KR102498098B1 - Biomarker composition for diagnosing idiopathic nephrotic syndrome and use thereof - Google Patents

Abstract

The present invention relates to a piwi-interacting RNA (piRNA) biomarker composition and use thereof for the diagnosis of idiopathic nephrotic syndrome, and more particularly, in the group consisting of piR-33064, piR-36365 and piR-54518 Provided is a biomarker composition for diagnosing idiopathic nephrotic syndrome comprising at least one selected piRNA as an active ingredient.
The composition can diagnose idiopathic nephrotic syndrome more easily by including piRNA specifically expressed in idiopathic nephrotic syndrome, and by diagnosing idiopathic nephrotic syndrome at an early stage, worsening symptoms and complications thereof through appropriate treatment accordingly By minimizing it, idiopathic nephrotic syndrome can be treated more effectively.

Description

Biomarker composition for diagnosis of idiopathic nephrotic syndrome and its use {BIOMARKER COMPOSITION FOR DIAGNOSING IDIOPATHIC NEPHROTIC SYNDROME AND USE THEREOF}

The present invention relates to a piwi-interacting RNA (piRNA) biomarker composition for the diagnosis of idiopathic nephrotic syndrome (INS) and its use.

Primary nephrotic syndrome is defined as characterized by severe edema, massive proteinuria and blood hypoalbuminemia. The cause of primary nephrotic syndrome is glomerulitis, in which the glomerulus of the kidney becomes inflamed. There are more than 10 types of glomerulonephritis. (idiopathic nephrotic syndrome, INS) accounts for the majority. Primary nephrotic syndrome is characterized by various treatment methods and treatment prognoses for each disease. MGN generally does not respond to steroid therapy alone, and resolution requires combination therapy with high-dose steroids and other immunosuppressive agents such as cyclophosphamide. Despite these treatments, there are also refractory MGN that do not respond to treatment.

In order to accurately diagnose the causative disease in nephrotic syndrome, an invasive kidney biopsy that collects kidney tissue using a gun needle is essential. In addition, invasive biopsy is a very dangerous test when taking antiplatelet agents and anticoagulation, which are taken for the recurrence of heart disease and cerebrovascular disease. Therefore, in addition to biopsy, which is an invasive diagnostic method, it is very important to develop non-invasive biomarkers that help confirm the disease or when invasive biopsy is not possible.

On the other hand, piwi-interacting RNA (piRNA; piR) is a non-coding RNA expressed in animal cells and is known to be involved in the post-transcriptional process and epigenomic regulation of organisms, and recently, such piRNA has been used in biotechnology for disease diagnosis. Research for use as a marker is ongoing. Most of the biomarkers currently used clinically are proteins circulating in body fluids, but unfortunately, the development of new protein-based biomarkers faces considerable technical difficulties due to the low affinity of the target protein in the sample. Development can be an alternative that can overcome the limitations of protein biomarkers.

Republic of Korea Patent Publication No. 10-2008-0091234 (2008.10.09. Publication)

An object of the present invention is to provide a composition capable of effectively diagnosing idiopathic nephrotic syndrome.

Another object of the present invention is to provide a method for providing information necessary for diagnosing idiopathic nephrotic syndrome.

In order to achieve the above object, the present invention provides a biomarker composition for diagnosing idiopathic nephrotic syndrome comprising at least one piRNA selected from the group consisting of piR-33064, piR-36365 and piR-54518 as an active ingredient.

The present invention relates to a composition for diagnosing idiopathic nephrotic syndrome comprising, as an active ingredient, an agent capable of measuring the expression level of any one or more piRNAs selected from the group consisting of piR-33064, piR-36365 and piR-54518, and idiopathic nephrotic syndrome comprising the same Diagnostic kits are provided.

In addition, the present invention comprises the steps of measuring the expression level of any one or more piRNAs selected from the group consisting of piR-33064, piR-36365 and piR-54518 from a sample isolated from a patient; and comparing the expression level of the piRNA with that of a normal control sample.

The composition according to the present invention can diagnose idiopathic nephrotic syndrome more easily by including piRNA specifically expressed in idiopathic nephrotic syndrome.

By diagnosing idiopathic nephrotic syndrome early using this, it is possible to treat idiopathic nephrotic syndrome more effectively by minimizing worsening of symptoms and complications thereof through appropriate treatment accordingly.

