CN106811512A - A kind of micro-deleted method in quick detection people Y chromosome AZF areas, kit and its preparation - Google Patents

Abstract

The present invention relates to field of gene detection, and in particular to a kind of micro-deleted method in quick detection people Y chromosome AZF areas, kit and its preparation.The kit includes sample treatment solution, at least one PCR reaction solutions, and every kind of PCR reaction solutions include the primer and probe for internal standard gene and at least one different STS sites.The kit that the present invention is provided hands-free can take genomic DNA, and detection people Y chromosome AZF areas are micro-deleted easily and fast, exactly.

Description

A kind of micro-deleted method in quick detection people Y chromosome AZF areas, kit and its preparation

Technical field

The present invention relates to field of gene detection, and in particular to a kind of quick detection people Y chromosome AZF areas are micro- to be lacked The method of mistake, kit and its preparation.

Background technology

10%~15% is there are about in male sterility patient because the idiopathic caused by Spermatogenic failure is without sperm Or few sperm.Cause idiopathic azoospermatism (idiopathic azoospermia), idiopathic severe oligospermia (idiopathic severe oligozoospermia), idiopathic aspermia or oligospermia (idiopathic oligozoospermia) Reason is extremely complex, and genetic defect is one of major reason therein.1976, Tiepolo etc. lost in cell Pass to learn and find that patients with azoospermia has a long-armed missing of Y chromosome in research, including distal end phosphor region and therewith Connected non-fluorescence area, therefore speculate that Yq11 has Y chromosome Gene of Spermatogenesis or gene family (azoosper-miafactor, AZF's) is micro-deleted, referred to as " without sperm factor ".Current document announcement, in nothing In the patient of sperm disease and oligospermatism, have AZF missings accounts for 3%~29%, and incidence is only second to Klinefelter syndromes (klinefelter syndrome), are to occupy deputy inherent cause.

There is influence on Y chromosome spermatogenetic without sperm factor (AZF) region, can further be divided into Tetra- regions of AZFa, AZFb, AZFc and AZFd.The missing in these regions will cause spermatogenesis obstacle, Few smart, weak essence, without diseases such as smart or abnormal essences.

First kind prior art is PCR- agarose gel electrophoresis methods (such as CN101575647B, one kind The micro-deleted gene tester of Y chromosome；CN200710074317.X, the micro-deleted base of male Y chromosome Because of detection kit and detection method；CN201210260960.2, a kind of micro-deleted detection reagent of Y chromosome Box；CN201510023696.4, a kind of Amplification thing of the micro-deleted rapid gene detection of Y chromosome, contains Have kit and its application of the Amplification thing), such method has many weak points, and one is that PCR terminates After still need open pipe electrophoresis, not only time-consuming but also may cause false negative result because of pollution；Two be sensitivity compared with It is low to be easily caused false positive results；Three is cumbersome to be unfavorable for extensive pattern detection.

Equations of The Second Kind prior art is the upgrade version of PCR- agarose gel electrophoresis methods, with sequenator (CN201210439356.6Y, the Amplification thing and detection kit of microdeletion detection), capillary Electrophoresis tube (CN201410425722.1, a kind of micro-deleted kit of detection human Y-chromosome), DHPLC (CN201310537372.3, the micro-deleted primer of detection Y chromosome and kit and its application method) etc. Although method or instrument substitution agarose gel electrophoresis, this several method solve the spirit of agarose gel electrophoresis Sensitivity is low, labor intensive the problems such as, but still open pipe after PCR cannot be solved and operate brought pollution risk, The instruments such as other sequenator, capillary electrophoresis system or HPLC are not only expensive, and instrumentation and As a result the professional requirement of interpretation is higher, is not easy to promote.

3rd class prior art is fluorescence quantitative PCR method, wherein dye method (CN101701248A, Y Microdeletion SYBR Green I real-time fluorescence quantitative PCR detection kits) it is disadvantageous in that dye Material do not have sequence-specific, cause primer dimer can also produce fluorescence and can only substance PCR cannot add Internal standard carries out inner quality control, while a PCR reaction is only capable of one site of detection and causes the work of many site primers Work amount is huge；Using several technical schemes of sonde method, (CN102703578BY, microdeletion is multiple Real-time fluorescence PCR assay kit；CN201210323595.5, detection micro-deleted real-time glimmering of Y chromosome Fluorescent Quantitative PCR kit and method；CN201410489611.7, one kind detection human Y-chromosome is micro-deleted Kit) be disadvantageous in that early stage need to separately extract genomic DNA, not only increase reagent cost And have in time cost, and extraction process because of the risk that misoperation causes cross pollution or sample to be obscured.

