step of diagnosing as BK virus nephropathy may be further included.

본 발명의 바람직한 일실시예에 따르면, 상기 신장이식 거부반응은 항체 매개성 거부반응, T 세포 매개성 거부반응 또는 이들 모두가 복합적으로 나타나는 혼합 거부반응일 수 있다.According to a preferred embodiment of the present invention, the kidney transplant rejection may be antibody-mediated rejection, T cell-mediated rejection, or a combination of both.

제2 양태와 관련하여, 본 발명은 또한 다음의 단계를 포함하는 BK 바이러스 신병증 치료제의 스크리닝 방법을 제공한다:Regarding the second aspect, the present invention also provides a method for screening a therapeutic agent for BK virus nephropathy, comprising the following steps:

(b) 상기 후보물질이 처리된 시료에서 hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준을 측정하는 단계.(b) consisting of hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p in the sample treated with the candidate substance Measuring the expression level of any one or more miRNA genes selected from the group.

본 발명의 바람직한 일실시예에 따르면, 상기 (a) 단계의 시료는 소변 또는 소변 유래 엑소좀일 수 있다.According to a preferred embodiment of the present invention, the sample in step (a) may be urine or urine-derived exosomes.

본 발명의 바람직한 다른 일실시예에 따르면, 상기 스크리닝 방법은 (c) 상기 (b) 단계에서 측정된, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준이 후보물질을 처리하지 않은 시료에서 보다 억제되는 경우, 상기 (a) 단계에서 처리한 후보물질을 BK 바이러스 신병증 치료제로 판단하는 단계를 추가로 포함할 수 있다.According to another preferred embodiment of the present invention, the screening method is (c) measured in step (b), hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa If the expression level of one or more miRNA genes selected from the group consisting of -miR-514a-3p and hsa-miR-125b-5p is more suppressed in the sample not treated with the candidate substance, the treatment in step (a) above A step of determining the candidate substance as a therapeutic agent for BK virus nephropathy may be further included.

본 발명에 따른 다양한 조합의 miRNA 유전자를 포함하는 바이오마커 조성물은 BK 바이러스 신병증을 진단할 수 있을 뿐만 아니라, BK 바이러스 신병증을 신장이식 거부반응, 예를 들어, 항체 매개성 거부반응, T 세포 매개성 거부반응 및/또는 이들 모두가 복합적으로 나타나는 혼합 거부반응과 구분하여 진단하는 것이 가능하여, 환자 맞춤별 치료방법을 제공함으로써 신장이식 후에 나타나는 다양한 증상을 원인에 따라 효과적으로 치료할 수 있다.The biomarker composition containing various combinations of miRNA genes according to the present invention can not only diagnose BK virus nephropathy, but also treat BK virus nephropathy by renal transplant rejection, eg, antibody-mediated rejection, T cell It is possible to differentiate and diagnose mediated rejection and/or mixed rejection in which all of them appear in combination, so that various symptoms after kidney transplantation can be effectively treated according to the cause by providing a customized treatment method for each patient.

도 1은 항체 매개성 거부반응군 (ABMR), T 세포 매개성 거부반응군 (TCMR) 및 BK 바이러스 신병증군 (BKVN)을 대표하는 바이오마커의 선발 과정을 나타낸 모식도로 나타낸 것이다.
도 2는 중요 데이터에 대하여, 발현 수준이 유사한 샘플 및 성숙 miRNA를 그룹화하는 계층적 군집 분석 (유리클리드 방법, 완전 연관)을 수행하고, 이를 히트맵으로 나타낸 것이다.
도 3은 1차 및 2차 선별 과정을 통해 선별된 miRNA 유전자를 나타낸 것으로, 도 3(A)는 정상 대조군 (NOMOA)을 기준으로 발현이 2배 이상 증가한 miRNA 유전자는 빨간색으로 표시하였고, 정상 대조군 (NOMOA)을 기준으로 발현이 2배 이상 감소한 miRNA 유전자는 녹색으로 표시하여 나타낸 것이고, 도 3(B)는 정상 대조군 (NOMOA)과 비교하여 각각 항체 매개성 거부반응군 (ABMR), T 세포 매개성 거부반응군 (TCMR) 및 BK 바이러스 신병증군 (BKVN)에서 발현 수준이 2배 이상 차이나는 상향 조절된 miRNA 유전자를 확인한 결과를 나타낸 것이다.
도 4(A)는 항체 매개성 거부반응군 (ABMR)의 바이오마커 후보 중, 항체 매개성 거부반응군 (TCMR) 및 BK 바이러스 신병증군 (BKVN)과 비교하여 현저한 발현 양상의 차이를 보이는 5종의 miRNA 유전자를 나타낸 것이고, 도 4(B)는 상기 5종의 miRNA 유전자가 정상 대조군 (NOMOA) 대비 항체 매개성 거부반응군 (ABMR)에서 2배 이상 증가된 발현 수준을 나타낸다는 것을 보여주는 그래프이다.
도 5(A)는 T 세포 매개성 거부반응군 (TCMR)의 바이오마커 후보 중, 항체 매개성 거부반응군 (ABMR) 및 BK 바이러스 신병증군 (BKVN)과 비교하여 현저한 발현 양상의 차이를 보이는 5종의 miRNA 유전자를 나타낸 것이고, 도 5(B)는 상기 5종의 miRNA 유전자가 정상 대조군 (NOMOA) 대비 T 세포 매개성 거부반응군 (TCMR)에서 2배 이상 증가된 발현 수준을 나타낸다는 것을 보여주는 그래프이다.
도 6(A)는 BK 바이러스 신병증군 (TCMR)의 바이오마커 후보 중, 항체 매개성 거부반응군 (ABMR) 및 T 세포 매개성 거부반응군 (TCMR)과 비교하여 현저한 발현 양상의 차이를 보이는 5종의 miRNA 유전자를 나타낸 것이고, 도 6(B)는 상기 5종의 miRNA 유전자가 정상 대조군 (NOMOA) 대비 BK 바이러스 신병증군 (TCMR)에서 2배 이상 증가된 발현 수준을 나타낸다는 것을 보여주는 그래프이다.
도 7은 통계분석 후 정상 대조군(NOMOA)과 비교하여 항체 매개성 거부반응군(ABMR), T 세포 매개성 거부반응군(TCMR) 및 BK 바이러스 신병증군(BKVN)에서 각각 다른 군과 유의적으로 상이하게 발현되는 소변 엑소좀 miRNA 유전자를 확인하여 벤다이어그램으로 나타낸 것이다.1 is a schematic diagram showing the selection process of biomarkers representing antibody-mediated rejection group (ABMR), T cell-mediated rejection group (TCMR), and BK virus nephropathy group (BKVN).
Figure 2 is a heat map after performing hierarchical clustering analysis (Euriclid method, complete association) to group samples and mature miRNAs with similar expression levels for important data.
Figure 3 shows the miRNA genes selected through the primary and secondary selection processes. In Figure 3 (A), miRNA genes whose expression increased by more than 2-fold based on the normal control group (NOMOA) are marked in red, and the normal control group (NOMOA), miRNA genes whose expression has decreased by more than 2 times are shown in green, and FIG. 3 (B) shows antibody-mediated rejection group (ABMR) and T cell-mediated rejection compared to normal control group (NOMOA), respectively. It shows the result of confirming the up-regulated miRNA gene whose expression level is more than 2-fold different in the sexual rejection group (TCMR) and the BK virus nephropathy group (BKVN).
Figure 4 (A) is a biomarker candidate of the antibody-mediated rejection group (ABMR), compared to the antibody-mediated rejection group (TCMR) and the BK virus nephropathy group (BKVN), five species showing a significant difference in expression pattern , and FIG. 4(B) is a graph showing that the expression level of the 5 miRNA genes is increased by more than 2 times in the antibody-mediated rejection group (ABMR) compared to the normal control group (NOMOA). .
Figure 5 (A) is a biomarker candidate of the T cell-mediated rejection group (TCMR), compared to the antibody-mediated rejection group (ABMR) and the BK virus nephropathy group (BKVN), showing a significant difference in expression patterns. Figure 5(B) shows the miRNA genes of the species, and Figure 5 (B) shows that the expression level of the 5 miRNA genes is increased by more than 2 times in the T cell-mediated rejection group (TCMR) compared to the normal control group (NOMOA). it's a graph
Figure 6 (A) is a biomarker candidate of the BK virus nephropathy group (TCMR), compared to the antibody-mediated rejection group (ABMR) and the T cell-mediated rejection group (TCMR), showing a significant difference in expression patterns. 6(B) is a graph showing that the expression level of the 5 miRNA genes is increased by more than 2 times in the BK virus nephropathy group (TCMR) compared to the normal control group (NOMOA).
Figure 7 shows that the antibody-mediated rejection group (ABMR), the T cell-mediated rejection group (TCMR), and the BK virus nephropathy group (BKVN) were significantly different from each other in comparison to the normal control group (NOMOA) after statistical analysis. Differently expressed urinary exosome miRNA genes were confirmed and shown in a Venn diagram.

상술한 바와 같이, 신장이식 환자에서 나타나는 BK 바이러스 신병증의 조직학적 특성은 급성 거부반응과 비슷하여 생체검사를 통한 BK 바이러스 신병증의 진단은 정확도가 떨어지는 단점이 있었다. 이에, 본 발명자들은 신장이식 후 BK 바이러스 신병증을 진단할 수 있는 miRNA 유전자 바이오마커 및/또는 BK 바이러스 신병증을 신장이식 거부반응과 구분하여 진단할 수 있는 miRNA 유전자 바이오마커를 제공함으로써 상술한 문제의 해결방안을 모색하였다. 본 발명에 따른 다양한 조합의 miRNA 유전자를 포함하는 바이오마커 조성물은 BK 바이러스 신병증을 진단할 수 있을 뿐만 아니라, BK 바이러스 신병증을 신장이식 거부반응, 예를 들어, 항체 매개성 거부반응, T 세포 매개성 거부반응 및/또는 이들 모두가 복합적으로 나타나는 혼합 거부반응과 구분하여 진단하는 것이 가능하여, 환자 맞춤별 치료방법을 제공함으로써 신장이식 후에 나타나는 다양한 증상을 원인에 따라 효과적으로 치료할 수 있다.As described above, the histological characteristics of BK virus nephropathy in kidney transplant patients are similar to acute rejection, so the diagnosis of BK virus nephropathy through biopsy has a disadvantage of low accuracy. Therefore, the present inventors provide a miRNA gene biomarker capable of diagnosing BK virus nephropathy after kidney transplantation and/or a miRNA gene biomarker capable of diagnosing BK virus nephropathy by distinguishing it from renal transplant rejection. searched for a solution. The biomarker composition containing various combinations of miRNA genes according to the present invention can not only diagnose BK virus nephropathy, but also treat BK virus nephropathy by renal transplant rejection, eg, antibody-mediated rejection, T cell It is possible to differentiate and diagnose mediated rejection and/or mixed rejection in which all of them appear in combination, so that various symptoms after kidney transplantation can be effectively treated according to the cause by providing a customized treatment method for each patient.

이하, 본 발명을 보다 상세히 설명한다.Hereinafter, the present invention will be described in more detail.

본 발명에서 사용되는 모든 기술용어는, 달리 정의되지 않는 이상, 본 발명의 관련 분야에서 통상의 당업자가 일반적으로 이해하는 바와 같은 의미로 사용된다. 또한 본 명세서에는 바람직한 방법이나 시료가 기재되나, 이와 유사하거나 동등한 것들도 본 발명의 범주에 포함된다.All technical terms used in the present invention, unless defined otherwise, are used with the same meaning as commonly understood by one of ordinary skill in the art related to the present invention. In addition, although preferred methods or samples are described in this specification, those similar or equivalent thereto are also included in the scope of the present invention.

본 발명의 제1 양태는 hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자를 포함하는, BK 바이러스 신병증 (BK virus nephropathy)을 진단하기 위한 바이오마커 조성물에 관한 것이다.The first aspect of the present invention is hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p , from the group consisting of hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p It relates to a biomarker composition for diagnosing BK virus nephropathy, including one or more selected miRNA genes.

상기 12종의 miRNA 유전자 바이오마커에 대한 정보는 표 1과 같다.Information on the 12 miRNA gene biomarkers is shown in Table 1.

성숙 miRNA 유전자mature miRNA genes 서열order 서열번호sequence number Accession NumberAccession Number hsa-miR-8485hsa-miR-8485 CACACACACACACACACGUAUCACACACACACACACACGUAU 99 MIMAT0033692MIMAT0033692 hsa-miR-221-3phsa-miR-221-3p AGCUACAUUGUCUGCUGGGUUUCAGCUACAUUGUCUGCUGGGUUUC 1010 MIMAT0000278MIMAT0000278 hsa-miR-331-3phsa-miR-331-3p GCCCCUGGGCCUAUCCUAGAAGCCCCUGGGCCUAUCCUAGAA 77 MIMAT0000760MIMAT0000760 hsa-miR-1290hsa-miR-1290 UGGAUUUUUGGAUCAGGGAUGGAUUUUUGGAUCAGGGA 88 MIMAT0005880MIMAT0005880 hsa-miR-19b-3phsa-miR-19b-3p UGUGCAAAUCCAUGCAAAACUGAUGUGCAAAUCCAUGCAAAACUGA 1616 MIMAT0000074MIMAT0000074 hsa-miR-31-5phsa-miR-31-5p AGGCAAGAUGCUGGCAUAGCUAGGCAAGAUGCUGGCAUAGCU 1717 MIMAT0000089MIMAT0000089 hsa-miR-17-5phsa-miR-17-5p CAAAGUGCUUACAGUGCAGGUAGCAAAGUGCUUACAGUGCAGGUAG 1818 MIMAT0000070MIMAT0000070 hsa-miR-205-5phsa-miR-205-5p UCCUUCAUUCCACCGGAGUCUGUCCUUCAUUCCACCGGAGUCUG 1919 MIMAT0000266MIMAT0000266 hsa-miR-4449hsa-miR-4449 CGUCCCGGGGCUGCGCGAGGCACGUCCCGGGGCUGCGCGAGGCA 2020 MIMAT0018968MIMAT0018968 hsa-miR-106a-5phsa-miR-106a-5p AAAAGUGCUUACAGUGCAGGUAGAAAAGUGCUUACAGUGCAGGUAG 2121 MIMAT0000103MIMAT0000103 hsa-miR-514a-3phsa-miR-514a-3p AUUGACACUUCUGUGAGUAGAAUUGACACUUCUGUGAGUAGA 2222 MIMAT0002883MIMAT0002883 hsa-miR-125b-5phsa-miR-125b-5p UCCCUGAGACCCUAACUUGUGAUCCCUGAGACCCUAACUUGUGA 2323 MIMAT0000423MIMAT0000423