Figure 1 is a result of comparative analysis of the expression level of piRNA-linked RNA (piRNA) in exosomes isolated from the serum of subjects with normal group (HV) and idiopathic nephrotic syndrome (INS). This is the result of a heat map performed by hierarchical clustering according to the expression level of piRNA whose expression was significantly reduced or increased by more than 2 times (p < 0.05) in the syndrome, and FIG. 1b is a scatter plot according to the expression level of the piRNA detected above ( scatter plot) result.
Figure 2 is a result of comparative analysis of the expression level of piRNA in exosomes isolated from the serum of subjects with idiopathic nephrotic syndrome (INS) and membranous glomerulonephritis (MGN), Figure 2a is significant in membranous glomerulonephritis compared to idiopathic nephrotic syndrome It is a heat map result of performing hierarchical clustering according to the expression level of piRNA whose expression is decreased or increased by more than 2 times (p < 0.05), and FIG. 2b is a scatter plot result according to the expression level of the piRNA detected above.
Figure 3 is a result of comparative analysis of the expression level of piRNA in exosomes isolated from the serum of normal group (HV) and membranous glomerulonephritis (MGN) subjects. It is a heat map result of performing hierarchical clustering according to the expression level of the piRNA whose expression is decreased or increased by more than twofold (p < 0.05), and FIG. 3B is a scatter plot result according to the expression level of the piRNA detected above.
Figure 4 shows only the piRNA whose expression was significantly changed from the results of Figures 1, 2, and 3 in a Venn diagram, showing that the expression was changed only in idiopathic nephrotic syndrome (INS) compared to the normal group (HV) or the membranous glomerulonephritis group (MGN). This is the result of deriving only piRNA (4).
Figure 5 is a result of confirming the significant expression difference between the normal group (HV), membranous glomerulonephritis (MGN) and idiopathic nephrotic syndrome (INS) of the three piRNAs derived in Figure 4 above.

Hereinafter, the present invention will be described in detail.

The present inventors analyzed piRNA present in serum-derived exosomes to discover biomarkers that can effectively diagnose idiopathic nephrotic syndrome, and significantly increased or decreased expression in the idiopathic nephrotic syndrome patient group compared to the normal control group or membranous glomerulonephritis patient group The present invention was completed by identifying piRNAs that do.

The present invention provides a biomarker composition for diagnosing idiopathic nephrotic syndrome comprising at least one piRNA selected from the group consisting of piR-33064, piR-36365 and piR-54518 as an active ingredient.

In the present specification, "idiopathic nephrotic syndrome (INS)" is a renal disease that develops without any preceding disease or factor, and is caused by protein leakage in urine due to unknown cause of glomerular dysfunction, leading to hypoproteinemia. It is a disease that causes edema or hyperlipidemia.

In the present specification, "diagnosis" means to confirm the presence or characteristics of a pathological state, and for the purpose of the present invention, it means to determine whether or not there is an occurrence of idiopathic nephrotic syndrome or the possibility of inventing it, idiopathic nephrotic syndrome or at least one thereof. determining a subject's susceptibility to one or more symptoms, therametrics (eg, monitoring a subject's condition to provide information about the efficacy of a treatment), and the like. It also includes primary diagnosis of a clinical condition or diagnosis of a recurrent disease.

In the present specification, a "biomarker" is an indicator that can detect changes in the body, and is a substance that can determine the normal or pathological state of a living organism, whether or not it is changed, and includes polypeptides, nucleic acids, lipids, and glycolipids. , glycoproteins, organic biomolecules such as sugars (monosaccharides, disaccharides, oligosaccharides, etc.), etc., and using them, it is possible to diagnose idiopathic nephrotic syndrome as in the present invention.

In the biomarker composition, the piRNA may be derived from exosomes, more preferably from blood or serum-derived exosomes, but is not limited thereto.

More specifically, the piR-33064 may consist of the nucleotide sequence represented by SEQ ID NO: 1, the piR-36365 may consist of the nucleotide sequence represented by SEQ ID NO: 2, and the piR-54518 may consist of the nucleotide sequence represented by SEQ ID NO: 3 It may consist of the indicated nucleotide sequence.

-piR-33064: ccccuggucgucuagugguuaggauucggc (SEQ ID NO: 1)

-piR-36365: ggugguggugguggaggugguggaggugga (SEQ ID NO: 2)

-piR-54518: uggauugauugcaaaauggggcuaaguggc (SEQ ID NO: 3)

Expression of the piRNA may be significantly changed in the idiopathic nephrotic syndrome patient group compared to the normal control group or the membranous glomerulonephritis patient group.