The content of the invention

The technical problems to be solved by the invention are：There is provided it is a kind of it is hands-free take genomic DNA, easily and fast, The micro-deleted method in detection people Y chromosome AZF areas, kit and its preparation exactly.

In order to solve the above technical problems, the present invention is adopted the following technical scheme that.

In a first aspect, the present invention relates to a kind of micro-deleted kit in detection people Y chromosome AZF areas, including Sample treatment solution, at least one PCR reaction solutions, wherein every kind of PCR reaction solutions include for internal standard gene and The primer and probe at least one different STS sites.

Second aspect, detection people Y is being prepared the present invention relates to sample treatment solution and at least one PCR reaction solutions Purposes in the micro-deleted kit in chromosome AZF areas, wherein every kind of PCR reaction solutions include being directed to internal standard base Cause and the primer and probe at least one different STS sites.

In a preferred embodiment of the invention, the PCR reaction solutions can for a kind, 2 kinds, 3 kinds, 4 Kind or more is planted.

In a preferred embodiment of the invention, every kind of PCR reaction solutions can comprising for 1,2,3 The primer and probe in individual, 4 or more different STS sites.

In a preferred embodiment of the invention, being directed to included in two or more different PCR reaction solutions The primer and probe in different STS sites can be with independent assortments.

In a preferred embodiment of the invention, being directed to included in two or more different PCR reaction solutions The primer and probe in different STS sites can with for target primer in difference and probe independent assortment.

In a preferred embodiment of the invention, the sample treatment solution include metal ion, Tris buffer solutions and Surfactant, it is preferable that the sample treatment solution includes NaCl, Tris, Triton X-100, SDS, Preferably, NaCl concentration is 100nmol/L, and Tris concentration is 10mmol/L, and Triton X-100 volumes are dense Spend is that 1%, SDS mass concentrations are 10%.

In another preferred embodiment of the invention, primer and probe difference that the PCR reaction solutions include It is preferably described STS at least each 2 STS sites in AZFa, AZFb, AZFc, AZFd area Point is sy84 sites, the sy86 sites in AZFa areas, the sy127 sites in AZFb areas, sy134 sites, AZFc The sy254 sites in area, sy255 sites, the sy145 sites in AZFd areas, sy152 sites are preferably described interior Mark gene is respectively general internal standard gene and sex internal standard gene, and preferably described general internal standard gene is β-actin Gene or zinc finger protein gene (ZFX/ZFY), preferably described sex internal standard gene are sry gene.

In another preferred embodiment of the invention, the PCR reaction solutions include PCR reaction solutions 1, PCR Reaction solution 2, PCR reaction solutions 3, PCR reaction solutions 4, the PCR reaction solutions 1 include being directed to β-actin Gene, sY84 sites, the primer and probe in sY86 sites；The PCR reaction solutions 2 include being directed to SRY Gene, sY127 sites, the primer and probe in sY152 sites；The PCR reaction solutions 3 include being directed to SRY Gene, sY134 sites, the primer and probe in sY254 sites；The PCR reaction solutions 4 include being directed to SRY Gene, sY145 sites, the primer and probe in sY255 sites.

In another preferred embodiment of the invention, the sequence such as sequence table SEQ ID of the primer NO:Shown in 1-20；The sequence of the probe such as sequence table SEQ ID NO:Shown in 21-30.

In another preferred embodiment of the invention, the PCR reaction solutions also include：KCl、MgCl2、 Tris, dNTP Mixture, it is preferable that wherein KCl concentration is that 50m mol/L, MgCl2 concentration are 1.5m Mol/L, Tris concentration are that 10m mol/L, dNTP concentration are 200 μm of ol/L.

In another preferred embodiment of the invention, the kit also includes PCR reaction enzymes, the PCR Reaction enzymes are preferably hot start Taq polymerase, and concentration is preferably 5U/ μ L.

In another preferred embodiment of the invention, the kit also includes that positive reference substance and feminine gender are right According to product, the positive reference substance is preferably normal male genomic DNA, and concentration is preferably 10ng/ μ L；Institute Negative controls preferably normal female genomic DNA is stated, concentration is preferably 10ng/ μ L.

The third aspect, the present invention relates to the use of kit detection people Y chromosome AZF areas of the invention micro-deleted Method, comprise the following steps：1) step treatment sample by the way of sample treatment solution directly mixes with whole blood This；2) the STS sites in detection AZF areas respectively are reacted by PCR using specific primer.