본 발명에서, 용어 “miRNA”는 특별히 언급하지 않는 한, 헤어핀 모양 구조의 RNA 전구체로서 전사되고, RNase III 절단 활성을 갖는 dsRNA 절단 효소에 의해 절단되어 RISC라고 칭하는 단백질 복합체에 도입되고, mRNA의 번역 억제에 관여하는 15~25염기의 비코딩 RNA를 의도하여 사용된다. 또한, 본 발명에서 사용하는 miRNA는 특정 염기서열(또는 서열번호)로 나타내어지는 miRNA뿐만 아니라 상기 miRNA의 전구체(pre-miRNA, primiRNA), 이들과 생물학적 기능이 동등한 miRNA, 예를 들면 동족체(즉, 호몰로그 또는 오솔로그), 유전자다형 등의 변이체, 및 유도체도 포함한다. 이러한 전구체, 동족체, 변이체 또는 유도체로서는 구체적으로는 miRBase release 20(http://www.mirbase.org/)에 의해 동정할 수 있고, 엄격한 조건 하에서 miRNA의 상보서열과 혼성화되는 염기서열을 갖는 miRNA를 들 수 있다. 또한, 본 발명에 언급된 miRNA는 miR 유전자의 유전자산물일 수 있고, 그러한 유전자산물은 성숙 miRNA(예를 들면, 상기와 같은 mRNA의 번역 억제에 관여하는 15~25염기 또는 19~25염기의 비코딩 RNA) 또는 miRNA 전구체(예를 들면, 상기와 같은 pre-miRNA 또는 pri-miRNA)를 포함한다.In the present invention, the term “miRNA”, unless otherwise specified, is transcribed as an RNA precursor of a hairpin-like structure, cleaved by a dsRNA cleavage enzyme having RNase III cleavage activity, introduced into a protein complex called RISC, and translated into mRNA. Non-coding RNA of 15 to 25 bases involved in inhibition is intended and used. In addition, the miRNA used in the present invention is not only miRNA represented by a specific nucleotide sequence (or sequence number), but also precursors (pre-miRNA, primiRNA) of the miRNA, and miRNAs with biological functions equivalent to these, such as homologues (i.e., homologs or orthologs), variants such as polymorphisms, and derivatives. These precursors, homologues, mutants or derivatives can be specifically identified by miRBase release 20 (http://www.mirbase.org/), and miRNAs having base sequences that hybridize with the complementary sequences of miRNAs under stringent conditions. can be heard In addition, the miRNA mentioned in the present invention may be a gene product of a miR gene, and such a gene product is a mature miRNA (eg, a ratio of 15 to 25 bases or 19 to 25 bases involved in translational inhibition of mRNA as described above). coding RNA) or miRNA precursors (eg, pre-miRNA or pri-miRNA as above).

본 발명에서, 용어“핵산”이란 RNA, DNA, 및 RNA/DNA(키메라) 모두 포함하는 핵산에 대하여 사용된다. 또한, 상기 DNA에는 cDNA, 게놈DNA, 및 합성DNA 모두가 포함된다. 또한, 상기 RNA에는 total RNA, mRNA, rRNA, miRNA, siRNA, snoRNA, snRNA, 비코딩(non-coding)RNA 및 합성RNA 모두가 포함된다. 본 발명에 있어서 “합성DNA” 및 “합성RNA”는 소정의 염기서열(천연형 서열 또는 비천연형 서열 중 어느 것이어도 좋음)에 의거하여, 예를 들면 자동핵산 합성기를 사용하여 인공적으로 제작된 DNA 및 RNA를 말한다. 본 발명에 있어서 “비천연형 서열”은 광의의 의미로 사용하는 것을 의도하고 있고, 천연형 서열과 상이한, 예를 들면 1 이상의 뉴클레오티드의 치환, 결실, 삽입 및/또는 부가를 포함하는 서열(즉, 변이 서열), 1 이상의 수식 뉴클레오티드를 포함하는 서열(즉, 수식 서열) 등을 포함한다. 또한, 본 발명에서는 폴리뉴클레오티드는 핵산과 호환적으로 사용된다.In the present invention, the term “nucleic acid” is used for nucleic acids including both RNA, DNA, and RNA/DNA (chimera). In addition, the DNA includes all of cDNA, genomic DNA, and synthetic DNA. In addition, the RNA includes all of total RNA, mRNA, rRNA, miRNA, siRNA, snoRNA, snRNA, non-coding RNA and synthetic RNA. In the present invention, "synthetic DNA" and "synthetic RNA" are artificially produced based on a predetermined base sequence (either a natural sequence or a non-natural sequence), for example, using an automatic nucleic acid synthesizer. refers to DNA and RNA. In the present invention, "non-natural sequence" is intended to be used in a broad sense, and is different from the natural sequence, for example, a sequence containing substitution, deletion, insertion and / or addition of one or more nucleotides (i.e., , variant sequences), sequences comprising one or more modified nucleotides (ie, modified sequences), and the like. Also, in the present invention, polynucleotides are used interchangeably with nucleic acids.

본 발명에서 용어 "신장이식 거부반응(renal allograft rejection)"은 공여자의 신장을 이식받은 수여자의 면역 체계가 이식된 신장을 외부 항원으로 인식하여 일어나는 일련의 면역 반응을 의미하며, 발생기전과 신생검 소견에 따라 항체-매개성 거부반응(Antibody mediated rejection, ABMR), T 세포 매개성 거부반응(T cell mediated rejection, TCMR), 및 이들 모두가 복합적으로 나타나는 혼합 거부반응(mixed rejection)으로 분류될 수 있다.In the present invention, the term "renal allograft rejection" refers to a series of immune reactions that occur when the recipient's immune system recognizes the transplanted kidney as a foreign antigen, and the mechanism of development and renal biopsy Depending on the findings, it can be classified into antibody-mediated rejection (ABMR), T cell mediated rejection (TCMR), and mixed rejection in which all of these appear in combination. there is.

본 발명에서 상기 신장이식의 거부반응은 항체 매개성 거부반응, T 세포 매개성 거부반응 및 혼합 거부반응을 모두 포함할 수 있으며, 바람직하게는 급성 T 세포 매개 거부 반응(Acute T cell mediated rejection, TCMR), 만성 항체-매개 거부반응(chronic antibody mediated rejection, CAMR), 활성형 항체-매개 거부반응(active antibody mediated rejection), 만성 활성형 T 세포 매개 거부반응(chronic active T cell mediated rejection) 및 혼합 거부반응(mixed rejection)으로 이루어진 군에서 선택될 수 있다.In the present invention, the rejection of the kidney transplant may include antibody-mediated rejection, T cell-mediated rejection, and mixed rejection, and preferably acute T cell mediated rejection (TCMR) ), chronic antibody mediated rejection (CAMR), active antibody mediated rejection, chronic active T cell mediated rejection and mixed rejection It may be selected from the group consisting of reaction (mixed rejection).

본 발명의 용어 "바이오마커"는 생물학적 현상의 존재와 정량적 또는 정성적으로 연관된 분자를 의미하며, 본 발명의 바이오마커는 신장이식 후 거부반응이 나타나는지 또는 BK 바이러스 신병증이 나타나는지 확인할 수 있는 miRNA 유전자 또는 신장이식 후 예후가 양호하거나 불량한 환자를 예측해내는 기준이 되는 유전자를 지칭한다. 이 용어는 마커 서열에 상보적이거나 이에 플랭킹된 핵산 서열, 예컨대 마커 서열을 증폭시킬 수 있는 프로브 또는 프라이머 쌍으로 사용된 핵산을 포함한다.The term "biomarker" of the present invention refers to a molecule quantitatively or qualitatively associated with the presence of a biological phenomenon, and the biomarker of the present invention is a miRNA gene that can determine whether rejection or BK virus nephropathy appears after kidney transplantation. Or, it refers to a gene that serves as a standard for predicting patients with good or poor prognosis after kidney transplantation. The term includes nucleic acid sequences complementary to or flanking a marker sequence, such as nucleic acids used as probes or primer pairs capable of amplifying the marker sequence.

본 발명에 있어서, 용어 "예후"는 의학적 귀추(예컨대, 장기 생존 가능성, 무병생존율 등)에 대한 예상을 의미하며, 양성적 예후(긍정적 예후) 또는 음성적 예후(부정적 또는 불량한 예후)를 포함하며, 본 발명에서 상기 음성적 예후는 신장이식 후에 나타나는 다양한 거부반응 또는 질환이 발생하는 것을 포함하고, 양성적 예후는 신장이식 후 거부반응 또는 질환이 발생하지 않는 것을 의미한다.In the present invention, the term "prognosis" means the prediction of medical outcomes (eg, long-term viability, disease-free survival rate, etc.), and includes positive prognosis (positive prognosis) or negative prognosis (negative or poor prognosis), In the present invention, the negative prognosis includes the occurrence of various rejection reactions or diseases after kidney transplantation, and the positive prognosis means that rejection reactions or diseases do not occur after kidney transplantation.

본 발명에 있어서, 용어 "예측"은 의학적 귀추에 대하여 미리 헤아려 짐작하는 것을 의미하며, 본 발명의 목적상 신장이식을 받은 환자의 반응(다양한 신장이식 거부반응, BK 바이러스 감염성 질환 등의 발병 등)을 미리 짐작하는 것을 의미한다.In the present invention, the term "prediction" means to guess in advance about medical consequences, and for the purpose of the present invention, the response of a patient who has received a kidney transplant (various kidney transplant rejection, onset of BK virus infectious disease, etc.) means to guess in advance.

본 발명자들은 신장이식 환자들 중에서 조직검사 상 이상소견이 없는 정상 대조군(no major abnormality, NOMOA)과 비교하여 BK 바이러스 신병증 (BKVN)을 나타내는 환자의 소변에서 전술한 12종의 miRNA 유전자 발현이 2배 이상 증가하며, 통계분석 결과 p-value 값이 0.05 이하로 유의성을 나타내므로, 이들 miRNA 유전자 바이오마커를 BK 바이러스 신병증의 진단 마커로서 활용할 수 있음을 알 수 있었다.Among renal transplant patients, the present inventors found that the expression of the above-mentioned 12 miRNA genes in the urine of patients with BK virus nephropathy (BKVN) was higher than that of a normal control group (no major abnormality, NOMOA) with no abnormal findings on biopsy among renal transplant patients. increased more than twice, and as a result of statistical analysis, the p-value value was less than 0.05, indicating significance, indicating that these miRNA gene biomarkers can be used as diagnostic markers for BK virus nephropathy.

제1 양태와 관련하여, 본 발명은 hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준을 측정하는 제제를 포함하는, BK 바이러스 신병증을 진단하기 위한 조성물 및 이를 포함하는 키트를 제공한다.Regarding the first aspect, the present invention provides hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR- 31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p A composition for diagnosing BK virus nephropathy, including an agent for measuring the expression level of any one or more miRNA genes selected from the group consisting of, and a kit including the same are provided.

본 발명에서 용어 "프라이머"는 짧은 자유 3 말단 수산화기(free 3` hydroxyl group)을 가지는 핵산 서열로 상보적인 주형(template)과 염기쌍(base pair)을 형성할 수 있고 주형의 복사를 위한 시작지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 본 발명에서는 miRNA 유전자의 센스 및 안티센스 프라이머를 이용하여 PCR 증폭을 실시하여 원하는 생성물의 생성 여부를 통해 신장이식의 거부반응 또는 BK 바이러스 신병증을 진단하거나 예후를 예측할 수 있다. PCR 조건, 센스 및 안티센스 프라이머의 길이는 당업계에 공지된 것을 기초로 변형할 수 있다. 본 발명에서, 상기 유전자의 mRNA 증폭에 사용되는 프라이머는, 적절한 버퍼 중의 적절한 조건(예를 들면, 4개의 다른 뉴클레오시드 트리포스페이트 및 DNA, RNA 폴리머라제 또는 역전사 효소와 같은 중합제) 및 적당한 온도 하에서 주형-지시 DNA 합성의 시작점으로서 작용할 수 있는 단일가닥 올리고뉴클레오티드가 될 수 있는데, 상기 프라이머의 적절한 길이는 사용 목적에 따라 달라질 수 있다. 상기 프라이머 서열은 miRNA 유전자 바이오마커의 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드와 완전하게 상보적일 필요는 없으며, 혼성화할 정도로 충분히 상보적이면 사용가능하다.In the present invention, the term "primer" is a nucleic acid sequence having a short free 3' hydroxyl group, which can form a base pair with a complementary template and serves as a starting point for copying the template. It refers to a short nucleic acid sequence that functions. In the present invention, PCR amplification is performed using sense and antisense primers of the miRNA gene, and the rejection of kidney transplantation or BK virus nephropathy can be diagnosed or the prognosis can be predicted through whether or not a desired product is produced. PCR conditions and lengths of sense and antisense primers can be modified based on those known in the art. In the present invention, the primers used for mRNA amplification of the gene are prepared under appropriate conditions (eg, four different nucleoside triphosphates and a polymerizing agent such as DNA, RNA polymerase or reverse transcriptase) in an appropriate buffer and at an appropriate temperature. It can be a single-stranded oligonucleotide that can serve as a starting point for template-directed DNA synthesis under the following conditions, and the appropriate length of the primer may vary depending on the purpose of use. The primer sequence does not have to be completely complementary to the polynucleotide of the miRNA gene biomarker or its complementary polynucleotide, and can be used as long as it is sufficiently complementary to hybridize.

본 발명에서 용어, "프로브(probe)" 란 mRNA와 특이적 결합을 이룰 수 있는 짧게는 수 염기 내지 길게는 수백 염기에 해당하는 RNA 또는 DNA 등의 핵산 단편을 의미하며, 표지(labeling)되어 있어서 특정 mRNA의 존재 유무를 확인할 수 있다. 프로브는 올리고 뉴클레오티드 프로브, 단일 사슬 DNA(single stranded DNA) 프로브, 이중사슬 DNA(double stranded DNA) 프로브, RNA 프로브 등의 형태로 제작될 수 있다. 본 발명에서는 miRNA 유전자와 상보적인 프로브를 이용하여 혼성화를 실시하여, 혼성화 여부를 통해 신장이식의 거부반응을 진단 또는 예후를 예측할 수 있다. 적당한 프로브의 선택 및 혼성화 조건은 당업계에 공지된 것을 기초로 변형할 수 있다.In the present invention, the term "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to a few bases to several hundreds of bases as short as possible to achieve specific binding with mRNA, and is labeled. The presence or absence of a specific mRNA can be confirmed. The probe may be manufactured in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like. In the present invention, hybridization is performed using a miRNA gene and a complementary probe, and the rejection of kidney transplantation can be diagnosed or the prognosis can be predicted through hybridization. Selection of suitable probes and hybridization conditions can be modified based on those known in the art.