Preferably, the expression of piR-33064 or piR-36365 can be significantly increased in idiopathic nephrotic syndrome compared to normal controls, and the piR-54518 is significantly expressed in idiopathic nephrotic syndrome compared to normal controls this may be reduced.

Alternatively, the expression of piR-33064 or piR-36365 can be significantly increased in idiopathic nephrotic syndrome compared to the membranous glomerulonephritis patient group, and the piR-54518 is significant in idiopathic nephrotic syndrome compared to the membranous glomerulonephritis patient group expression may be reduced.

According to one embodiment of the present invention, the expression level of the piRNA in idiopathic nephrotic syndrome compared to the expression level of piR-33064 or piR-36365 in the normal control group calculated as a log2 (fold change) value may be 2 to 3 , The expression level of the piRNA in idiopathic nephrotic syndrome compared to the expression level of piR-54518 in the normal control group may be -5 to -6.

Alternatively, the expression level of the piRNA in idiopathic nephrotic syndrome compared to the expression level of piR-33064 or piR-36365 in the membranous glomerulonephritis patient group may be 2 to 4, calculated as a log2 (fold change) value, and the membranous glomerulonephritis patient group The value obtained by calculating the expression level of the piRNA of idiopathic nephrotic syndrome as a log2 (fold change) value relative to the expression level of piR-54518 in the piR-54518 may be -2 to -3.

Since the biomarker according to the present invention shows the same results even in repeated experiments, and the change in its expression level shows significant results, it can be regarded as a highly reliable marker, and thus the predicted results can be reasonably trusted.

The present invention provides a composition for diagnosis of idiopathic nephrotic syndrome comprising, as an active ingredient, an agent capable of measuring the expression level of at least one piRNA selected from the group consisting of piR-33064, piR-36365 and piR-54518.

An agent capable of measuring the expression level of the piRNA may be a primer or probe that specifically binds to the piRNA, but is not limited thereto.

As used herein, a "primer" is a nucleic acid sequence having a short free 3' hydroxl group, capable of forming base pairs with a complementary template and serving as a starting point for template strand copying. Refers to a short nucleic acid sequence. The primer can initiate DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleotide triphosphates in an appropriate buffer and temperature. PCR conditions and lengths of sense and antisense primers can be appropriately selected according to techniques known in the art.

In the present specification, "probe" refers to a fragment of several to hundreds of nucleotide sequences capable of specifically binding to piRNA, and is labeled so that the presence or absence of the piRNA and the expression level can be confirmed. Appropriate probes and hybridization conditions can be appropriately selected according to techniques known in the art.

The present invention provides a kit for diagnosing idiopathic nephrotic syndrome comprising the composition for diagnosing idiopathic nephrotic syndrome. The kit can be used to diagnose the occurrence of idiopathic nephrotic syndrome by measuring the expression level of the piRNA in a sample isolated from an individual suspected of having idiopathic nephrotic syndrome.

The kit for diagnosing idiopathic nephrotic syndrome may include not only an agent for measuring the piRNA expression level, but also one or more other component compositions, solutions, or devices suitable for analysis methods.

For example, the kit according to the present invention includes genomic DNA derived from a sample to be analyzed to perform PCR, a primer set specific for the marker gene of the present invention, an appropriate amount of DNA polymerase, a dNTP mixture, a PCR buffer and It may be a kit containing water. The PCR buffer may contain KCl, Tris-HCl and MgCl2. In addition, the kit of the present invention may additionally include components necessary for performing electrophoresis to confirm whether the PCR product is amplified or not.

In addition, the kit according to the present invention may be a kit including essential elements necessary for performing RT-PCR. The RT-PCR kit contains, in addition to each pair of primers specific for a marker gene, a test tube or other suitable container, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC -Water (DEPC-water), sterilized water, etc. may be included. It may also include a primer pair specific to a gene used as a quantitative control.

The present invention comprises the steps of measuring the expression level of any one or more piRNAs selected from the group consisting of piR-33064, piR-36365 and piR-54518 from a sample isolated from a patient; and comparing the expression level of the piRNA with that of a normal control sample.

The method for providing information necessary for diagnosing idiopathic nephrotic syndrome may further include comparing the expression level of the piRNA with membranous glomerulonephritis patient group samples.

The sample may include tissue, cell, whole blood, blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine, preferably blood or serum, and more preferably blood or serum-derived exosomes. However, it is not limited thereto.