The primer information of table 1

Primer	Primer sequence
		SRY-F	AGATGCTGCCGAAGAATTGC
SRY-R	GTTGCACTTCGCTGCAGAGTAC
		β-actin-F	TCGCCGATAGGATGCAGAA
β-actin-R	AGGAGCAGTGATCTTGATCTTCATT
		sY84-F	AGACATATAAGCTGATAGTCCTGG
sY84-R	AAGGGCCCATATGGGCAC
		sY86-F	CTCACTTTGCAGGACAGAGACTTGG
sY86-R	AGATGCTGTCTTCTCCCTGTGTCCTC
		sY127-F	GAAAAAGATAGCACCCACTGGA
sY127-R	AAAAGAGAAGAAACTTTTTCATG
		sY134-F	GGTCAAAGGAAATAAATAGATGGGG
sY134-R	GCACTTCAGAAACTTAGC
		sY254-F	TGGAGGTTTAGAATTGCTTTTAGGTT
sY254-R	CCAGCAGCCCTTTGTCAAA
		sY255-F	GGATTCGGCGTGATTTGG
sY255-R	AACGTCTGGCGGAATCCA
		sY145-F	CAACACAAAAACACTCATATACTCG
sY145-R	TTGAGAATAATTGTATGTTACGGG
		sY152-F	TGCCATGTTTCAGCTCTTTGA
sY152-R	TTCTGAGATTTGGTGTTCCTGTCTT

The detecting probe information of table 2

Probe title	Probe sequence
		SRY-P	Cy5-TTTGCTTCCCGCAGATCCCGC-BHQ3
β-actin-P	Cy5-CCACCCTGGCGCCCAGCA-BHQ3
		sY84-P	JOE-TGGCTCTACCTCCTTCCCCCAGTGC-BHQ1
sY86-P	FAM-AATCCCAAAGACTGGGCCCCTTAAACA-BHQ1
		sY127-P	FAM-ATCTACCAAAGCCCACTGTGTTCATG-BHQ1
sY134-P	JOE-AACATCTGGAACATTCTACTTGAAGCG-BHQ1
		sY254-P	FAM-CCCATAGGTACTAAAAAT-MGB
sY255-P	VIC-CTGCAGGTAGGTTTC-MGB
		sY145-P	FAM-ACTCGACTTTTGGCTGGGCTGACTACC-BHQ1
sY152-P	VIC-AACAAAATTCATGCTGAAAC-MGB

Key point of the invention and it is intended to protect and is a little：1, the side directly mixed using sample treatment solution and whole blood The step of formula one processes sample；2,4 AZF areas of detection amount to 8 STS sites；Using β-actin, SRY As general internal standard gene and sex internal standard gene.

Advantages of the present invention：1, one-step method treatment sample, it is to avoid sample caused by cross pollution and operational error Originally obscure；2, except generally acknowledged in the industry 36 of AZF areas (AZFa, AZFb, AZFc) STS Point is outer, also newly increases 2 STS sites in AZFd areas, can provide more reference significances for clinical detection.

Possible alternative solution：1, the main component of sample treatment solution is metal ion, Tris buffer solutions and table Face activating agent composition, can be reached ionic strength, buffering effect and the surface-active of sample treatment solution Other reagents of agent effect are replaced；2, interior target selection is the ordinary technical knowledge of this area, general internal standard base Other genes that cause and sex internal standard gene can be reached phase same-action are replaced；Often managed in guarantee necessary On the premise of having an internal standard, all STS sites can independent assortment with internal standard in the present invention；3, used glimmering On the premise of the sense channel number of signal and supporting quantitative real time PCR Instrument is allowed, every STS number of sites in pipe Adjustment, such as 1,2,3,4 or more can be needed according to experiment；4, multitube of the invention In PCR reactions, often the combination (containing the internal standard) in multiple sites of pipe, can be reached its of phase same-action It combines and replaces；5, all of primer, probe sequence can be by the several bases of left and right translation or reverse complemental sequences The sequence replacing of the several bases of row or reverse complementary sequence or so translation；6, the present invention in all the components it is dense Angle value, pH value etc., other values that can be reached same effect are replaced.

Brief description of the drawings

Figure 1A to Fig. 1 E shows the fluorescence quantitative PCR detection result of different samples in the embodiment of the present invention：Figure 1A, normal male sample；Figure 1B, normal female sample；Fig. 1 C, AZFa, b, c, d areas lack entirely Sample；Fig. 1 D, AZFa areas lack sample；Fig. 1 E, AZFb areas lack sample.

Specific embodiment

Before exemplary of the invention is described in detail, to understanding that the critically important term of the present invention is given Go out definition.Unless otherwise defined, all technologies otherwise used herein and scientific terminology have institute of the present invention The identical implication that category technical field those of ordinary skill is generally understood.

As used herein, term "comprising", " including ", " having " or its any other variant, it is intended to contain Lid nonexcludability includes.