본 발명의 프라이머 또는 프로브는 포스포르아미다이트 고체 지지체 방법 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비-제한적인 예로는 메틸화, 캡화, 천연 뉴클레오티드 하나 이상의 동족체로의 치환, 및 뉴클레오티드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다.Primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method or other well-known methods. Such nucleic acid sequences can also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, capping, substitution of one or more natural nucleotides with homologues, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phosphotriesters, phosphoro amidates, carbamates, etc.) or to charged linkages (eg phosphorothioates, phosphorodithioates, etc.).

본 발명에서 이용되는 miRNA 유전자의 발현 수준을 측정하는 제제의 염기서열은, 생물학적으로 균등 활성을 갖는 변이를 고려한다면, miRNA 유전자에 특이적으로 결합하는 서열과 실질적인 동일성(substantial identity)을 나타내는 서열도 포함하는 것으로 해석된다. 상기 용어, '실질적인 동일성'은 특정 서열을과 임의의 다른 서열을 최대한 대응되도록 얼라인(align)하고, 당업계에서 통상적으로 이용되는 알고리즘을 이용하여 얼라인된 서열을 분석한 경우에, 최소 60%의 동일성, 더욱 구체적으로 70%의 동일성, 더더욱 구체적으로 80%의 동일성, 가장 구체적으로 90%의 동일성을 나타내는 서열을 의미한다.The nucleotide sequence of the agent for measuring the expression level of the miRNA gene used in the present invention is also a sequence showing substantial identity with a sequence that specifically binds to the miRNA gene, considering mutations with biologically equivalent activity. be interpreted as including The term 'substantial identity' means that when a specific sequence and any other sequence are aligned so as to correspond as much as possible, and the aligned sequence is analyzed using an algorithm commonly used in the art, at least 60 % identity, more specifically 70% identity, even more specifically 80% identity, and most specifically 90% identity.

본 발명의 키트는 정량적 실시간 PCR (qRT-PCR)과 같은 실시간 PCR (RT-PCR) 키트, 마이크로어레이 키트 또는 SAGE (Serial Analysis of Gene Expression) 키트일 수 있으나, 이에 제한되는 것은 아니다. 구체적인 예로, 상기 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. 예를 들어, RT-PCR 키트는, miRNA 유전자에 대한 특이적인 각각의 프라이머 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 디옥시뉴클레오타이드(dNTPs), 디디옥시뉴클레오타이드(ddNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNase, RNAse 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다. 또한, 정량 대조군으로 사용되는 DNA, RNA 또는 miRNA에 특이적인 프라이머 쌍을 포함할 수 있다.The kit of the present invention may be a real-time PCR (RT-PCR) kit such as quantitative real-time PCR (qRT-PCR), a microarray kit, or a Serial Analysis of Gene Expression (SAGE) kit, but is not limited thereto. As a specific example, the kit may be a kit including essential elements required to perform RT-PCR. For example, the RT-PCR kit contains, in addition to each primer specific for the miRNA gene, a test tube or other suitable container, a reaction buffer (with varying pH and magnesium concentration), deoxynucleotides (dNTPs), and dideoxynucleotides (ddNTPs). ), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like. In addition, a primer pair specific to DNA, RNA or miRNA used as a quantitative control may be included.

본 발명의 키트에는 체액, 세포 또는 조직으로부터 핵산(예를 들면, total RNA)을 추출하기 위한 키트, 표지용 형광물질, 핵산 증폭용 효소 및 배지, 사용 설명서 등을 포함시킬 수 있다.The kit of the present invention may include a kit for extracting nucleic acid (eg, total RNA) from body fluids, cells or tissues, a fluorescent material for labeling, an enzyme and medium for amplifying nucleic acid, instructions for use, and the like.

본 발명의 키트는 상기 핵산이, 예를 들면 고상에 결합 또는 부착된 파킨슨병 마커 측정을 위한 디바이스이다. 고상의 재질의 예는 플라스틱, 종이, 유리, 실리콘 등이며, 가공의 용이함으로부터 바람직한 고상의 재질은 플라스틱이다. 고상의 형상은 임의이며, 예를 들면 사각형, 원형, 직사각형, 필름형 등이다.The kit of the present invention is a device for measuring a Parkinson's disease marker in which the nucleic acid is bound or attached to, for example, a solid phase. Examples of the material of the solid phase are plastic, paper, glass, silicon, and the like, and a material of the solid phase preferable from the viewpoint of ease of processing is plastic. The shape of the solid phase is arbitrary, and is, for example, square, circular, rectangular, or film-like.

본 발명의 키트는 상기 miRNA의 적어도 1개와 특이적으로 결합 가능한 핵산을 포함할 수 있다.The kit of the present invention may contain a nucleic acid capable of specifically binding to at least one of the miRNAs.

제1 양태와 관련하여, 본 발명은 또한 다음의 단계를 포함하는 BK 바이러스 신병증의 진단을 위한 정보제공방법을 제공한다:Regarding the first aspect, the present invention also provides an information providing method for diagnosing BK virus nephropathy, comprising the following steps:

본 발명의 정보제공방법에 있어서, 용어 "개체"는 신장이식 거부반응이 나타나거나 BK 바이러스 신병증이 발병될 가능성이 있거나 또는 발병된 인간, 침팬지를 포함한 영장류, 개, 고양이 등의 애완동물, 소, 말, 양, 염소 등의 가축동물, 마우스, 래트 등의 설치 류 등의 포유동물을 포함하는 의미로 해석된다.In the information provision method of the present invention, the term "subject" refers to humans who are likely or have developed kidney transplant rejection or BK virus nephropathy, primates including chimpanzees, pets such as dogs and cats, and cows. , It is interpreted as meaning including livestock animals such as horses, sheep, and goats, and mammals such as rodents such as mice and rats.

본 발명의 정보제공방법에 있어서, 분석을 위해 사용되는 "시료"는 혈액, 혈장, 혈청, 타액, 비액, 객담, 복수, 질 분비물, 소변, 대변 등 정상적인 상태와 구별될 수 있는 신장이식 거부반응 또는 BK 바이러스 신병증에 특이적인 miRNA 유전자를 확인할 수 있는 생체 시료를 포함한다. 바람직하게는 생물학적 액체 시료, 예를 들어 혈액, 혈청, 혈장 또는 소변일 수 있으며, 가장 바람직하게는 소변 또는 소변 유래 엑소좀일 수 있다.In the information provision method of the present invention, the "sample" used for analysis is blood, plasma, serum, saliva, nasal fluid, sputum, ascites, vaginal secretion, urine, feces, etc. Kidney transplant rejection that can be distinguished from normal conditions or a biological sample capable of confirming miRNA genes specific to BK virus nephropathy. Preferably, it may be a biological liquid sample such as blood, serum, plasma or urine, and most preferably urine or urine-derived exosomes.

본 발명에서 용어 "엑소좀"은 세포에서 유래된 지질 이중층의 소낭(vesicle)을 의미한다. 엑소좀은 세포 또는 조직으로부터 유래한 고유의 단백질 및 핵산 등을 포함하고 있으며, 다양한 질환의 진단 등에 사용될 수 있는 RNA, miRNA 등의 바이오마커가 다량 포함되어 있다.In the present invention, the term "exosome" means a cell-derived lipid bilayer vesicle. Exosomes contain unique proteins and nucleic acids derived from cells or tissues, and contain a large amount of biomarkers such as RNA and miRNA that can be used for diagnosis of various diseases.

본 발명의 정보제공방법은 공지된 다양한 시험방법을 사용할 수 있으며, 예를 들어, 혼성화법, 면역분석(immunoassay) 방법 또는 유전자 증폭방법을 이용하여 실시할 수 있고 이에 한정되는 것은 아니다.The information providing method of the present invention may use a variety of well-known test methods, and may be performed using, for example, a hybridization method, an immunoassay method, or a gene amplification method, but is not limited thereto.

상기 혼성화법은 프로브를 이용하여 miRNA의 존재를 확인하는 것일 수 있다.The hybridization method may be to confirm the presence of miRNA using a probe.

본 발명의 정보제공방법이 혼성화 방식 중 마이크로어레이 방식으로 실시되는 경우, 상기한 프로브는 혼성화 어레이 요소(hybridizable array element)로서 이용되며, 기질(substrate) 상에 고정화 된다. 바람직한 기질은 견고성 또는 반-견고성 지지체로서, 예컨대, 막, 필터, 칩, 슬라이드, 웨이퍼, 파이버, 자기성 비드 또는 비자기성 비드, 겔, 튜빙, 플레이트, 고분자, 미소입자 및 모세관을 포함한다. 상기 혼성화 어레이 요소는 상기의 기질 상에 배열되고 고정화 된다. 이와 같은 고정화는 화학적 결합 방법 또는 UV와 같은 공유 결합적 방법에 의해 실시된다. 예컨대, 상기 혼성화 어레이 요소는 에폭시 화합물 또는 알데히드기를 포함하도록 변형된 글래스 표면에 결합될 수 있고, 또한 폴리라이신 코팅 표면에서 UV에 의해 결합될 수 있다. 또한, 상기 혼성화 어레이 요소는 링커(예: 에틸렌 글리콜 올리고머 및 디아민)를 통해 기질에 결합될 수 있다.When the information providing method of the present invention is performed in a microarray method among hybridization methods, the above probe is used as a hybridizable array element and is immobilized on a substrate. Preferred substrates include rigid or semi-rigid supports such as membranes, filters, chips, slides, wafers, fibers, magnetic or non-magnetic beads, gels, tubing, plates, polymers, microparticles and capillaries. The hybridization array elements are arranged and immobilized on the substrate. This immobilization is carried out by chemical bonding methods or covalent bonding methods such as UV. For example, the hybridization array element may be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and may also be bonded to a polylysine-coated surface by UV. In addition, the hybridization array element may be coupled to a substrate through a linker (eg, ethylene glycol oligomer and diamine).

한편, 본 발명의 마이크로어레이에 적용되는 시료 DNA는 표지(labeling)될 수 있고, 마이크로어레이상의 어레이 요소와 혼성화된다. 혼성화 조건은 다양하게 변경할 수 있다. 또한, 혼성화 정도의 검출 및 분석은 표지 물질에 따라 다양하게 실시될 수 있다.Meanwhile, sample DNA applied to the microarray of the present invention can be labeled and hybridized with array elements on the microarray. Hybridization conditions can be variously changed. In addition, the degree of hybridization may be detected and analyzed in various ways depending on the labeling substance.

프로브의 표지는 혼성화 여부를 검출케 하는 시그널을 제공할 수 있으며, 이는 올리고뉴클레오타이드에 연결될 수 있다. 적합한 표지는 형광단(예컨대, 플루오리신(fluorescein), 피코에리트린(phycoerythrin), 로다민, 리사민(lissamine), 그리고 Cy3와 Cy5(Pharmacia)), TdT(terminal deoxynucleotidyl transferase), 발색단, 화학발광단, 자기입자, 방사능동위원소(P32 또는 S35), 매스 표지, 전자밀집입자, 효소(알칼린 포스파타아제 또는 호스래디쉬 퍼옥시다아제), 조인자, 효소에 대한 기질, 중금속(예컨대, 금) 그리고 항체, 스트렙타비딘, 바이오틴, 디곡시게닌과 킬레이팅기와 같은 특정 결합 파트너를 갖는 햅텐을 포함하나, 이에 한정되는 것은 아니다. 표지는 당업계에서 통상적으로 실시되는 다양한 방법, 예컨대, 닉 트랜스레이션(nick translation) 방법, 무작위 프라이밍 방법(Multiprime DNA labelling systems booklet, "Amersham"(1989)) 및 카이네이션 방법(Maxam & Gilbert, Methods in Enzymology, 65:499(1986))을 통해 실시될 수 있다. 표지는 형광, 방사능, 발색 측정, 중량 측정, X-선 회절 또는 흡수, 자기, 효소적 활성, 매스 분석, 결합 친화도, 혼성화 고주파, 나노크리스탈에 의하여 검출할 수 있는 시그널을 제공한다.The label of the probe may provide a signal allowing detection of hybridization, which may be linked to an oligonucleotide. Suitable labels include fluorophores (e.g., fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia)), terminal deoxynucleotidyl transferase (TdT), chromophores, chemiluminescent provided, however, that magnetic particles, radioactive isotopes (P32 or S35), mass labels, electron dense particles, enzymes (alkaline phosphatase or horseradish peroxidase), cofactors, substrates for enzymes, heavy metals (e.g., gold), and Antibodies, streptavidin, biotin, digoxigenin and haptens with specific binding partners such as chelating groups, but are not limited thereto. Labeling is performed by various methods commonly practiced in the art, such as the nick translation method, the random priming method (Multiprime DNA labeling systems booklet, “Amersham” (1989)), and the kination method (Maxam & Gilbert, Methods in Enzymology, 65:499 (1986)). The label provides a signal that can be detected by fluorescence, radioactivity, chromometry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, hybridization radiofrequency, nanocrystals.

혼성화 방법에서 분석 대상이 되는 핵산 시료는 다양한 생물학적 시료(biosamples)에서 얻은 RNA를 이용하여 제조할 수 있다. 상기 생물학적 시료는, 바람직하게는 장상피세포이다. 프로브 대신에 분석 대상이 되는 cDNA를 표지하여 혼성화 반응-기초 분석을 실시할 수도 있다.Nucleic acid samples to be analyzed in the hybridization method can be prepared using RNA obtained from various biological samples (biosamples). The biological sample is preferably intestinal epithelial cells. Hybridization reaction-based analysis can also be performed by labeling the cDNA to be analyzed instead of the probe.