If the expression level of the piRNA is increased or decreased compared to the normal control group or membranous glomerulonephritis patient group sample, it can be determined that the possibility of idiopathic nephrotic syndrome is high.

Preferably, when the expression level of the piR-33064 or piR-36365 is higher than that of the normal control sample; or when the expression level of the piR-54518 is lower than that of the normal control sample; It can be judged that the possibility of idiopathic nephrotic syndrome is high.

In addition, if the expression level of the piR-33064 or piR-36365 is increased than the expression level of the membranous glomerulonephritis patient group sample; or when the expression level of the piR-54518 is lower than that of the membranous glomerulonephritis patient group sample; It can be judged that the possibility of idiopathic nephrotic syndrome is high.

According to one embodiment of the present invention, the expression level of the piRNA in idiopathic nephrotic syndrome compared to the expression level of piR-33064 or piR-36365 in the normal control group is calculated as a log2 (fold change) value of 2 to 3, or normal When the value obtained by calculating the expression level of the piRNA in idiopathic nephrotic syndrome as a log2 (fold change) value compared to the expression level of piR-54518 in the control group is -5 to -6, it can be determined that the possibility of idiopathic nephrotic syndrome is high.

In addition, the expression level of the piRNA of idiopathic nephrotic syndrome compared to the expression level of piR-33064 or piR-36365 in the membranous glomerulonephritis patient group is calculated as a log2 (fold change) value of 2 to 4, or the piR of the membranous glomerulonephritis patient group -54518 When the expression level of idiopathic nephrotic syndrome compared to the expression level of idiopathic nephrotic syndrome is calculated as a log2 (fold change) value of -2 to -3, it can be determined that the possibility of idiopathic nephrotic syndrome is high.

The expression level of the piRNA is polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), competitive RT-PCR (Competitive RT-PCR), real-time RT-PCR (Real-time RT-PCR), RNase It can be measured by one or more methods selected from the group consisting of RNase protection assay (RPA), Northern blotting, and DNA microarray chip, but is not limited thereto.

The method for providing information necessary for diagnosing idiopathic nephrotic syndrome may further include a step of confirming an increased level of proteinuria from a sample isolated from a patient, but is not limited thereto.

Hereinafter, examples will be described in detail to aid understanding of the present invention. However, the following examples are merely illustrative of the contents of the present invention, but the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.

<Experimental example>

The following experimental examples are intended to provide items commonly applied to each embodiment according to the present invention.

1. Recruitment of analysis subjects

In order to diagnose idiopathic nephrotic syndrome early and to discover biomarkers for diagnosis of idiopathic nephrotic syndrome to prevent the development of complications related to idiopathic nephrotic syndrome, 20 normal group (HV) and 19 membranous glomerulonephritis group (MGN), respectively. 21 subjects with idiopathic nephrotic syndrome (INS) were recruited, and serum was provided from subjects in each group.

2. RNA isolation and sequencing from serum

Previously, exosomes were isolated using Exoquick (SBI, USA) from serum samples collected from subjects in each group, and total RNA was extracted from the isolated exosomes using Qiagen miRNeasy kit, and extraction The quality of total RNA obtained was measured using an Agilent RNA Bioanalyzer according to the manufacturer's instructions.

Then, using the isolated RNA, a library was prepared using Takara SMARTer smRNA for illumina kit from Macrogen, and piRNA was detected by next-generation sequencing (NGS) using Hiseq 2500.

<Example 1> Identification of piRNA for diagnosis of idiopathic nephrotic syndrome

1. Normal vs. normal group Differences in the expression level of idiopathic nephrotic syndrome piRNA check

First, in order to identify piRNAs with different expression levels in the blood-derived exosomes of 20 normal people and 21 people with idiopathic nephrotic syndrome recruited as in the previous experimental example, exosomes from serum collected from each subject as in the above experimental example was isolated and NGS analysis was performed on the extracted total RNA. As a result of the analysis, 408 piRNAs were detected, and the expression levels of the detected piRNAs were further compared.

As a result, as shown in FIG. 1a, when comparing the normal group and the idiopathic nephrotic syndrome, 39 of the 85 piRNAs with a 2-fold or more expression difference and p < 0.05 showed increased expression and 46 decreased expression. Confirmed. In addition, the scatter plot result according to the expression level of piRNA showing the significant expression change was confirmed as shown in FIG. 1B.