As used herein, term " amplification " and its variant include at least a certain portion for producing polynucleotides The multiple copies or any process of complement for dividing, the polynucleotides are commonly referred to as " template ".Template is more Nucleotides can be single-stranded or double-stranded.The product of polynucleotide amplification product group can be caused to the amplification of solid plate Raw, the polynucleotide amplification product group is collectively referred to as " amplicon ".The polynucleotides of amplicon can be with It is single-stranded or double-stranded or two kinds of mixture.Normally, template will be comprising target sequence, and produced expansion Increase son by comprising the polynucleotides with sequence that is substantially the same with target sequence or being substantially complementary.At some In embodiment, the polynucleotides of specific amplicon are substantially the same each other or are substantially complementary；Or, In some embodiments, the polynucleotides given in amplicon can have nucleotide sequence different from each other. Amplification can be carried out in the way of linear or index, and be may include multiple with continuous to the repetition of solid plate Make to form two or more amplified productions.Some typical amplified reactions include that the nucleic acid based on template is closed Into continuous and repetitive cycling, cause the formation of many sub- polynucleotides, the sub- polynucleotides include template Nucleotide sequence at least certain a part and it is same with the nucleotide sequence that template enjoys at least a certain degree Property (or complementary).In some embodiments, each nucleic acid synthesis (its " circulation " that can be referred to as amplification) Including primer annealing and primer extension procedures；Optionally, wherein template is may also include partially or completely to be denatured Other denaturing step.In some embodiments, an amplification bout includes giving for single amplification cycles Fixed number of repetition.For example, amplification bout may include particular cycle 5,10,15,20,25,30,35, 40th, repeat for 50,75,100 or more times.In an exemplary embodiment, amplification includes wherein specific Polynucleotide template experiences two any reactions of continuous nucleic acid synthesis circulation.Synthesis may include template dependant Property nucleic acid synthesis.Each circulation of nucleic acid synthesis optionally includes single primer annealing step and single extension Step.In some embodiments, amplification includes isothermal duplication.

As used herein, " multiplex amplification " refers in same amplified reaction, to two or more targets The selectivity of sequence and nonrandom amplification.In some embodiments, multiplex amplification is performed such, and makes Some or all of target sequence is obtained to be amplified in single reaction vessel.

As used herein, " amplification condition " and its derivative words, typically refer to be adapted to expand one or more nucleic acid The condition of sequence.Such amplification can be linear or index.In some embodiments, the expansion Increasing condition can include isothermy or can alternatively include thermal cycle conditions or wait gentle thermal cycle conditions Combination.In some embodiments, the condition for being adapted to expand one or more nucleotide sequences includes polymerase chain Formula reacts (PCR) condition.Typically, the amplification condition refers to be enough to amplification of nucleic acid (such as one or more target sequences Row) or the target sequence of the amplification for being connected to one or more joints is expanded (for example, the target of the amplification of joint connection Sequence) reactant mixture.Generally, the amplification condition includes the catalysis for expanding or synthesize for nucleic acid Agent (for example, polymerase) and the nucleic acid subject to amplification have complementary primer and promotion to a certain degree Once with the nucleotides of the extension of the primer of the nucleic acid hybridization (such as deoxyribonucleotide triphosphoric acid (dNTPs)).The amplification condition can need the hybridization or annealing of primer and nucleic acid, the extension of the primer and The denaturing step that the primer for wherein being extended with the nucleotide sequence of experience amplification separate.Typically, but be not must Must, amplification condition can include thermal cycle；In some embodiments, amplification condition includes multiple circulations, Wherein anneal, extension and separating step are repeated.Typically, the amplification condition includes cation (such as Mg²⁺ Or Mn²⁺(for example, MgCl₂Deng)) and also the various modifying agent of ionic strength can be included.

As used herein, " target sequence " or " target sequence interested " or " target sequence " and its derivative words, Any single-stranded or double-stranded nucleotide sequence that can be amplified or synthesize according to present disclosure is typically referred to, including is doubted Like or expection be present in any nucleotide sequence in sample.In some embodiments, the target sequence is with double Chain form exists and included subject to amplification or synthesis spy before target specific primer or appended joint is added Determine at least part of of nucleotide sequence or its complementary series.Target sequence may include have in amplification or synthetic reaction The nucleic acid that primer can be hybrid with it before extension by polymerase.

As used herein, " sample " or " sample " and its derivative words, are used and are wrapped with its broadest sense Include etc. doubtful any sample including target, culture.In some embodiments, the sample comprising DNA, The nucleic acid of RNA, PNA, LNA, chimeric, hybridization or many n-ary form ns.The sample can include containing one Individual or multiple nucleic acid it is any based on biology, clinical, surgery, agronomy, air or aquatic Sample.The term also nucleic acid samples including any separation, such as genomic DNA, fresh food frozen or Fu Er Malin fixes the nucleic acid sample of FFPE.