프로브를 이용하는 경우, 프로브를 cDNA 분자와 혼성화시킨다. 본 발명에서, 적합한 혼성화 조건은 최적화 절차에 의하여 일련의 과정으로 결정될 수 있다. 이런 절차는 연구실에서 사용을 위한 프로토콜을 수립하기 위하여 당업자에 의하여 일련의 과정으로 실시된다. 예를 들어, 온도, 성분의 농도, 혼성화 및 세척 시간, 완충액 성분 및 이들의 pH 및 이온세기 등의 조건은 프로브의 길이 및 GC 양 및 타깃 뉴클레오타이드 서열 등의 다양한 인자에 의존한다. 혼성화를 위한 상세한 조건은 Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001); 및 M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y.(1999)에서 확인할 수 있다.When using a probe, the probe is hybridized with the cDNA molecule. In the present invention, suitable hybridization conditions can be determined in a series of steps by an optimization procedure. This procedure is carried out as a series of procedures by those skilled in the art to establish a protocol for use in the laboratory. For example, conditions such as temperature, concentration of components, hybridization and washing time, buffer components and their pH and ionic strength depend on various factors such as probe length and GC amount and target nucleotide sequence. Detailed conditions for hybridization are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); and M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y. (1999).

혼성화 반응 이후에, 혼성화 반응을 통하여 나오는 혼성화 시그널을 검출한다. 혼성화 시그널은 예컨대, 프로브에 결합된 표지의 종류에 따라 다양한 방법으로 실시할 수 있다. 예를 들어, 프로브가 효소에 의해 표지된 경우, 이 효소의 기질을 혼성화 반응 결과물과 반응시켜 혼성화 여부를 확인할 수 있다. 이용될 수 있는 효소/기질의 조합은, 퍼옥시다아제(예컨대, 호스래디쉬퍼옥시다아제)와 클로로나프톨, 아미노에틸카바졸, 디아미노벤지딘, D-루시페린, 루시게닌(비스-N-메틸아크리디늄 니트레이트), 레소루핀 벤질 에테르, 루미놀, 암플렉스레드 시약(10-아세틸-3,7-디하이드록시페녹사진), HYR(p-phenylenediamine-HCl and pyrocatechol), TMB(tetramethylbenzidine), ABTS(2,2‘-Azine-di[3-ethylbenzthiazoline sulfonate]), o-페닐렌디아민(OPD) 및 나프톨/파이로닌; 알칼린 포스파타아제와 브로모클로로인돌일 포스페이트(BCIP), 니트로 블루 테트라졸리움(NBT), 나프톨-AS-B1-포스페이트(naphthol-AS-B1-phosphate) 및 ECF 기질; 글루코스 옥시다아제와 t-NBT(nitroblue tetrazolium) 및 m-PMS(phenzaine methosulfate) 등이다. 프로브가 금 입자로 표지된 경우에는 실버 나이트레이트를 이용하여 실버 염색 방법으로 검출할 수 있다.After the hybridization reaction, a hybridization signal generated through the hybridization reaction is detected. Hybridization signals can be performed in various ways depending on the type of label attached to the probe, for example. For example, when a probe is labeled by an enzyme, hybridization can be confirmed by reacting a substrate of the enzyme with a hybridization reaction product. Enzyme/substrate combinations that can be used include peroxidases (e.g., horseradish peroxidase) with chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium nitrate). rate), resorufin benzyl ether, luminol, amplex red reagent (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2, 2'-Azine-di[3-ethylbenzthiazoline sulfonate]), o-phenylenediamine (OPD) and naphthol/pyronine; alkaline phosphatase with bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol-AS-B1-phosphate and ECF substrate; These include glucose oxidase, t-NBT (nitroblue tetrazolium), and m-PMS (phenzaine methosulfate). When the probe is labeled with gold particles, it can be detected by a silver staining method using silver nitrate.

생물학적 시료에서 상기 miRNA의 서열에 대한 혼성화 시그널이 정상 시료보다 상향 조절 (up-regulation)되는 경우에는 신장이식 후 BK 바이러스 신병증으로 진단된다.When the hybridization signal to the miRNA sequence in the biological sample is up-regulated compared to the normal sample, BK virus nephropathy is diagnosed after kidney transplantation.

본 발명의 정보제공방법은 면역분석 방법에 의해 실시될 수 있다. 상기 면역분석 방법은 방사능면역분석, 방사능면역침전, 면역침전, ELISA(enzyme-linked immunosorbent assay), 캡처-ELISA, 억제 또는 경재 분석, 샌드위치 분석, 유세포 분석(flow cytometry), 면역형광염색 및 면역친화성 정제를 포함하지만, 이에 한정되는 것은 아니다. 상기 면역분석의 방법은 Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbentassay(ELISA), inMethodsinMolecularBiology, Vol. 1, Walker, J.M. ed., Humana Press, NJ, 1984; 및 Ed Harlow and David Lane, UsingAntibodies:A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999에 기재되어 있으며, 상기 문헌은 본 명세서에 참조로서 삽입된다.The information providing method of the present invention can be performed by an immunoassay method. The immunoassay method includes radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), capture-ELISA, inhibition or hard material assay, sandwich assay, flow cytometry, immunofluorescence staining and immunophile including, but not limited to, chemical tablets. The immunoassay method is Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J.M. ed., Humana Press, NJ, 1984; and Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, incorporated herein by reference.

본 발명의 정보제공방법은 유전자 증폭방법에 의해 실시될 수 있다. 유전자 증폭방법을 이용한 miRNA의 검출은 당업계에 공지된 다양한 방법을 이용하여 실시할 수 있으며, 이 경우 miRNA의 프라이머 또는 프로브가 이용될 수 있다. 프라이머를 이용하는 경우에는, 유전자 증폭 반응을 실시하여 상기 miRNA의 유전자의 발현 정도를 조사한다. 본 발명은 miRNA 유전자의 발현 정도를 분석하는 것이기 때문에, 분석 대상의 시료(예컨대, 소변 유래 엑소좀)에서 마커의 mRNA 양을 조사하여 마커의 유전자의 발현 정도를 결정한다. 따라서 본 발명은 원칙적으로 생물학적 시료 내의 mRNA를 주형으로 하고 mRNA 또는 cDNA에 결합하는 프라이머를 이용하여 유전자 증폭 반응을 실시한다.The information providing method of the present invention can be implemented by a gene amplification method. Detection of miRNA using a gene amplification method can be performed using various methods known in the art, and in this case, miRNA primers or probes can be used. In the case of using primers, a gene amplification reaction is performed to examine the expression level of the miRNA gene. Since the present invention analyzes the expression level of miRNA genes, the level of expression of the marker gene is determined by examining the amount of mRNA of the marker in the sample to be analyzed (eg, urine-derived exosomes). Therefore, in the present invention, in principle, a gene amplification reaction is performed using mRNA in a biological sample as a template and primers binding to mRNA or cDNA.

우선, mRNA를 얻기 위하여 시료에서 총 RNA를 분리한다. 총 RNA를 분리하는 것은 당업계에 공지된 통상의 방법에 따라 실시될 수 있다(참조: Sambrook, J. et al., MolecularCloning. A Laboratory Manual, 3rd ed. Cold pring Harbor Press(2001); Tesniere, C. et al., PlantMol. Biol. Rep., 9:242(1991); Ausubel, F.M. et al., CurrentProtocolsinMolecularBiology, John Willey & Sons(1987); 및 Chomczynski, P. et al., Anal. Biochem. 162:156(1987)). 예컨대, Trizol을 이용하여 용이하게 세포내의 총 RNA를 분리할 수 있다.First, total RNA is isolated from a sample to obtain mRNA. Isolation of total RNA can be performed according to conventional methods known in the art (see: Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold pring Harbor Press (2001); Tesniere, C. et al., PlantMol. Biol. Rep., 9:242 (1991) Ausubel, F.M. et al., Current Protocols in Molecular Biology, John Willey & Sons (1987) and Chomczynski, P. et al., Anal. Biochem. 162:156 (1987)). For example, total RNA in cells can be easily isolated using Trizol.

이어, 분리된 mRNA로부터 cDNA를 합성하고, 이 cDNA를 증폭한다. 본 발명의 총 RNA는 인간의 시료로부터 분리되는 것이기 때문에, mRNA의 말단에는 폴리-A 테일을 갖고 있으며, 이러한 서열 특성을 이용한 올리고 dT 프라이머 및 역전사 효소를 이용하여 cDNA을 용이하게 합성할 수 있다(참조: PNAS USA, 85:8998(1988); Libert F, et al., Science, 244:569(1989); 및 Sambrook, J. et al., Molecular Cloning. A LaboratoryManual, 3rd ed. Cold Spring Harbor Press(2001)). 이어, 유전자 증폭 반응을 통하여 합성된 cDNA를 증폭한다. 본 발명에 이용되는 프라이머는 주형의 한 부위에 혼성화 또는 어닐링되어, 이중쇄 구조를 형성한다. 이러한 이중쇄 구조를 형성하는 데 적합한 핵산 혼성화의 조건은 Joseph Sambrook, 등, MolecularCloning, A LaboratoryManual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001) 및 Haymes, B. D., 등, Nucleic Acid Hybridization, A PracticalApproach, IRL Press, Washington, D.C. (1985)에 개시되어 있다.Then, cDNA is synthesized from the isolated mRNA, and this cDNA is amplified. Since the total RNA of the present invention is isolated from human samples, mRNA has a poly-A tail at the end, and cDNA can be easily synthesized using oligo dT primers and reverse transcriptase using this sequence characteristic ( References: PNAS USA, 85:8998 (1988); Libert F, et al., Science, 244:569 (1989); and Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)). Subsequently, the synthesized cDNA is amplified through a gene amplification reaction. The primer used in the present invention is hybridized or annealed to one site of the template to form a double-stranded structure. Conditions of nucleic acid hybridization suitable for forming such a double-stranded structure are Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001) and Haymes, B. D., et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985).

다양한 DNA 중합효소가 본 발명의 증폭에 이용될 수 있으며, E. coli DNA 중합효소 I의 “클레나우” 단편, 열안정성 DNA 중합효소 및 박테리오파아지 T7 DNA 중합효소를 포함한다. 중합효소는 다양한 박테리아 종으로부터 얻을 수 있는 열안정성 DNA 중합효소이고, 이는 Thermus aquaticus(Taq), Thermusthermophilus(Tth), Thermusfiliformis, Thermisflavus, Thermococcus literalis, 및 Pyrococcusfuriosus(Pfu)를 포함한다. 중합 반응을 실시할 때, 반응 용기에 반응에 필요한 성분들을 과량으로 제공하는 것이 바람직하다. 증폭 반응에 필요한 성분들의 과량은, 증폭반응이 성분의 농도에 실질적으로 제한되지 않는 정도의 양을 의미한다. Mg2+와 같은 조인자, dATP, dCTP, dGTP 및 dTTP를 원하는 증폭 정도가 달성될 수 있을 정도로 반응 혼합물에 제공하는 것이 바람직하다. 증폭 반응에 이용되는 모든 효소들은 동일한 반응 조건에서 활성 상태일 수 있다. 사실상, 완충액은 모든 효소들이 최적의 반응 조건에 근접하도록 한다. 따라서 본 발명의 증폭 과정은 반응물의 첨가와 같은 조건의 변화 없이 단일 반응물에서 실시될 수 있다.A variety of DNA polymerases can be used for the amplification of the present invention, including the “Klenow” fragment of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase. Polymerases are thermostable DNA polymerases available from various bacterial species, including Thermus aquaticus (Taq), Thermusthermophilus (Tth), Thermusfiliformis, Thermisflavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu). When carrying out the polymerization reaction, it is preferable to provide the reaction vessel with components necessary for the reaction in excess. An excess of components required for the amplification reaction means an amount to the extent that the amplification reaction is not substantially limited by the concentration of the components. Cofactors such as Mg 2+ , dATP, dCTP, dGTP and dTTP are preferably provided in the reaction mixture in such a way that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In effect, the buffer brings all enzymes closer to optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reactant without changing conditions such as addition of reactants.

본 발명에 있어서 어닐링 또는 혼성화는 표적 뉴클레오타이드 서열과 프라이머 사이에 특이적 결합을 가능하게 하는 엄격조건 하에서 실시된다. 어닐링을 위한 엄격조건은 서열-의존적이며 주위 환경적 변수에 따라 다양하다.In the present invention, annealing or hybridization is performed under stringent conditions enabling specific binding between the target nucleotide sequence and the primer. Stringent conditions for annealing are sequence-dependent and vary depending on environmental variables.

본 명세서의 용어“증폭 반응”은 핵산 분자를 증폭하는 반응을 의미한다. 다양한 증폭 반응들이 당업계에 보고되어 있으며, 이는 중합효소 연쇄반응(이하 PCR이라 한다)(미국 특허 제4,683,195, 4,683,202, 및 4,800,159호), 역전사-중합효소 연쇄반응(이하 RT-PCR로 표기한다)(Sambrook 등, Molecular Cloning. A LaboratoryManual, 3rd ed. Cold Spring Harbor Press(2001)), Miller, H. I.(WO 89/06700) 및 Davey, C. 등 (EP 329,822)의 방법, 리가아제 연쇄 반응(ligase chain reaction; LCR), Gap-LCR(WO 90/01069), 복구 연쇄 반응(repair chain reaction; EP 439,182), 전사-중재 증폭(transcription-mediated amplification; TMA) (WO 88/10315), 자가 유지 염기서열 복제(self sustained sequence replication) (WO 90/06995), 타깃 폴리뉴클레오티드 염기서열의 선택적 증폭(selective amplification of target polynucleotide sequences)(미국 특허 제6,410,276호), 컨센서스 서열 프라이밍 중합효소 연쇄 반응(consensus sequence primed polymerase chain reaction; CP-PCR)(미국 특허 제4,437,975호) 및 고리-중재 항온성 증폭(loopmediated isothermal amplification; LAMP)를 포함하나, 이에 한정되지는 않는다. 사용 가능한 다른 증폭 방법들은 미국특허 제5,242,794, 5,494,810, 4,988,617호 및 미국 특허 제09/854,317호에 기술되어 있다. 본 발명의 유전자 증폭방법은 미국특허 제4,683,195호, 제4,683,202호 및 제4,800,159호에 개시된 PCR(polymerase chain reaction)에 따라 실시될 수 있다.As used herein, the term “amplification reaction” refers to a reaction that amplifies a nucleic acid molecule. Various amplification reactions have been reported in the art, including polymerase chain reaction (hereinafter referred to as PCR) (U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcription-polymerase chain reaction (hereinafter referred to as RT-PCR) (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)), Miller, H. I. (WO 89/06700) and Davey, C. et al. (EP 329,822) method, ligase chain reaction chain reaction (LCR), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA) (WO 88/10315), self-retaining bases Self sustained sequence replication (WO 90/06995), selective amplification of target polynucleotide sequences (U.S. Patent No. 6,410,276), consensus sequence primed polymerase chain reaction polymerase chain reaction (CP-PCR) (US Pat. No. 4,437,975) and loopmediated isothermal amplification (LAMP). Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617 and U.S. Patent No. 09/854,317. The gene amplification method of the present invention may be performed according to the PCR (polymerase chain reaction) disclosed in US Patent Nos. 4,683,195, 4,683,202 and 4,800,159.