2. Idiopathic nephrotic syndrome vs. Identification of piRNA with difference in expression level of membranous glomerulonephritis

In order to identify piRNAs having different expression levels in blood-derived exosomes of 21 patients with idiopathic nephrotic syndrome and 19 patients with membranous glomerulonephritis, NGS analysis was performed on total RNA in exosomes obtained in the same manner as above. As a result of the analysis, 408 piRNAs were detected, and the expression levels of the detected piRNAs were compared.

As a result, as shown in FIG. 2a, when idiopathic nephrotic syndrome and membranous glomerulonephritis were compared, 22 of the 45 piRNAs with a 2-fold or more expression difference and p < 0.05 increased expression, and 23 decreased expression identified as a dog. In addition, the scatter plot result according to the expression level of piRNA showing the significant expression change was confirmed as shown in FIG. 2b.

3. Normal control vs. Identification of piRNA with difference in expression level of membranous glomerulonephritis

In order to identify piRNAs having different expression levels in the blood-derived exosomes of 20 normal patients and 19 patients with membranous glomerulonephritis, NGS analysis was performed on total RNA in exosomes obtained in the same manner as described above. As a result of the analysis, 408 piRNAs were detected, and the expression levels of the detected piRNAs were compared.

As a result, as shown in FIG. 3a, when comparing the normal group and membranous glomerulonephritis, 11 out of 17 piRNAs with a 2-fold or more expression difference and p < 0.05 showed increased expression and 6 decreased expression. Confirmed. In addition, the scatter plot result according to the expression level of the piRNA showing the significant expression change was confirmed as shown in FIG. 3b.

4. Identification of piRNA for diagnosis of idiopathic nephrotic syndrome

In order to discover piRNAs capable of specifically diagnosing idiopathic nephrotic syndrome based on the results identified above, the piRNAs whose expression was significantly changed as a result of each analysis were shown in a Venn diagram as shown in FIG.

As a result, 4 piRNAs whose expression was significantly changed in idiopathic nephrotic syndrome compared to the normal group and membranous glomerulonephritis were identified.

Table 1 below shows the three types of piRNAs that were significantly changed.

piRNA sequence No. compared to normal group
fold change membranous glomerulonephritis
Contrast fold change hsa-piR-33064 ccccuggucgucuagugguuaggauucggc SEQ ID NO: 1 2.89 (p<0.001) 2.58
(p=0.0024) hsa-piR-36365 ggugguggugguggaggugguggaggugga SEQ ID NO: 2 2.80 (p<0.05) 3.46
(p=0.0063) hsa-piR-54518 uggauugauugcaaaauggggcuaaguggc SEQ ID NO: 3 -5.77 (p<0.001) -2.86
(p=0.0027)

Referring to Figure 5 and Table 1 confirming the significant difference between the normal group or membranous glomerulonephritis and idiopathic nephrotic syndrome of the piRNA, the three piRNAs were 2.89 times, 2.80 times and 2.80 times respectively compared to the normal group in idiopathic nephrotic syndrome. It can be seen that it shows a significant difference of 5.77 times, and shows a significant difference of 2.58 times, 3.46 times and 2.86 times compared to membranous glomerulonephritis.

Therefore, the above results show that the three piRNAs whose expression is significantly changed only in idiopathic nephrotic syndrome, compared to the normal group or membranous glomerulonephritis, can be usefully used as biomarkers that can specifically diagnose idiopathic nephrotic syndrome. .

<Example 2> Confirmation of serum indicators

In the serum of 20 normal group (HV), 19 membranous glomerulonephritis (MGN), and 21 idiopathic nephrotic syndrome (INS) collected in the previous experimental example, the level changes of various indicators were confirmed as shown in Table 2.

Variables Study subjects P value
(MGN vs Idiopathic NS) HVs (n = 20) MGN (n = 19) Idiopathic NS
(n = 21) AGE 51.9±12.4 54.4±13.7 61.0±16.2 0.797 Sex (Male) 11 (55%) 11 (57.9%) 12 (57.1%) 0.962 WBC 5364.6±588.8 7490.7±1466.7* 6985.5±1914.1 0.96 Hb 13.9±1.3 13.2±2.0 13.7±1.7 0.398 PLT (K) 219.9±48.1 303.0±100.2* 289.3±70.3** 0.209 BUN 12.9±3.2 14.1±5.5 21.3±10.4 0.009 Cr 0.9±0.2 0.9±0.2 1.3±0.8** 0.04 eGFR 88.2±15.7 81.5±23.2 70.1±38.2 0.360 Baseline proteinuria (g/day)
82.3±49.3
7046.3±4423.2*
9023.6±4062.6**
0.220 AST 19.5±7.0 26.4±10.1* 31.1±19.5** 0.892 ALT 18.9±9.1 19.7±8.2 27.9±22.1 0.188 Total protein 7.2±0.3 4.8±0.7* 5.1±1.2** 0.366 Albumin 4.6±0.2 2.4±0.6* 2.5±1.1** 0.775 CRP 0.1±0.2 0.3±0.5* 0.2±0.2** 0.668 Total cholesterol 192.9±28.5 300.3±94.1* 340.3±116.0** 0.445 Triglycerides 108.7±48.4 332.2±214.9* 454.1±350.9** 0.871 HDL 60.8±9.3 53.1±19.0 58.1±21.4 0.552 LDL 123.8±30.1 180.8±98.7 201.9±84.3** 0.913