As used herein, typically refer to can be miscellaneous with target sequence interested for term " primer " and its derivative words Any polynucleotides handed over.In some embodiments, the primer may also be used for triggering nucleic acid synthesis. Typically, the primer can be aggregated to substrate function thereon as nucleotides by polymerase. The primer includes nucleotides or any combination of its analog, and it can optionally be connected to form any conjunction The linear polymer of suitable length.The primer is optionally naturally occurring, such as in the restriction Enzyme digestion thing of purifying In, or generation can be synthesized.In some embodiments, the primer can include one or more cores Thuja acid analog.The definite length and/or composition (including sequence) of the target specific primer can influence multiple Property, including melting temperature (Tm), G/C content, the formation of secondary structure, nucleotides motif, the institute of repetition The length of the primer extension product of prediction, across nucleic acid molecules interested level of coverage, it is single amplification or The number of primer present in synthetic reaction, in the primer inner nucleotide analog or the nucleotides of modification In the presence of etc..

As used herein, " specific primer " and its derivative words, typically refer to single-stranded or double-stranded polynucleotides, Typically oligonucleotides, it include it is complementary with least partly at least 50% of the nucleic acid molecules including target sequence, Typically at least 75% is complementary or at least 85% complementary, more typically at least 90% complementary, more typically at least 95% is complementary, the more typically at least 98% or 99% complementary or sequence of identical at least one.In such feelings Under condition, the target specific primer and target sequence are described as " corresponding " in each other.In some embodiments In, the target specific primer can its corresponding target sequence (or the complementary series with the target sequence) extremely Small part is hybridized；Such hybridization can optionally under Standard hybridization conditions or in stringent hybridization condition Under carry out.

As used herein, " polymerase " and its derivative words, (including it is similar to typically refer to be catalyzed nucleotides Thing) turn into nucleic acid chains polymerization any enzyme.Typically but it is not required, such nucleotide polymerization can be with The form of Template Dependent occurs.Such polymerase can include but is not limited to naturally occurring polymerase and Any subunit and clipped form, mutated polymerase, variant of its ability for retaining the such polymerization of catalysis are poly- The polymerase of synthase, recombinant, fusion or other manner engineering, the polymerase of chemical modification, synthesis point Son or assembly and its any analog, derivative or fragment.Optionally, the polymerase can be included The mutated polymerase of one or more mutation, the mutation is related to one or more amino acid replacements to be other Amino acid, the insertion of one or more amino acid of polymerase or missing or two or more polymerases Partial connection.Typically, the polymerase includes one or more avtive spots, and its nucleotide is combined And/or the catalysis of nucleotide polymerization can occur.Some exemplary polymerases include but is not limited to DNA and gather Synthase and RNA polymerase.As used herein, term " polymerase " and its variant, also refer to comprising mutual At least two-part fusion protein of connection, wherein Part I are included and can be catalyzed nucleotides referred to as nucleic acid chains Polymerization peptide and be connected with the Part II of domain including reporter enzyme or enhancing processivity. Optionally, the polymerase can have 5' 5 prime excision enzyme activities or terminal transferase activity.In some embodiment party In case, the polymerase can optionally be re-activated, such as mixed by using heat, chemicals or to reaction Compound adds the polymerase of new amount.In some embodiments, the polymerase can be poly- including thermal starting Synthase or the polymerase based on aptamers, it can optionally be re-activated.

As used herein, term " nucleic acid " refer to natural acid, artificial nucleic acid, its analog or its combination, Including polynucleotides and oligonucleotides.As used herein, term " polynucleotides " and " oligonucleotides " exist Used interchangeably herein simultaneously means the single-stranded and double-chain polymer of nucleotides, including but not limited to by nucleotides Between phosphodiester bond (such as 3'-5' and 2'-5'), back bond (such as 3'-3' and 5'-5'), branched structure connection 2'- deoxyribonucleotides (nucleic acid) and ribonucleotide (RNA), or nucleic acid analog.Polynucleotides have phase The counter ion counterionsl gegenions of association, such as H⁺、NH₄ ⁺, trialkyl ammonium, Mg²⁺、Na⁺Deng.Oligonucleotides can be complete By deoxyribonucleotide, completely it is made up of ribonucleotide or its chimeric mixtures.Oligonucleotides can be by Core base and sugar analogue are constituted.Polynucleotides are typically sized from several monomeric units (such as 5-40 It is individual) (when they are more commonly frequently referred to as oligonucleotides in the prior art) to thousands of monomeric nucleotide units In the range of (when they are in the prior art by more commonly known as polynucleotides)；But, for present disclosure Purpose for, both oligonucleotides and polynucleotides may each be any suitable length.Unless other table Show, otherwise whenever oligonucleotide sequence is represented, it should be understood that the nucleotides is arrived with from left to right 5' The order of 3', and " A " expression desoxyadenossine, " C " expression deoxycytidine, " G " expression deoxyguanosine, " T " represents that thymidine and " U " represent BrdU.Why oligonucleotides is considered to have at " 5' ends " " 3' ends " is because mononucleotide is connected to typically via the 5' phosphoric acid or identities of a nucleotides The 3' hydroxyls or identities of its adjacent nucleotide and react to form oligonucleotides, optionally by di(2-ethylhexyl)phosphate Ester bond or other suitable keys.