PCR은 가장 잘 알려진 핵산 증폭 방법으로, 그의 많은 변형과 응용들이 개발되어 있다. 예를 들어, PCR의 특이성 또는 민감성을 증진시키기 위해 전통적인 PCR 절차를 변형시켜 터치다운(touchdown) PCR, 핫 스타트(hot start) PCR, 네스티드(nested) PCR 및 부스터(booster) PCR이 개발되었다. 또한, 실시간(real-time) PCR, 분별 디스플레이 PCR(differential display PCR: DD-PCR), cDNA 말단의 신속 증폭(rapid amplification of cDNA ends: RACE), 멀티플렉스 PCR, 인버스 중합효소 연쇄반응(inverse polymerase chain reaction: IPCR), 벡토레트(vectorette) PCR, TAIL-PCR(thermal asymmetric interlaced PCR)및 멀티플렉스 PCR이 특정한 응용을 위해 개발되었다. PCR에 대한 자세한 내용은 McPherson, M.J., 및 Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000)에 기재되어 있으며, 그의 교시사항은 본 명세서에 참조로 삽입된다.PCR is the most well-known nucleic acid amplification method, and many variations and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction chain reaction (IPCR), vectorette PCR, thermal asymmetric interlaced PCR (TAIL-PCR) and multiplex PCR have been developed for specific applications. For details on PCR, see McPherson, M.J., and Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000), the teachings of which are incorporated herein by reference.

본 발명에서 유전자 증폭방법에 이용되는 프라이머는 상기 miRNA의 cDNA 서열에 상보적인 서열을 갖는 올리고뉴클레오타이드이다. 프라이머의 적합한 길이는 다양한 인자, 예컨대, 온도와 프라이머의 용도에 따라 변이가 있지만 전형적으로 15-30 뉴클레오타이드이다. 짧은 프라이머 분자는 주형과 충분히 안정된 하이브리드 복합체를 형성하기 위하여 일반적으로 보다 낮은 온도를 요구한다.Primers used in the gene amplification method in the present invention are oligonucleotides having a sequence complementary to the cDNA sequence of the miRNA. The suitable length of a primer varies depending on various factors, such as temperature and use of the primer, but is typically 15-30 nucleotides. Shorter primer molecules generally require lower temperatures to form a sufficiently stable hybrid complex with the template.

프라이머의 서열은 주형의 일부 서열과 완전하게 상보적인 서열을 가질 필요는 없으며, 주형과 혼성화 되어 프라이머 고유의 작용을 할 수 있는 범위 내에서의 충분한 상보성을 가지면 충분하다. 따라서, 본 발명에서의 프라이머 세트는 주형인 상기 마커의 cDNA 서열에 완벽하게 상보적인 서열을 가질 필요는 없으며, 이 서열에 혼성화되어 프라이머 작용을 할 수 있는 범위 내에서 충분한 상보성을 가지면 충분하다. 바람직하게는, 본 발명에서 이용되는 프라이머는 상기 마커의 cDNA 서열에 완벽하게 상보적인 서열을 갖는 것일 수 있다.The sequence of the primer does not have to have a sequence completely complementary to a part of the sequence of the template, and it is sufficient to have sufficient complementarity within the range of hybridizing with the template to perform the specific function of the primer. Therefore, the primer set in the present invention does not have to have a sequence perfectly complementary to the cDNA sequence of the marker as a template, and it is sufficient to have sufficient complementarity within the range in which the primer can function as a primer by hybridizing to this sequence. Preferably, the primer used in the present invention may have a sequence perfectly complementary to the cDNA sequence of the marker.

이러한 프라이머의 디자인은 상기 miRNA의 cDNA 서열을 참조하여 당업자에 의해 용이하게 실시할 수 있으며, 예컨대, 프라이머 디자인용 프로그램(예: PRIMER 3 프로그램)을 이용하여 할 수 있다.The design of such primers can be easily performed by those skilled in the art by referring to the cDNA sequence of the miRNA, for example, using a primer design program (eg, PRIMER 3 program).

이렇게 증폭된 상기 마커의 cDNA를 적합한 방법으로 분석하여 상기 마커의 유전자의 발현 정도를 조사한다. 예를 들어, 상술한 증폭 반응 결과물을 젤 전기영동을 하고, 그 결과 형성되는 밴드를 관찰 및 분석함으로써 상기 마커의 유전자의 발현 정도를 조사한다.The amplified cDNA of the marker is analyzed by an appropriate method to examine the expression level of the marker gene. For example, the expression level of the marker gene is investigated by subjecting the amplification reaction product described above to gel electrophoresis and observing and analyzing a band formed as a result.

상기 정상 대조군이란 신장이식을 받지 않은 정상인 또는 신장이식을 받았지만 안정적인 신장 기능이 발휘되며, 조직검사 상 이상소견이 없고, 항체 매개성 거부반응, T 세포 매개성 거부반응, 혼합 거부반응 또는 BK 바이러스 신병증이 나타나지 않은 상태의 신장이식 환자 등이며, 이들로부터 채취한 시료와 신장이식의 거부반응 또는 BK 바이러스 신병증의 존재 또는 예후를 알고자 하는 환자로부터 채취한 시료에서 유전자 발현수준 또는 발현패턴을 수득하고 비교함으로써 환자의 예후를 정확하게 예측할 수 있다.The normal control group refers to a normal person who has not undergone a kidney transplant or has undergone a kidney transplant, but has stable kidney function, has no abnormal findings on histological examination, antibody-mediated rejection, T cell-mediated rejection, mixed rejection or BK virus infection. Obtain gene expression levels or expression patterns from samples collected from kidney transplant patients who do not show any symptoms and from patients who want to know the existence or prognosis of kidney transplant rejection or BK virus nephropathy By comparing and comparing, the patient's prognosis can be accurately predicted.

본 발명의 제1 양태와 관련된 정보제공방법은 (c) 상기 (a) 단계에서 측정된, hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준이 정상 대조군 시료에서의 발현 수준보다 증가하는 경우, 신장이식 후 BK 바이러스 신병증으로 진단하는 단계를 추가로 포함할 수 있다.The information providing method related to the first aspect of the present invention is (c) hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR- 1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa- When the expression level of one or more miRNA genes selected from the group consisting of miR-514a-3p and hsa-miR-125b-5p is higher than that in the normal control sample, diagnosis of BK virus nephropathy after kidney transplantation Additional steps may be included.

구체적으로, hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준이 정상 대조군 시료에서의 발현 수준보다 100% 이상, 바람직하게는 200% 이상 상향조절 되어 있는 경우, BK 바이러스 신병증으로 진단할 수 있다.Specifically, hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR Any one selected from the group consisting of -17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p BK virus nephropathy can be diagnosed when the expression level of the above miRNA gene is up-regulated by 100% or more, preferably by 200% or more, than the expression level in the normal control sample.

본 발명의 치료제 스크리닝 방법에 있어서, 분석을 위해 사용되는 "시료"는 정보제공방법에 사용되는 시료와 동일하다.In the therapeutic agent screening method of the present invention, the "sample" used for analysis is the same as the sample used in the information providing method.

본 발명의 용어, "항체 매개성 거부반응 치료제의 후보물질", "T 세포 매개성 거부반응 치료제의 후보물질""신장이식 거부반응 치료제의 후보물질" 또는 "BK 바이러스 신병증 치료제의 후보물질"은 항체 매개성 거부반응, T 세포 매개성 거부반응, 신장이식 거부반응 또는 BK 바이러스 신병증을 치료할 수 있을 것으로 예상되는 물질로서, 직접 또는 간접적으로 신장이식 거부반응 또는 BK 바이러스 신병증을 호전 또는 개선 시킬 수 있을 것으로 예상되는 물질이면 제한 없이 사용 가능하며, 화합물, 유전자 또는 단백질 등의 치료가능 예상물질을 모두 포함한다.The term of the present invention, "candidate for antibody-mediated rejection treatment", "candidate for T cell-mediated rejection treatment", "candidate for kidney transplant rejection treatment" or "candidate for BK virus nephropathy treatment" It is a substance expected to be able to treat antibody-mediated rejection, T cell-mediated rejection, kidney transplant rejection, or BK virus nephropathy, and directly or indirectly improves or improves kidney transplant rejection or BK virus nephropathy. Any material that is expected to be able to treat can be used without limitation, and includes all expected therapeutic substances such as compounds, genes, or proteins.

본 발명의 치료제 스크리닝 방법에서, miRNA 유전자의 발현 수준을 측정하는 상기 (b) 단계는 당업자에게 알려진 어떠한 방법이든 사용 가능하다. 구체적인 예로, PCR, 리가제 연쇄 반응(LCR), 전사증폭(transcription amplification), 자가유지 서열복제, 핵산에 근거한 서열 증폭(NASBA), 공동-면역침전 어세이(Co-Immunoprecipitation assay), ELISA(Enzyme Linked Immunosorbent Assay), 실시간 RT-PCR 등이 사용될 수 있으나, 이에 제한되는 것은 아니다.In the therapeutic agent screening method of the present invention, any method known to those skilled in the art may be used for the step (b) of measuring the expression level of the miRNA gene. Specifically, PCR, ligase chain reaction (LCR), transcription amplification, self-maintained sequence replication, nucleic acid-based sequence amplification (NASBA), co-immunoprecipitation assay (Co-Immunoprecipitation assay), ELISA (Enzyme Linked Immunosorbent Assay), real-time RT-PCR, etc. may be used, but are not limited thereto.

본 발명의 제1 양태와 관련된 치료제 스크리닝 방법은 (c) 상기 (b) 단계에서 측정된, hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준이 후보물질을 처리하지 않은 시료에서 보다 억제되는 경우, 상기 (a) 단계에서 처리한 후보물질을 BK 바이러스 신병증 치료제로 판단하는 단계를 추가로 포함할 수 있다.The therapeutic agent screening method related to the first aspect of the present invention is (c) hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR- 1290, hsa-miR-19b-3p, hsa-miR-31-5p, hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa- If the expression level of one or more miRNA genes selected from the group consisting of miR-514a-3p and hsa-miR-125b-5p is suppressed more than in the sample not treated with the candidate substance, the candidate treated in step (a) above A step of determining the substance as a therapeutic agent for BK virus nephropathy may be further included.

본 발명의 제2 양태는 hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자를 포함하는, 신장이식 거부반응과 구분하여 BK 바이러스 신병증 (BK virus nephropathy; BKVN)을 진단하기 위한 바이오마커 조성물에 관한 것이다.A second aspect of the present invention is selected from the group consisting of hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p The present invention relates to a biomarker composition for diagnosing BK virus nephropathy (BKVN), including one or more miRNA genes, in distinction from renal transplant rejection.

상기 5종의 miRNA 유전자 바이오마커에 대한 정보는 상기 표 1에 기재된 바와 같다.Information on the five miRNA gene biomarkers is as described in Table 1 above.

본 발명의 용어, "BK 바이러스 신병증 (BK virus nephropathy; BKVN)"은 BK 바이러스에 의해 야기되는 신장병을 의미하며, BK 바이러스 신장병 또는 신장병증 등으로 불린다. 신병증은 신장에 병변이 생긴 상태를 의미하는데, 질환의 단위가 확립되지 않거나 병변이 분류불능인 경우를 모두 총칭한다. 주로, 신장이식 환자에서 면역억제제 투여에 의한 합병증으로 발병되며, BK 바이러스는 이식선의 상피 세포를 침범하여 염증을 일으키고, 결국 이식된 신장의 기능 저하를 야기한다. The term of the present invention, "BK virus nephropathy (BKVN)" means a kidney disease caused by the BK virus, and is referred to as BK virus nephropathy or nephropathy. Nephropathy refers to a condition in which a lesion occurs in the kidney, and refers to all cases in which the unit of disease is not established or the lesion is unclassifiable. Mainly, it occurs as a complication of immunosuppressant administration in kidney transplant patients, and the BK virus invades the epithelial cells of the transplant gland, causes inflammation, and eventually causes functional deterioration of the transplanted kidney.

본 발명의 용어, "BK 바이러스 (BKV)"는 파포바바이러스(papovavirus)에 속하는 바이러스를 의미한다. 주로, 화학요법을 받고 있는 암환자, 비스코트-올드리치(Wiskott-Aldrich) 증후군 환자의 소변에서 분리되고 있다.As used herein, the term "BK virus (BKV)" refers to a virus belonging to Papovavirus. Mainly, it is isolated from the urine of cancer patients undergoing chemotherapy and patients with Wiskott-Aldrich syndrome.

본 발명자들은 신장이식 환자들 중에서 조직검사 상 이상소견이 없는 정상 대조군(no major abnormality, NOMOA), 항체 매개성 거부반응군 (ABMR) 및 T 세포 매개성 거부반응군 (TCMR)과 비교하여 BK 바이러스 신병증 (BKVN)을 나타내는 환자의 소변에서 전술한 5종의 miRNA 유전자 발현이 2배 이상 증가하며, 통계분석 결과 p-value 값이 0.05 이하로 유의성을 나타내므로, 이들 miRNA 유전자 바이오마커를 항체 매개성 거부반응 및/또는 BK 세포 매개성 거부반응을 동반하지 않는 BK 바이러스 신병증의 진단 마커로서 활용할 수 있음을 알 수 있었다.The present inventors compared BK virus to a normal control group (no major abnormality, NOMOA), antibody-mediated rejection group (ABMR), and T cell-mediated rejection group (TCMR) with no abnormal findings on biopsy among renal transplant patients. In the urine of patients with nephropathy (BKVN), the expression of the above-mentioned 5 miRNA genes increased more than 2-fold, and as a result of statistical analysis, the p-value value was less than 0.05, indicating significance. It was found that it can be used as a diagnostic marker for BK virus nephropathy without sexual rejection and/or BK cell-mediated rejection.

제2 양태와 관련하여, 본 발명은 또한 hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준을 측정하는 제제를 포함하는, 신장이식 거부반응과 구분하여 BK 바이러스 신병증을 진단하기 위한 조성물 및 이를 포함하는 키트를 제공한다.Regarding the second aspect, the present invention also provides a composition consisting of hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p. Provided is a composition for diagnosing BK virus nephropathy, including an agent for measuring the expression level of one or more miRNA genes selected from the group, and a kit including the same, as distinguished from kidney transplant rejection.