(* HVs vs MGN P value < 0.05; ** HVs vs Idiopathic NS P value < 0.05 HVs-Health volunteers, MGN-Membranous glomerulonephritis, NSnephrotic syndrome. Hb-hemoglobin, PLT-platelet, BUN-blood urea nitrogen, Crcreatinine, eGFR -estimated glomerular filtration rate, HDL-high density lipoprotein, LDL-low density lipoprotein)

Having described specific parts of the present invention in detail above, it is clear to those skilled in the art that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. do. That is, the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> Research Cooperation Foundation of Yeungnam University <120> BIOMARKER COMPOSITION FOR DIAGNOSING IDIOPATHIC NEPHROTIC SYNDROME AND USE THEREOF <130> ADP-2021-0251 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 30 <212> RNA <213> artificial sequence <220> <223> piR-33064 <400> 1 ccccuggucg ucuagugguu aggauucggc 30 <210> 2 <211> 30 <212> RNA <213> artificial sequence <220> <223> piR-36365 <400> 2 ggugguggug guggaggugg uggaggugga 30 <210> 3 <211> 29 <212> RNA <213> artificial sequence <220> <223> piR-54518 <400> 3 uggauugauu gcaaaauggg cuaaguggc 29

Claims (13)

A biomarker composition for diagnosing idiopathic nephrotic syndrome comprising at least one piRNA selected from the group consisting of piR-33064, piR-36365 and piR-54518 as an active ingredient. According to claim 1,
The piR-33064 or piR-36365,
A biomarker composition for diagnosing idiopathic nephrotic syndrome, characterized in that the expression is increased compared to a normal control group. According to claim 1,
The piR-54518,
A biomarker composition for diagnosing idiopathic nephrotic syndrome, characterized in that the expression is reduced compared to a normal control group. According to claim 1,
The piRNA is
A biomarker composition for diagnosis of idiopathic nephrotic syndrome, characterized in that it is derived from exosomes. According to claim 4,
The exosome,
A biomarker composition for diagnosis of idiopathic nephrotic syndrome, characterized in that it is derived from blood or serum. A composition for diagnosis of idiopathic nephrotic syndrome comprising, as an active ingredient, an agent capable of measuring the expression level of any one or more piRNAs selected from the group consisting of piR-33064, piR-36365 and piR-54518. According to claim 6,
The agent capable of measuring the expression level of the piRNA,
A composition for diagnosing idiopathic nephrotic syndrome, characterized in that the primer or probe specifically binds to the piRNA. A kit for diagnosing idiopathic nephrotic syndrome comprising the composition of claim 6 or 7. Measuring the expression level of at least one piRNA selected from the group consisting of piR-33064, piR-36365 and piR-54518 from a sample isolated from the patient; and
A method for providing information necessary for diagnosing idiopathic nephrotic syndrome, comprising: comparing the expression level of the piRNA with a normal control sample. According to claim 9,
The method,
Comparing the expression level of the piRNA with membranous glomerulonephritis patient group samples; method for providing information necessary for diagnosing idiopathic nephrotic syndrome, characterized in that it further comprises. According to claim 9 or 10,
The sample is
A method for providing information necessary for diagnosis of idiopathic nephrotic syndrome, characterized in that it is blood or serum. According to claim 11,
The sample is
A method for providing information necessary for diagnosis of idiopathic nephrotic syndrome, characterized in that it is blood or serum-derived exosomes. According to claim 9,
The method,
A method for providing information necessary for diagnosing idiopathic nephrotic syndrome, further comprising the step of confirming an increased level of proteinuria from a sample isolated from the patient.

Images