The present invention is not limited to specific method as herein described, scheme, reagent etc., because these can change. Term used herein is only used for describing the purpose of specific embodiment rather than in order to limit model of the invention Enclose.

The following is technical foundation of the invention：

A) using the physicochemical property treatment sample of buffer solution

Main research includes：Preparation contains the molten of surfactant, certain ionic strength and acid-base value Liquid, the solution of certain volume mixes with the whole blood of certain volume, using in its physicochemical property cleavable whole blood Body cell simultaneously discharges genomic DNA, and can remove the influence of the PCR inhibitor in whole blood；

B) using the micro-deleted achievement in research in known Y chromosome AZF areas carry out multiplex PCR design and Implement

Main research includes：According in NCBI on Research Literature that Y chromosome AZF areas are micro-deleted With related STS site sequences, specific primer and different fluorescein-labeled fluorescence probes are designed；Design 4 Tube reaction system, 2 STS sites and 1 internal standard gene are detected per tube reaction system respectively.

C) detected using quantitative real time PCR Instrument

After 4 tube reaction systems are separately added into the whole blood sample for the treatment of, it is placed in quantitative real time PCR Instrument, if Put response procedures, you can the detection of complete paired samples.

Embodiment

To make technical scheme and advantage clearer, embodiment of the present invention will be made into one below Step ground is described in detail.It should be understood that embodiment should not be construed as it is restricted.Those skilled in the art can be clear The further modification of the principle listed herein is envisioned on ground by Chu.

Embodiment 1

A) preparation of sample treatment solution

The sample treatment solution each component of determination is as follows：NaCl, Tris, Triton X-100, SDS, wherein NaCl Concentration is 100nM, and Tris concentration is 10mM, and Triton X-100 concentration is that 1%, SDS concentration is 10%, PH value is 8.0；

B) design of primed probe

The sequence in each gene or STS sites is downloaded in NCBI, the Software for Design of Primer Express 3.0 is used Primer, probe, after the synthesis of commission Invitrogen (Shanghai) Trading Co., Ltd., checking primer, probe Availability.The primed probe that this kit determines is shown in preceding table.

C) determination of reaction system

By many experiments contrast verification, it is determined that STS sites and internal standard combination and reaction system each component it is dense Degree, see the table below.

The reaction system site of table 3 constitutes

Fluorescence labeling	FAM	JOE/VIC	Cy5
				Reaction solution 1	sY86	sY84	β-actin
Reaction solution 2	sY127	sY152	SRY
				Reaction solution 3	sY254	sY134	SRY
Reaction solution 4	sY145	sY255	SRY

The reaction system each component concentration of table 4

D) determination of reaction condition

By many experiments contrast verification, the reaction condition that this kit determines is as follows：

The reaction condition of table 5

2 uses of kit of embodiment

A) desired use

This product is used for Y chromosome Azoospermia factor (azoospermia in qualitative detection male's whole blood sample Factor, AZF) region with the presence or absence of missing.Alternative STS sites are a lot, in the industry it is generally acknowledged that every 2 sites are detected in individual area, and the present invention selects most representational 2 sites, tool in each AZF area Deletion segment is surveyed in physical examination：For 3 generally acknowledged in the industry AZF areas, AZFa：sy84、sy86；AZFb： sy127、sy134；AZFc：sy254、sy255；2 STS sites in AZFd areas are also newly increased in addition Sy145, sy152, can provide more reference significances for clinical detection.

Clinical research shows that Y chromosome AZF areas (AZFa, AZFb, AZFc, AZFd) are different degrees of Missing can cause the symptoms such as aspermia or oligospermia, azoospermatism or the teratospermia of male, so as to cause male sterility.This The use of kit can assist to be analyzed the cause of disease of infertile patient, and testing result is available for clinical reference, But can not individually be used as make a definite diagnosis or the clinical diagnosis such as Excluded cases foundation.

B) Cleaning Principle

This kit with 8 STS sites in Y chromosome AZF areas as target sequence, design specific primer and Fluorescence probe, is equipped with the compositions such as hot resistant DNA polymerase (Taq enzyme), four kinds of nucleotide monomers (dNTPs), Using PCR (PCR) and fluorescence labeling probe technology, 4 three are carried out to each sample to be checked Weight PCR reactions, containing an internal standard and two specific primers in site and special in each PCR reaction system Property probe, so that whether 8 sites in Y chromosome AZF areas lack in quick detection sample.