본 발명의 바람직한 일실시예에 따르면, 상기 hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준을 측정하는 제제는 상기 유전자에 특이적으로 결합하는 프라이머 또는 프로브를 포함할 수 있다.According to a preferred embodiment of the present invention, the hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p An agent for measuring the expression level of one or more miRNA genes selected from the group may include a primer or probe that specifically binds to the gene.

본 발명의 바람직한 일실시예에 따르면, 상기 정보제공방법은 (c) 상기 (a) 단계에서 측정된, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준이 정상 대조군 시료에서의 발현 수준보다 증가하는 경우, 신장이식 거부반응을 동반하지 않는 BK 바이러스 신병증으로 진단하는 단계를 추가로 포함할 수 있다.According to a preferred embodiment of the present invention, the information providing method (c) measured in step (a), hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa - When the expression level of one or more miRNA genes selected from the group consisting of miR-514a-3p and hsa-miR-125b-5p is higher than that in the normal control sample, BK without renal transplant rejection A step of diagnosing viral nephropathy may be further included.

구체적으로, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준이 정상 대조군 시료에서의 발현 수준보다 100% 이상, 바람직하게는 200% 이상 상향조절 되어 있는 경우, 신장이식 거부반응을 동반하지 않는 BK 바이러스 신병증으로 진단할 수 있다.Specifically, any one or more miRNAs selected from the group consisting of hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p When the expression level of the gene is up-regulated by 100% or more, preferably by 200% or more, compared to the expression level in the normal control sample, BK virus nephropathy without renal transplant rejection can be diagnosed.

본 발명의 바람직한 일실시예에 따르면, 상기 스크리닝 방법은 (c) 상기 (b) 단계에서 측정된, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p 및 hsa-miR-125b-5p로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA 유전자의 발현 수준이 후보물질을 처리하지 않은 시료에서 보다 억제되는 경우, 상기 (a) 단계에서 처리한 후보물질을 BK 바이러스 신병증 치료제로 판단하는 단계를 추가로 포함할 수 있다.According to a preferred embodiment of the present invention, the screening method (c) the hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-measured in step (b) If the expression level of one or more miRNA genes selected from the group consisting of miR-514a-3p and hsa-miR-125b-5p is suppressed more than in the sample not treated with the candidate substance, the candidate treated in step (a) above A step of determining the substance as a therapeutic agent for BK virus nephropathy may be further included.

본 발명의 제2 양태와 관련하여, 제1 양태와 동일한 부분은 설명을 생략한다.Regarding the second aspect of the present invention, the description of the same parts as the first aspect is omitted.

시료의 준비sample preparation

1-1. 환자의 선발 및 소변 시료의 준비1-1. Selection of patients and preparation of urine samples

신장이식 환자의 항체 매개성 거부반응을 진단하기 위한 바이오마커를 발굴하기 위하여, 신장이식 후 5년 이내 징후 생검 (indication biopsy)을 시행받은 환자 15명을 대상으로 생검 2~3 시간 전에 소변 시료를 수집하였다. 또한 생체 신장 기증자로부터 신장 기증수술 직전에 소변 시료를 수집하였다. 환자들은 표 2와 같이 생검의 병리학적인 진단에 따라 4 군으로 분류되었다; 항체 매개성 거부반응 (ABMR) 군 4개, T 세포 매개성 거부반응 (TCMR) 군 4개, BK 바이러스 신병증 (BKVN) 군 3개 및 주요 이상이 없는 (NOMOA) 군 4개, 혼합된 동종 이병성 병변을 가진 환자의 소변은 제외하였다. 수집된 소변 시료는 프로테아제 저해제 혼합물을 넣어 4,000 rpm, 4

에서 15분 간 원심분리하였고 상층액을 모아 사용시까지 동결보관하였다. 이 연구는 아산 병원 의료기관 평가위원회의 승인을 받아 진행하였으며, 모든 환자에게서 서면 동의를 받았다.In order to discover biomarkers for diagnosing antibody-mediated rejection of kidney transplant patients, urine samples were taken 2 to 3 hours before biopsy in 15 patients who underwent an indication biopsy within 5 years after kidney transplant. collected. In addition, urine samples were collected from living kidney donors immediately before kidney donation surgery. Patients were classified into 4 groups according to the pathological diagnosis of biopsy, as shown in Table 2; Antibody-mediated rejection (ABMR) 4 groups, T cell-mediated rejection (TCMR) 4 groups, BK virus nephropathy (BKVN) 3 groups and no major abnormality (NOMOA) 4 groups, mixed allogeneic Urine from patients with diseased lesions was excluded. Collected urine samples were mixed with a protease inhibitor at 4,000 rpm, 4

was centrifuged for 15 minutes, and the supernatant was collected and stored frozen until use. This study was conducted with the approval of the Medical Institution Evaluation Committee of Asan Medical Center, and written informed consent was obtained from all patients.

　 시료 이름sample name 그룹group 순서order 1One Bx579-1Bx579-1 NOMOANOMOA 1805KHP-00671805KHP-0067 22 Bx613Bx613 NOMOANOMOA 1808AHP-00021808AHP-0002 33 Bx623-1Bx623-1 NOMOANOMOA 1808AHP-00021808AHP-0002 44 Bx632Bx632 NOMOANOMOA 1808AHP-00021808AHP-0002 55 Bx144Bx144 TCMRTCMR 1805KHP-00671805KHP-0067 66 Bx39-1Bx39-1 TCMRTCMR 1805KHP-00671805KHP-0067 77 Bx201-1Bx201-1 TCMRTCMR 1805KHP-00671805KHP-0067 88 Bx175Bx175 TCMRTCMR 1808AHP-00021808AHP-0002 99 Bx107Bx107 BKVNBKVN 1805KHP-00671805KHP-0067 1010 Bx650Bx650 BKVNBKVN 1805KHP-00671805KHP-0067 1111 Bx98-1Bx98-1 BKVNBKVN 1805KHP-00671805KHP-0067 1212 Bx85Bx85 ABMRABMR 1804AHP-00571804AHP-0057 1313 Bx376Bx376 ABMRABMR 1804AHP-00571804AHP-0057 1414 Bx326Bx326 ABMRABMR 1804AHP-00571804AHP-0057 1515 Bx605Bx605 ABMRABMR 1804AHP-00571804AHP-0057

1-2. 소변 유래 1-2. urine origin 엑소좀exosome 분리 및 separate and 엑소좀exosome 내 my miRNAmiRNAs 분리 separation

동결보관 중인 소변을 실온 (RT)에서 녹이고 4℃에서 17,000xg로 15분 동안 원심분리하여 세포 잔해를 제거한 후 상청액을 450nm 필터로 여과하였다. 초고속 원심분리기를 이용하여 200,000xg에서 1시간 동안 원심분리하여 침전물을 얻은 후 PBS로 200,000xg에서 1시간 동안 원심분리하여 세척하고 200ul 볼륨의 PBS에 풀어 엑소좀을 모은 후 small RNA isolation kit (miRNeasy mini kit, Quiagen)을 이용하여 제시되어 있는 방법에 따라 RNA 를 분리하여 80℃에 보관하였다.The cryopreserved urine was thawed at room temperature (RT) and centrifuged at 4° C. at 17,000xg for 15 minutes to remove cell debris, and then the supernatant was filtered through a 450 nm filter. After obtaining the precipitate by centrifugation at 200,000xg for 1 hour using an ultra-high-speed centrifuge, washing with PBS at 200,000xg for 1 hour, dissolving in PBS in a volume of 200ul to collect exosomes, small RNA isolation kit (miRNeasy mini kit, Quiagen) according to the suggested method, and RNA was isolated and stored at 80°C.

miRNAmiRNAs 유전자 gene 바이오마커biomarkers 후보 선발 및 확인 Candidate selection and confirmation

각각의 병리학적 그룹을 대표하는 특정 바이오마커를 선발하기 위해, t-테스트를 사용하여 ABMR, TCMR 및 BKVN을 각각 NOMOA 그룹과 비교하였을 때 2배 이상의 차이를 보이고, P<0.05인 miRNA 유전자를 선정했다. RNA는 RNA bioanalyzer pico 6000 chip을 이용하여 RNA-seq 수행업체에 의뢰하여 QC 진행 후 Illumnia smarter kit로 라이브러리를 제작했다. RNA-seq은 크기 분할 (size fractionation)을 통하여 20nt 사이즈의 유전체(genome)에 어댑터 결합 (adaptor ligation), RT-RCR 방법으로 증폭 후 Hi-seq으로 시퀀싱 (sequencing) 하였다. 이의 결과로 정상인 그룹에 비해 발현도가 2배 이상이며 통계적으로 유의하게 발현한 miRNA를 선별하였다.In order to select a specific biomarker representing each pathological group, a t-test was used to select a miRNA gene that showed a difference of more than 2 times and P<0.05 when ABMR, TCMR and BKVN were compared with the NOMOA group, respectively. did. RNA was requested to an RNA-seq performer using an RNA bioanalyzer pico 6000 chip, and a library was produced with an Illumnia smarter kit after QC. RNA-seq was amplified by adapter ligation and RT-RCR method to a 20nt genome through size fractionation, followed by sequencing by Hi-seq. As a result, the expression level was more than twice as high as that of the normal group, and miRNAs with statistically significant expression were selected.

보다 구체적인 miRNA 유전자 바이오마커 후보 선발과정은 다음과 같다.A more specific miRNA gene biomarker candidate selection process is as follows.

도 1에 나타낸 바와 같이, 첫 번째 단계로 상기 실시예 1에서 준비된 15개의 샘플에서 2,588개의 성숙 (mature) miRNA를 선별하였다. 두 번째 단계로 중요 데이터에 대하여, 발현 수준이 유사한 샘플 및 성숙 miRNA를 그룹화하는 계층적 군집 분석 (유리클리드 방법, 완전 연관)을 수행하고, 이를 도 2에 히트맵 (Heatmap)으로 나타내었다. 각 성숙 miRNA 별, 전체 15개 샘플에서 총 2,588개 성숙 miRNA 중에서 모두 0인 카운트 (Count) 값을 가지는 성숙 miRNA는 분석에서 제외하여 892개의 성숙 miRNA를 대상으로 통계분석을 진행하였다.As shown in FIG. 1, as a first step, 2,588 mature miRNAs were selected from the 15 samples prepared in Example 1 above. As a second step, for important data, hierarchical clustering analysis (Euriclid method, complete association) was performed to group samples and mature miRNAs with similar expression levels, and this is shown as a heatmap in FIG. 2 . For each mature miRNA, among a total of 2,588 mature miRNAs in 15 samples, mature miRNAs with a count value of 0 were excluded from the analysis, and statistical analysis was performed on 892 mature miRNAs.

1차 및 2차 선별과정을 통해 NOMOA 그룹을 기준으로 발현이 2배 이상 증가하거나 또는 감소하고, 통계분석 결과 p-value 값이 0.05 이하인 유전자를 선택하여 유전자를 필터링함으로써 NOMOA에 비해 ABMR, TCMR 및 BKVN 환자에서 상향 혹은 하향 조절되는 miRNA를 확인하였다. 발현 수준이 증가한 miRNA는 빨간색으로 표시하고 발현도가 감소한 miRNA는 초록색으로 표시하여 도 3(A)에 나타내었다. 특히 도 3(B)에 나타낸 바와 같이 NOMOA 그룹 대비 ABMR 그룹에서 발현 수준이 증가한 miRNA 유전자는 10개, TCMR 환자에서 11개, BKVN에서 12개를 최종 선발하였고, 그 목록을 표 3에 나타내었다.Through the first and second selection process, genes whose expression increased or decreased by more than 2 times based on the NOMOA group and whose p-value was 0.05 or less as a result of statistical analysis were selected and filtered to generate ABMR, TCMR and TCMR compared to NOMOA. Up- or down-regulated miRNAs were identified in BKVN patients. miRNAs with increased expression levels are shown in red, and miRNAs with reduced expression levels are shown in green, as shown in FIG. 3(A). In particular, as shown in FIG. 3(B), 10 miRNA genes whose expression levels increased in the ABMR group compared to the NOMOA group, 11 in TCMR patients, and 12 in BKVN were finally selected, and the lists are shown in Table 3.

그룹group 바이오마커biomarkers 수 number 선발된 selected miRNAmiRNAs 유전자 gene ABMRABMR 1010 hsa-miR-8485
hsa-miR-221-3p
hsa-miR-331-3p
hsa-miR-1290
hsa-miR-192-5p
hsa-miR-126-5p
hsa-miR-328-5p
hsa-miR-103a-3p
hsa-miR-455-3p
hsa-miR-126-3phsa-miR-8485
hsa-miR-221-3p
hsa-miR-331-3p
hsa-miR-1290
hsa-miR-192-5p
hsa-miR-126-5p
hsa-miR-328-5p
hsa-miR-103a-3p
hsa-miR-455-3p
hsa-miR-126-3p TCMRTCMR 1111 hsa-miR-8485
hsa-miR-221-3p
hsa-miR-19b-3p
hsa-miR-31-5p
hsa-miR-17-5p
hsa-miR-192-5p
hsa-miR-345-5p
hsa-miR-215-5p
hsa-miR-1273g-3p
hsa-miR-19a-3p
hsa-miR-223-3phsa-miR-8485
hsa-miR-221-3p
hsa-miR-19b-3p
hsa-miR-31-5p
hsa-miR-17-5p
hsa-miR-192-5p
hsa-miR-345-5p
hsa-miR-215-5p
hsa-miR-1273g-3p
hsa-miR-19a-3p
hsa-miR-223-3p BKVNBKVN 1212 hsa-miR-8485
hsa-miR-221-3p
hsa-miR-331-3p
hsa-miR-1290
hsa-miR-19b-3p
hsa-miR-31-5p
hsa-miR-17-5p
hsa-miR-205-5p
hsa-miR-4449
hsa-miR-106a-5p
hsa-miR-514a-3p
hsa-miR-125b-5phsa-miR-8485
hsa-miR-221-3p
hsa-miR-331-3p
hsa-miR-1290
hsa-miR-19b-3p
hsa-miR-31-5p
hsa-miR-17-5p
hsa-miR-205-5p
hsa-miR-4449
hsa-miR-106a-5p
hsa-miR-514a-3p
hsa-miR-125b-5p

선발된 miRNA 유전자 바이오마커에 따른 병리학적 그룹의 확인Identification of pathological groups according to selected miRNA gene biomarkers

3-1. 3-1. TCMRTCMR 그룹 및 group and BKVNBKVN 그룹 대비 group contrast ABMRABMR 그룹에서 in the group 증가된increased 발현 수준을 나타내는 miRNA 유전자 바이오마커의 확인 Identification of miRNA gene biomarkers representing expression levels

실시예 2에서 선발된 NOMOA 그룹 대비 ABMR 그룹에서 발현 수준이 증가한 miRNA 유전자 중에서, TCMR 그룹 및 BKVN 그룹 대비 현저한 발현 양상 차이를 나타내는 5종의 miRNA 유전자를 선발하였고, 그 결과를 도 4(A)에 나타냈다. 도 4(A)에서 확인되는 바와 같이, hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p 및 hsa-miR-103a-3p의 5종의 miRNA 유전자는 TCMR 그룹 및 BKVN 그룹 대비 현저한 발현 양상의 차이가 있었다. 또한, 도 4(B) 및 표 4에 나타낸 바와 같이 상기 5종의 miRNA 유전자는 NOMOA 그룹 대비 ABMR 그룹에서 발현 수준이 2배 이상 증가하고, p<0.05 로 통계적 유의성이 있음을 확인하였다.Among the miRNA genes whose expression levels increased in the ABMR group compared to the NOMOA group selected in Example 2, 5 miRNA genes showing significant differences in expression compared to the TCMR and BKVN groups were selected, and the results are shown in FIG. 4(A). showed up As confirmed in Figure 4 (A), hsa-miR-126-3p, hsa-miR-126-5p, hsa-miR-328-5p, hsa-miR-455-3p and hsa-miR-103a-3p The five miRNA genes in showed significant differences in expression patterns compared to the TCMR group and the BKVN group. In addition, as shown in FIG. 4(B) and Table 4, the expression level of the 5 miRNA genes increased more than 2-fold in the ABMR group compared to the NOMOA group, and it was confirmed that there was statistical significance with p<0.05.