C) kit forms

Kit each component see the table below：

The reagent constituents of table 6

D) condition of storage and the term of validity

Less than -20 ± 5 DEG C preserve, the term of validity 12 months；2-8 DEG C of transport, laboratory is sent in 72 hours；Freeze Melt number of times<5 times.

E) it is applicable instrument

Roche LightCycler 480II, ABI Prism 7500, Bio-Rad CFX96 quantitative fluorescent PCRs Instrument.

F) sample requirement

I. sample type EDTA anticoagulated whole bloods are applicable

Ii. sample collection gathers blood sample of patient 2mL using the vacuum test tube added with EDTA anti-coagulants, Censorship is sealed after overturning mixing immediately.

Iii. Sample preservation and transport sample can be immediately available for detection；Or 2-8 DEG C of preservation, detection in 2 weeks； Or -20 DEG C of preservations, detected in 3 months.2-8 DEG C of Refrigerated Transport.

G) detection method

I. sample process takes the μ L of anticoagulated whole blood 10 and is placed in 1.5mL centrifuge tubes, adds 200 μ L samples Present treatment liquid, vibration is mixed；

Ii. reaction solution prepares negative controls, positive reference substance and sample DNA to be checked respectively with 4 kinds PCR reaction solutions are detected that every kind of PCR reaction solutions are prepared as follows：(n is to take n × 23 μ L Tested sample number, negative control and positive control summation) PCR reaction solutions, add n × The PCR reaction enzymes of 0.3 μ L, vibration is dispensed to PCR reaction tubes, 23 μ L/ pipes after mixing.

Iii. it is loaded to the sample or reference substance that 2 μ L treatment is separately added into correspondence PCR reaction tubes, mixes The even rear brief centrifugation several seconds.

Be put into each reaction tube in the reactive tank of fluorescent PCR amplification instrument by iv.PCR amplifications, sets reactant It is 25 μ L to be, reference substance, sample ID are set by correspondence order.Enter by the response procedures of table 5 Performing PCR is expanded.

1.Roche LightCycler 480II fluorescence is set：Detection Formats select 3 Color Hydrolysis Probe；

The fluorescence of 2.ABI Prism 7500 is set：Reporter group selects FAM, JOE/VIC, Cy5, Quenching group selects none；Passive Reference options are set to none；

3.Bio-Rad CFX96 fluorescence is set：Fluorophor selects FAM, VIC, Cy5.

H) interpretation of result condition setting

Reaction terminates rear instrument and automatically saves result, according to image adjustment Baseline after analysis (or Background (Start values may be provided in 3~10, End for Start values), End values and Threshold values Value may be provided in 10~15, highest of the threshold value setting principle with threshold line just above normal negative control amplification curve Point, as a result shows that feminine gender is defined).

I) quality control

I. negative controls：The Cy5 passages of negative controls reaction solution 1 have S types amplification curve and Ct Value≤26, remaining all equal Ct values ＞ 28 of passage or shows without Ct values；

Ii. positive reference substance：All passages of 4 kinds of reaction solutions of positive reference substance have S types amplification curve and Ct value≤26；

Conditions above should meet simultaneously, and otherwise, it is invalid that this time experiment is considered as, and total Test should be re-started.

Iii. the Cy5 passages (β-actin) of the reaction solution 1 of sample to be checked answer S-type amplification curve and Ct Value≤28.

If a certain sample is unsatisfactory for condition 5.2.3, detected again after should again processing the sample.

J) result judgement

If i. the SRY of the reaction solution 2,3,4 of sample to be tested is without S types amplification curve or Ct values ＞ 28, Advise that the patient carries out karyotype inspection；If the SRY of a certain reaction solution is expanded without S types Curve or Ct values ＞ 28, should be rechecked using this reaction solution；

If ii. sY127, sY134, sY152, sY254, sY255 site of sample to be tested are without obvious S Type amplification curve or Ct values ＞ 24, then judge corresponding site missing；

If iii. sY84, sY86, sY145 site of sample to be tested are without obvious S types amplification curve or Ct values ＞ 28, then judge corresponding site missing；

K) positive cutoff value is according to clinical test results statistical analysis, this kit sY127, sY134, The positive cutoff value in sY152, sY254, sY255 site is Ct values ＞ 24；sY84、sY86、 The positive cutoff value in sY145 sites is Ct values ＞ 28.

L) the explanation result of the test of assay only supplies clinical reference, not as treatment or other clinical managements Unique foundation；White blood cell concentration is too low in irrational sample collection, transhipment and treatment, sample It is likely to result in false negative result；Detecting the variation of target sequence can cause false negative result；Non- experience Other disturbing factors of card, such as operational error may result in false negative result.

M) the limitation pattern detection result of the method for inspection is collected with sample, processes, transported and preservation condition And detection process cross pollution control it is relevant, such as during make a fault be easily caused false negative or False positive results.

N) this kit of product performance index lowest detection is limited to：10ng genomic DNAs/test；Precision： CV≤5%；Detection accuracy is 100%；Ferroheme high, hyperlipemia sample and excessive anti-coagulants pair Testing result is noiseless.

O) testing result

Figure 1A to Fig. 1 E shows the fluorescence quantitative PCR detection result of different samples in the embodiment of the present invention：Figure 1A, normal male sample；Figure 1B, normal female sample；Fig. 1 C, AZFa, b, c, d areas lack entirely Sample；Fig. 1 D, AZFa areas lack sample；Fig. 1 E, AZFb areas lack sample.Wherein corresponding AZF areas Missing determined by operating the software kit of reaction kit.

Presently preferred embodiments of the present invention is the foregoing is only, the protection domain being not intended to limit the invention is all Within the spirit and principles in the present invention, any modification, equivalent substitution and improvements made etc., all should include Within protection scope of the present invention.

Claims (10)

1. the micro-deleted kit in a kind of detection people Y chromosome AZF areas, including sample treatment solution, at least A kind of PCR reaction solutions, wherein every kind of PCR reaction solutions are including different for internal standard gene and at least one The primer and probe in STS sites.

2. sample treatment solution and at least one PCR reaction solutions are micro- scarce in preparation detection people Y chromosome AZF areas Purposes in the kit of mistake, wherein every kind of PCR reaction solutions are included for internal standard gene and at least one difference STS sites primer and probe.

3. the purposes of the kit of claim 1 or claim 2, wherein the sample treatment solution includes gold Category ion, Tris buffer solutions and surfactant, it is preferable that the sample treatment solution include NaCl, Tris, Triton X-100, SDS, it is preferable that NaCl concentration is 100nmol/L, Tris concentration is 10mmol/L, Triton X-100 volumetric concentrations are that 1%, SDS mass concentrations are 10%.

4. the kit or purposes of foregoing any one claim, wherein the primer that the PCR reaction solutions include It is directed at least each 2 STS sites in AZFa, AZFb, AZFc, AZFd area respectively with probe, preferably The STS sites are sy84 sites, the sy86 sites in AZFa areas, the sy127 sites in AZFb areas, sy134 Site, the sy254 sites in AZFc areas, sy255 sites, the sy145 sites in AZFd areas, sy152 sites, It is preferred that the internal standard gene is respectively general internal standard gene and sex internal standard gene, preferably described general internal standard base Because β-actin genes or zinc finger protein gene, preferably described sex internal standard gene is sry gene.

5. the kit or purposes of foregoing any one claim, wherein the PCR reaction solutions include PCR Reaction solution 1, PCR reaction solutions 2, PCR reaction solutions 3, PCR reaction solutions 4, the PCR reaction solutions 1 Including for β-actin genes, sY84 sites, sY86 sites primer and probe；The PCR reaction solutions 2 include being directed to sry gene, sY127 sites, the primer and probe in sY152 sites；The PCR reactions Liquid 3 includes being directed to sry gene, sY134 sites, the primer and probe in sY254 sites；The PCR is anti- Answering liquid 4 is included for sry gene, sY145 sites, the primer and probe in sY255 sites.

6. the kit or purposes of foregoing any one claim, wherein, the sequence such as sequence table of the primer SEQ ID NO:Shown in 1-20；

The sequence of the probe such as sequence table SEQ ID NO:Shown in 21-30.

7. the kit or purposes of foregoing any one claim, wherein the PCR reaction solutions also include： KCl、MgCl₂, Tris, dNTP Mixture, it is preferable that wherein KCl concentration be 50mmol/L, MgCl₂ Concentration is 1.5mmol/L, and Tris concentration is 10mmol/L, and dNTP concentration is 200 μm of ol/L.

8. the kit or purposes of foregoing any one claim, wherein the kit also reacts including PCR Enzyme, the PCR reaction enzymes are preferably hot start Taq polymerase, and concentration is preferably 5U/ μ L.

9. the kit or purposes of foregoing any one claim, wherein the kit also includes positive control Product and negative controls, the positive reference substance are preferably normal male genomic DNA, and concentration is preferably 10ng/μL；The negative controls are preferably normal female genomic DNA, and concentration is preferably 10ng/ μ L.

10. using the side that the kit detection people Y chromosome AZF areas of foregoing any one claim are micro-deleted Method, comprises the following steps：1) step treatment sample by the way of sample treatment solution directly mixes with whole blood； 2) the STS sites in detection AZF areas respectively are reacted by PCR using specific primer.