NOMOA 그룹 대비 ABMR 그룹에서 발현 수준이 증가한 5종의 miRNA 유전자에 대한 fc 및 p 값fc and p values for the 5 miRNA genes whose expression levels increased in the ABMR group compared to the NOMOA group 성숙 Maturity miRNAmiRNAs ABMRABMR // NOMOANOMOA .. fcfc ABMRABMR // NOMOANOMOA ..
raw.raw. pvalpval hsa-miR-126-3phsa-miR-126-3p 68.5083613268.50836132 0.0015215040.001521504 hsa-miR-328-5phsa-miR-328-5p 18.9567041218.95670412 0.0289495120.028949512 hsa-miR-126-5phsa-miR-126-5p 6.3492830586.349283058 0.042047560.04204756 hsa-miR-455-3phsa-miR-455-3p 4.4622482334.462248233 0.0301231510.030123151 hsa-miR-103a-3phsa-miR-103a-3p 3.4688013223.468801322 0.0413456170.041345617

이와 같은 결과를 통해, 상기 5종의 miRNA 유전자는 정상 그룹뿐만 아니라 TCMR 또는 BKVN과 구분하여 ABMR을 진단하는 바이오마커로서 활용 가능함을 확인할 수 있다.Through these results, it can be confirmed that the 5 kinds of miRNA genes can be used as biomarkers for diagnosing ABMR by distinguishing them from TCMR or BKVN as well as the normal group.

3-2. 3-2. ABMRABMR 그룹 및 group and BKVNBKVN 그룹 대비 group contrast TCMRTCMR 그룹에서 in the group 증가된increased 발현 수준을 나타내는 expressing expression level miRNAmiRNAs 유전자 gene 바이오마커의of biomarkers 확인 check

실시예 2에서 선발된 NOMOA 그룹 대비 TCMR 그룹에서 발현 수준이 증가한 miRNA 유전자 중에서, ABMR 그룹 및 BKVN 그룹 대비 현저한 발현 양상 차이를 나타내는 5종의 miRNA 유전자를 선발하였고, 그 결과를 도 5(A)에 나타냈다. 도 5(A)에서 확인되는 바와 같이, hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p 및 hsa-miR-223-3p의 5종의 miRNA 유전자는 ABMR 그룹 및 BKVN 그룹 대비 현저한 발현 양상의 차이가 있었다. 또한, 도 5(B) 및 표 5에 나타낸 바와 같이 상기 5종의 miRNA 유전자는 NOMOA 그룹 대비 TCMR 그룹에서 발현 수준이 2배 이상 증가하고, p<0.05 로 통계적 유의성이 있음을 확인하였다.Among the miRNA genes whose expression levels increased in the TCMR group compared to the NOMOA group selected in Example 2, 5 miRNA genes showing significant differences in expression compared to the ABMR and BKVN groups were selected, and the results are shown in FIG. 5(A). showed up As confirmed in Figure 5 (A), hsa-miR-345-5p, hsa-miR-215-5p, hsa-miR-1273g-3p, hsa-miR-19a-3p and hsa-miR-223-3p The five miRNA genes in showed significant differences in expression patterns compared to the ABMR group and the BKVN group. In addition, as shown in FIG. 5(B) and Table 5, the expression level of the 5 miRNA genes increased more than 2-fold in the TCMR group compared to the NOMOA group, and it was confirmed that there was statistical significance with p<0.05.

NOMOA 그룹 대비 TCMR 그룹에서 발현 수준이 증가한 5종의 miRNA 유전자에 대한 fc 및 p 값fc and p values for 5 miRNA genes whose expression levels increased in the TCMR group compared to the NOMOA group 성숙 Maturity miRNAmiRNAs TCMRTCMR // NOMOANOMOA .. fcfc TCMRTCMR // NOMOANOMOA ..
raw.raw. pvalpval hsa-miR-223-3phsa-miR-223-3p 32.7482041732.74820417 0.0487894740.048789474 hsa-miR-215-5phsa-miR-215-5p 15.718101115.7181011 0.0006812710.000681271 hsa-miR-345-5phsa-miR-345-5p 4.3826699864.382669986 0.0278765340.027876534 hsa-miR-19a-3phsa-miR-19a-3p 3.3504894673.350489467 0.0380751170.038075117 hsa-miR-1273g-3phsa-miR-1273g-3p 2.6119365682.611936568 0.0217838910.021783891

이와 같은 결과를 통해, 상기 5 종의 miRNA 유전자는 정상 그룹뿐만 아니라 ABMR 또는 BKVN과 구분하여 ABMR을 진단하는 바이오마커로서 활용 가능함을 확인할 수 있다.Through these results, it can be confirmed that the 5 kinds of miRNA genes can be used as biomarkers for diagnosing ABMR by distinguishing them from not only the normal group but also ABMR or BKVN.

3-3. 3-3. ABMRABMR 그룹 및 group and TCMRTCMR 그룹 대비 group contrast BKVNBKVN 그룹에서 in the group 증가된increased 발현 수준을 나타내는 miRNA 유전자 바이오마커의 확인 Identification of miRNA gene biomarkers representing expression levels

실시예 2에서 선발된 NOMOA 그룹 대비 BKVN 그룹에서 발현 수준이 증가한 miRNA 유전자 중에서, ABMR 그룹 및 TCMR 그룹 대비 현저한 발현 양상 차이를 나타내는 5종의 miRNA 유전자를 선발하였고, 그 결과를 도 6(A)에 나타냈다. 도 6(A)에서 확인되는 바와 같이, hsa-miR-4449, hsa-miR-514a-3p, hsa-miR-106a-5p, hsa-miR-205-5p 및 hsa-miR-125b-5p의 5종의 miRNA 유전자는 ABMR 그룹 및 TCMR 그룹 대비 현저한 발현 양상의 차이가 있었다. 또한, 도 6(B) 및 표 6에 나타낸 바와 같이 상기 5종의 miRNA 유전자는 NOMOA 그룹 대비 BKVN 그룹에서 발현 수준이 2배 이상 증가하고, p<0.05 로 통계적 유의성이 있음을 확인하였다.Among the miRNA genes whose expression levels increased in the BKVN group compared to the NOMOA group selected in Example 2, 5 miRNA genes showing significant differences in expression patterns compared to the ABMR and TCMR groups were selected, and the results are shown in FIG. 6(A). showed up As confirmed in Figure 6 (A), hsa-miR-4449, hsa-miR-514a-3p, hsa-miR-106a-5p, hsa-miR-205-5p and hsa-miR-125b-5p of 5 There was a significant difference in the expression pattern of the miRNA genes of the species compared to the ABMR and TCMR groups. In addition, as shown in FIG. 6(B) and Table 6, the expression level of the 5 miRNA genes increased more than 2 times in the BKVN group compared to the NOMOA group, and it was confirmed that there was statistical significance with p<0.05.

NOMOA 그룹 대비 BKVN 그룹에서 발현 수준이 증가한 5종의 miRNA 유전자에 대한 fc 및 p 값fc and p values for the 5 miRNA genes whose expression levels increased in the BKVN group compared to the NOMOA group 성숙 Maturity miRNAmiRNAs BKVNBKVN // NOMOANOMOA .. fcfc BKVNBKVN // NOMOANOMOA ..
raw.raw. pvalpval hsa-miR-4449hsa-miR-4449 97.7393154297.73931542 0.0021094690.002109469 hsa-miR-514a-3phsa-miR-514a-3p 27.8315349427.83153494 0.044996450.04499645 hsa-miR-106a-5phsa-miR-106a-5p 10.6552458210.65524582 0.025742650.02574265 hsa-miR-205-5phsa-miR-205-5p 5.244745115.24474511 0.0356160630.035616063 hsa-miR-125b-5phsa-miR-125b-5p 3.2782345893.278234589 0.0493865610.049386561

이와 같은 결과를 통해, 상기 5 종의 miRNA 유전자는 정상 그룹뿐만 아니라 ABMR 또는 TCMR과 구분하여 BKVN을 진단하는 바이오마커로서 활용 가능함을 확인할 수 있다.Through these results, it can be confirmed that the 5 kinds of miRNA genes can be used as biomarkers for diagnosing BKVN by distinguishing them from not only the normal group but also ABMR or TCMR.

3-4. 병리학적 그룹에 따른 3-4. according to pathological group 바이오마커의of biomarkers 그룹핑grouping

상기 결과를 바탕으로, 표 7의 바이오마커 목록을 표 9와 같이 재그룹핑하였고, 이를 도 7에 벤다이어그램으로 나타내었다.Based on the above results, the biomarker list in Table 7 was regrouped as shown in Table 9, which is shown in a Venn diagram in FIG. 7.

그룹group 바이오마커biomarkers 수 number 선발된 selected miRNAmiRNAs 유전자 gene ABMR BKVN TCMRABMR BKVN TCMR 22 hsa-miR-8485
hsa-miR-221-3phsa-miR-8485
hsa-miR-221-3p ABMR BKVNABMR BKVN 22 hsa-miR-331-3p
hsa-miR-1290hsa-miR-331-3p
hsa-miR-1290 BKVN TCMRBKVN TCMR 33 hsa-miR-19b-3p
hsa-miR-31-5p
hsa-miR-17-5phsa-miR-19b-3p
hsa-miR-31-5p
hsa-miR-17-5p ABMR TCMRABMR TCMR 1One hsa-miR-192-5phsa-miR-192-5p ABMRABMR 55 hsa-miR-126-5p
hsa-miR-328-5p
hsa-miR-103a-3p
hsa-miR-455-3p
hsa-miR-126-3phsa-miR-126-5p
hsa-miR-328-5p
hsa-miR-103a-3p
hsa-miR-455-3p
hsa-miR-126-3p TCMRTCMR 55 hsa-miR-345-5p
hsa-miR-215-5p
hsa-miR-1273g-3p
hsa-miR-19a-3p
hsa-miR-223-3phsa-miR-345-5p
hsa-miR-215-5p
hsa-miR-1273g-3p
hsa-miR-19a-3p
hsa-miR-223-3p BKVNBKVN 55 hsa-miR-205-5p
hsa-miR-4449
hsa-miR-106a-5p
hsa-miR-514a-3p
hsa-miR-125b-5phsa-miR-205-5p
hsa-miR-4449
hsa-miR-106a-5p
hsa-miR-514a-3p
hsa-miR-125b-5p

상기 표 7에 기재된 23종의 miRNA 유전자 바이오마커에 대한 정보는 표 8에 나타내었다.Information on the 23 miRNA gene biomarkers listed in Table 7 is shown in Table 8.

성숙 miRNA 유전자mature miRNA genes 서열order 서열번호sequence number Accession NumberAccession Number hsa-miR-126-3phsa-miR-126-3p UCGUACCGUGAGUAAUAAUGCGUCGUACCGUGAGUAAUAAUGCG 1One MIMAT0000445MIMAT0000445 hsa-miR-126-5phsa-miR-126-5p CAUUAUUACUUUUGGUACGCGCAUUAUUACUUUUGGUACGCG 22 MIMAT0000444MIMAT0000444 hsa-miR-328-5phsa-miR-328-5p GGGGGGGCAGGAGGGGCUCAGGGGGGGGGGCAGGAGGGGCUCAGGG 33 MIMAT0026486MIMAT0026486 hsa-miR-455-3phsa-miR-455-3p GCAGUCCAUGGGCAUAUACACGCAGUCCAUGGGCAUAUACAC 44 MIMAT0004784MIMAT0004784 hsa-miR-103a-3phsa-miR-103a-3p AGCAGCAUUGUACAGGGCUAUGAAGCAGCAUUGUACAGGGCUAUGA 55 MIMAT0000101MIMAT0000101 hsa-miR-192-5phsa-miR-192-5p CUGACCUAUGAAUUGACAGCCCUGACCUAUGAAUUGACAGCC 66 MIMAT0000222MIMAT0000222 hsa-miR-331-3phsa-miR-331-3p GCCCCUGGGCCUAUCCUAGAAGCCCCUGGGCCUAUCCUAGAA 77 MIMAT0000760MIMAT0000760 hsa-miR-1290hsa-miR-1290 UGGAUUUUUGGAUCAGGGAUGGAUUUUUGGAUCAGGGA 88 MIMAT0005880MIMAT0005880 hsa-miR-8485hsa-miR-8485 CACACACACACACACACGUAUCACACACACACACACACGUAU 99 MIMAT0033692MIMAT0033692 hsa-miR-221-3phsa-miR-221-3p AGCUACAUUGUCUGCUGGGUUUCAGCUACAUUGUCUGCUGGGUUUC 1010 MIMAT0000278MIMAT0000278 hsa-miR-345-5phsa-miR-345-5p GCUGACUCCUAGUCCAGGGCUCGCUGACUCCUAGUCCAGGGCUC 1111 MIMAT0000772MIMAT0000772 hsa-miR-215-5phsa-miR-215-5p AUGACCUAUGAAUUGACAGACAUGACCUAUGAAUUGACAGAC 1212 MIMAT0000272MIMAT0000272 hsa-miR-1273g-3phsa-miR-1273g-3p ACCACUGCACUCCAGCCUGAGACCACUGCACUCCAGCCUGAG 1313 MIMAT0022742MIMAT0022742 hsa-miR-19a-3phsa-miR-19a-3p UGUGCAAAUCUAUGCAAAACUGAUGUGCAAAUCUAUGCAAAACUGA 1414 MIMAT0000073MIMAT0000073 hsa-miR-223-3phsa-miR-223-3p UGUCAGUUUGUCAAAUACCCCAUGUCAGUUUGUCAAAUACCCCA 1515 MIMAT0000280MIMAT0000280 hsa-miR-19b-3phsa-miR-19b-3p UGUGCAAAUCCAUGCAAAACUGAUGUGCAAAUCCAUGCAAAACUGA 1616 MIMAT0000074MIMAT0000074 hsa-miR-31-5phsa-miR-31-5p AGGCAAGAUGCUGGCAUAGCUAGGCAAGAUGCUGGCAUAGCU 1717 MIMAT0000089MIMAT0000089 hsa-miR-17-5phsa-miR-17-5p CAAAGUGCUUACAGUGCAGGUAGCAAAGUGCUUACAGUGCAGGUAG 1818 MIMAT0000070MIMAT0000070 hsa-miR-205-5phsa-miR-205-5p UCCUUCAUUCCACCGGAGUCUGUCCUUCAUUCCACCGGAGUCUG 1919 MIMAT0000266MIMAT0000266 hsa-miR-4449hsa-miR-4449 CGUCCCGGGGCUGCGCGAGGCACGUCCCGGGGCUGCGCGAGGCA 2020 MIMAT0018968MIMAT0018968 hsa-miR-106a-5phsa-miR-106a-5p AAAAGUGCUUACAGUGCAGGUAGAAAAGUGCUUACAGUGCAGGUAG 2121 MIMAT0000103MIMAT0000103 hsa-miR-514a-3phsa-miR-514a-3p AUUGACACUUCUGUGAGUAGAAUUGACACUUCUGUGAGUAGA 2222 MIMAT0002883MIMAT0002883 hsa-miR-125b-5phsa-miR-125b-5p UCCCUGAGACCCUAACUUGUGAUCCCUGAGACCCUAACUUGUGA 2323 MIMAT0000423MIMAT0000423

상기와 같이 그룹핑된 바이오마커를 활용하여, 신장이식 후 항체 매개성 거부반응, T 세포 거부반응 및 BK 바이러스 신병증을 각각 구분하여 진단할 수 있다.Using the grouped biomarkers as described above, antibody-mediated rejection, T cell rejection, and BK virus nephropathy after kidney transplantation can be separately diagnosed.

SEQUENCE LISTING <110> THE ASAN FOUNDATION University of Ulsan Foundation For Industry Cooperation <120> Urinary exosome-derived miRNA gene biomarkers for diagnosis of BK virus nephropathy in kidney allografts and use thereof <130> 1065626 <160> 23 <170> PatentIn version 3.2 <210> 1 <211> 22 <212> RNA <213> Artificial <220> <223> hsa-miR-126-3p <400> 1 ucguaccgug aguaauaaug cg 22 <210> 2 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-126-5p <400> 2 cauuauuacu uuugguacgc g 21 <210> 3 <211> 23 <212> RNA <213> Artificial <220> <223> hsa-miR-328-5p <400> 3 gggggggcag gaggggcuca ggg 23 <210> 4 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-455-3p <400> 4 gcaguccaug ggcauauaca c 21 <210> 5 <211> 23 <212> RNA <213> Artificial <220> <223> hsa-miR-103a-3p <400> 5 agcagcauug uacagggcua uga 23 <210> 6 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-192-5p <400> 6 cugaccuaug aauugacagc c 21 <210> 7 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-331-3p <400> 7 gccccugggc cuauccuaga a 21 <210> 8 <211> 19 <212> RNA <213> Artificial <220> <223> hsa-miR-1290 <400> 8 uggauuuuug gaucaggga 19 <210> 9 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-8485 <400> 9 cacacacaca cacacacgua u 21 <210> 10 <211> 23 <212> RNA <213> Artificial <220> <223> hsa-miR-221-3p <400> 10 agcuacauug ucugcugggu uuc 23 <210> 11 <211> 22 <212> RNA <213> Artificial <220> <223> hsa-miR-345-5p <400> 11 gcugacuccu aguccagggc uc 22 <210> 12 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-215-5p <400> 12 augaccuaug aauugacaga c 21 <210> 13 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-1273g-3p <400> 13 accacugcac uccagccuga g 21 <210> 14 <211> 23 <212> RNA <213> Artificial <220> <223> hsa-miR-19a-3p <400> 14 ugugcaaauc uaugcaaaac uga 23 <210> 15 <211> 22 <212> RNA <213> Artificial <220> <223> hsa-miR-223-3p <400> 15 ugucaguuug ucaaauaccc ca 22 <210> 16 <211> 23 <212> RNA <213> Artificial <220> <223> hsa-miR-19b-3p <400> 16 ugugcaaauc caugcaaaac uga 23 <210> 17 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-31-5p <400> 17 aggcaagaug cuggcauagc u 21 <210> 18 <211> 23 <212> RNA <213> Artificial <220> <223> hsa-miR-17-5p <400> 18 caaagugcuu acagugcagg uag 23 <210> 19 <211> 22 <212> RNA <213> Artificial <220> <223> hsa-miR-205-5p <400> 19 uccuucauuc caccggaguc ug 22 <210> 20 <211> 22 <212> RNA <213> Artificial <220> <223> hsa-miR-4449 <400> 20 cgucccgggg cugcgcgagg ca 22 <210> 21 <211> 23 <212> RNA <213> Artificial <220> <223> hsa-miR-106a-5p <400> 21 aaaagugcuu acagugcagg uag 23 <210> 22 <211> 21 <212> RNA <213> Artificial <220> <223> hsa-miR-514a-3p <400> 22 auugacacuu cugugaguag a 21 <210> 23 <211> 22 <212> RNA <213> Artificial <220> <223> hsa-miR-125b-5p <400> 23 ucccugagac ccuaacuugu ga 22 SEQUENCE LISTING <110> THE ASAN FOUNDATION University of Ulsan Foundation For Industry Cooperation <120> Urinary exosome-derived miRNA gene biomarkers for diagnosis of BK virus nephropathy in kidney allografts and use thereof <130> 1065626 <160> 23 <170> PatentIn version 3.2 <210> 1 <211> 22 <212> RNA <213> artificial <220> <223> hsa-miR-126-3p <400> 1 ucguaccgug aguaauaug cg 22 <210> 2 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-126-5p <400> 2 cauuauuacu uuugguacgc g 21 <210> 3 <211> 23 <212> RNA <213> artificial <220> <223> hsa-miR-328-5p <400> 3 gggggggcag gaggggcuca ggg 23 <210> 4 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-455-3p <400> 4 gcaguccaug ggcauauaca c 21 <210> 5 <211> 23 <212> RNA <213> artificial <220> <223> hsa-miR-103a-3p <400> 5 agcagcauug uacaggggcua uga 23 <210> 6 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-192-5p <400> 6 cugaccuaug aauugacagc c 21 <210> 7 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-331-3p <400> 7 gccccugggc cuauccuaga a 21 <210> 8 <211> 19 <212> RNA <213> artificial <220> <223> hsa-miR-1290 <400> 8 uggauuuuug gaucaggga 19 <210> 9 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-8485 <400> 9 cacacacaca cacacacgua u 21 <210> 10 <211> 23 <212> RNA <213> artificial <220> <223> hsa-miR-221-3p <400> 10 agcuacauug ucugcugggu uuc 23 <210> 11 <211> 22 <212> RNA <213> artificial <220> <223> hsa-miR-345-5p <400> 11 gcugacuccu aguccagggc uc 22 <210> 12 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-215-5p <400> 12 augaccuaug aauugacaga c 21 <210> 13 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-1273g-3p <400> 13 accacugcac uccagccuga g 21 <210> 14 <211> 23 <212> RNA <213> artificial <220> <223> hsa-miR-19a-3p <400> 14 uugcaaauc uaugcaaaac uga 23 <210> 15 <211> 22 <212> RNA <213> artificial <220> <223> hsa-miR-223-3p <400> 15 ugucaguuug ucaaauaccc ca 22 <210> 16 <211> 23 <212> RNA <213> artificial <220> <223> hsa-miR-19b-3p <400> 16 uggcaaauc caugcaaaac uga 23 <210> 17 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-31-5p <400> 17 aggcaagaug cuggcauagc u 21 <210> 18 <211> 23 <212> RNA <213> artificial <220> <223> hsa-miR-17-5p <400> 18 caaagugcuu acagugcagg uag 23 <210> 19 <211> 22 <212> RNA <213> artificial <220> <223> hsa-miR-205-5p <400> 19 uccuucauuc caccggaguc ug 22 <210> 20 <211> 22 <212> RNA <213> artificial <220> <223> hsa-miR-4449 <400> 20 cgucccgggg cugcgcgagg ca 22 <210> 21 <211> 23 <212> RNA <213> artificial <220> <223> hsa-miR-106a-5p <400> 21 aaaagugcuu acagugcagg uag 23 <210> 22 <211> 21 <212> RNA <213> artificial <220> <223> hsa-miR-514a-3p <400> 22 auugacacuu cugugaguag a 21 <210> 23 <211> 22 <212> RNA <213> artificial <220> <223> hsa-miR-125b-5p <400> 23 cccuugagac ccuaacuugu ga 22

Claims

BK virus nephropathy, including hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p miRNA genes A biomarker composition for diagnosing nephropathy).

According to claim 1, hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p and A biomarker composition for diagnosing BK virus nephropathy, further comprising any one or more miRNA genes selected from the group consisting of hsa-miR-17-5p.

Including agents for measuring the expression levels of hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p miRNA genes, A composition for diagnosing BK virus nephropathy.

According to claim 3, hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p and A composition for diagnosing BK virus nephropathy, further comprising an agent for measuring the expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-17-5p.

The method of claim 4, wherein the hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p Expression of hsa-miR-17-5p, hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p miRNA genes A composition for diagnosing BK virus nephropathy, wherein the agent for measuring the level comprises a primer or probe that specifically binds to the gene.

A kit for diagnosing BK virus nephropathy, comprising the composition of claim 3 or 4.

The kit for diagnosing BK virus nephropathy according to claim 6, wherein the kit is a real-time PCR (RT-PCR) kit, a microarray kit, or a Serial Analysis of Gene Expression (SAGE) kit.

(a) hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p miRNA genes in biological samples isolated from individuals measuring the expression level; and
(b) hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p miRNA genes measured in step (a) above A method for providing information for diagnosis of BK virus nephropathy, comprising the step of comparing the expression level of with the expression level of the same miRNA gene measured in a biological sample isolated from a normal control group.

The method of claim 8, wherein (c) in the biological sample isolated from the subject in step (a) and the biological sample isolated from the normal control in step (b), hsa-miR-8485, hsa-miR-221-3p , hsa-miR-331-3p, hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p and hsa-miR-17-5p of any one or more miRNA genes selected from the group consisting of Further measuring each expression level; and
(d) hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, hsa-miR-1290, hsa further measured in biological samples isolated from the subject in step (a) - The expression level of any one or more miRNA genes selected from the group consisting of miR-19b-3p, hsa-miR-31-5p and hsa-miR-17-5p, the biological Comparing with the same miRNA gene expression level additionally measured in the sample; further comprising a method for providing information for diagnosis of BK virus nephropathy.

The method of claim 8 or 9, wherein the biological sample is urine or urine-derived exosomes.

According to claim 8, (e-1) hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa measured in step (a) -If the expression level of the miR-125b-5p miRNA gene is higher than the expression level of the same miRNA gene measured in the biological sample isolated from the normal control group in step (b), a step of diagnosing BK virus nephropathy is added. A method for providing information for diagnosing BK virus nephropathy.

The method of claim 9, wherein (e-2) hsa-miR-8485, hsa-miR-221-3p, hsa-miR-331-3p, which are additionally measured in biological samples isolated from the subject in step (a) , the expression level of any one or more miRNA genes selected from the group consisting of hsa-miR-1290, hsa-miR-19b-3p, hsa-miR-31-5p and hsa-miR-17-5p, (b) A method for providing information for diagnosis of BK virus nephropathy, further comprising diagnosing BK virus nephropathy if the expression level of the same miRNA gene additionally measured in the biological sample isolated from the normal control group of the step is increased. .

Differentiate from kidney transplant rejection, including hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p miRNA genes A biomarker composition for diagnosing BK virus nephropathy.

The method of claim 13, wherein the kidney transplant rejection is antibody mediated rejection (ABMR), T cell mediated rejection (TCMR), or a mixed rejection reaction in which both appear in combination. (Mixed rejection), a biomarker composition for diagnosing BK virus nephropathy, as distinguished from kidney transplant rejection.

Including agents for measuring the expression levels of hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p miRNA genes, A composition for diagnosing BK virus nephropathy in distinction from kidney transplant rejection.

The method of claim 15, wherein the expression levels of the hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p miRNA genes The agent to be measured is a composition for diagnosing BK virus nephropathy in distinction from kidney transplant rejection, including a primer or probe that specifically binds to the gene.

A kit for diagnosing BK virus nephropathy separately from kidney transplant rejection, comprising the composition of claim 15 or 16.

The method of claim 17, wherein the kit is a real-time PCR (RT-PCR) kit, a microarray kit, or a serial analysis of gene expression (SAGE) kit, for diagnosing BK virus nephropathy in distinction from kidney transplant rejection. kit.

(a) hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p miRNA genes in biological samples isolated from individuals measuring the expression level; and
(b) hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR-125b-5p miRNA genes measured in step (a) above A method of providing information for diagnosing BK virus nephropathy by distinguishing it from renal transplant rejection, comprising comparing the expression level of the same miRNA gene measured in a biological sample isolated from a normal control group.

The method of claim 19, wherein the biological sample is urine or urine-derived exosomes.

The method of claim 19, (c) hsa-miR-205-5p, hsa-miR-4449, hsa-miR-106a-5p, hsa-miR-514a-3p and hsa-miR measured in step (a) If the expression level of the 125b-5p miRNA gene is higher than the expression level of the same miRNA gene measured in the biological sample isolated from the normal control group in step (b) above, BK virus nephropathy without renal transplant rejection Information providing method for diagnosing BK virus nephropathy by distinguishing it from kidney transplant rejection, further comprising the step of diagnosing as.

delete