KR20190113033A - Method for diagnosing parkinson's disease using nasal mucus, composition therefore, and kit comprising the same - Google Patents

Abstract

The present application relates to a method for providing information for diagnosing Parkinson′s disease, including a step of measuring the expression level of a Parkinson′s disease related gene from a nasal mucus sample of a subject; a composition for diagnosing Parkinson′s disease; and a kit including the same.

Description

METHOD FOR DIAGNOSING PARKINSON'S DISEASE USING NASAL MUCUS, COMPOSITION THEREFORE, AND KIT COMPRISING THE SAME}

The present application relates to an information providing method for diagnosing Parkinson's disease, including a method for diagnosing Parkinson's disease, and a kit comprising the same.

As life expectancy increases and enters an aging society, degenerative diseases caused by aging are becoming a major medical and social problem. Among these degenerative diseases, in particular, the number of patients with Parkinson's disease, which is a degenerative dyskinesia, is rapidly increasing.

Parkinson's disease is a degenerative neurological disorder in which the muscles of the arms, legs or whole body are convulsed or stiff and do not center. This symptom is caused by a problem in the nerve cells of the neurotransmitter dopamine secretion, the specific neurons of the brain is gradually destroyed. Typical symptoms of Parkinson's disease are dyskinesia, including convulsions, muscle stiffness and slow motion.

Because Parkinson's disease progresses slowly and progresses for decades, it is difficult to know exactly when the disease occurs. When symptoms are found, nerve cells in the brain's black matter are often denatured. Therefore, for proper regulation of the progression of Parkinson's disease, it is important to discover new disease-specific markers that can be diagnosed early before significant neuronal cell death occurs.

Currently, cerebrospinal fluid, blood, and urine are used as biological secretion samples for early diagnosis of Parkinson's disease. However, cerebrospinal fluid is limited in the amount of sample that can be collected and it is difficult to obtain a sample for research purposes, which limits the analysis of various markers at the same time. Although blood and urine have the advantage of non-invasive sampling compared to cerebrospinal fluid, there may be a problem with sensitivity or consistency because it is an indirect diagnostic marker measurement in a sample that does not directly represent the site of lesion development of degenerative disease. .

Republic of Korea Patent No. 10-1716114

The present study noted that more than 80% of Parkinson's patients reported olfactory abnormalities early, and to develop a transcript analysis method using a runny nose solution with excellent ease of sampling as an early diagnosis strategy for Parkinson's disease. Olfactory abnormalities in Parkinson's patients appear many years before the onset of motor lesions. No attempt has been made to diagnose Parkinson's disease using a runny nose that can represent these olfactory abnormalities.

Herein, the present invention extracts and isolates transcript RNA from a runny nose, and from there, a real-time quantitative PCR technique, major Parkinson's disease markers (α-synuclein (SNCA), Parkin, ZNF746 (PARIS), Expression of RNF146, c-Abl and AIMP2) was quantified. In addition, markers showing association with Parkinson's lesions from the nasal transcripts of normal and Parkinson's patients were used as early diagnosis markers of Parkinson's disease lesions.

However, the problem to be solved by the present application is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

The first aspect of the present application may provide a composition for diagnosing Parkinson's disease, including an agent for measuring the expression level of Parkinson's disease-related genes in an isolated runny nose.

The second aspect of the present application can provide a Parkinson's disease diagnostic kit comprising a composition for diagnosing Parkinson's disease according to the first aspect of the present application.

A third aspect of the present disclosure is directed to separating a runny nose from a patient suspected of Parkinson's disease; Measuring expression levels of Parkinson's disease related gene transcripts, or peptides or proteins expressed therefrom, from cells in the runny nose and normalizing them for expression of standard genes; Informational methods can be provided for diagnosing Parkinson's disease, including comparing normalized expression levels with those measured for normal individuals and normalized expression levels.

The above-mentioned means for solving the problems are merely exemplary, and should not be construed to limit the present invention. In addition to the exemplary embodiments described above, there may be additional embodiments and embodiments described in the drawings and detailed description of the invention.

The present application aims to provide a method for early diagnosis or confirmation of Parkinson's disease by quantifying a runny nose specific Parkinson's disease marker in a runny nose transcript of a potential Parkinson's disease patient with olfactory abnormalities. In particular, the analysis of runny nose transcripts from normal and Parkinson's patients confirmed that the reduction of Parkin transcripts and the increase of AIMP2 transcripts were significantly associated with Parkinson's lesions. It was intended to be used as an early diagnostic marker. In addition, it was intended to be applied to the separation and purification of transcripts from a runny nose and to develop an efficient and selective sensitive diagnostic kit of Parkinson's disease by quantifying Parkin and AIMP2 transcripts.

The present application aims to quantify transcripts in a runny nose of a Parkinson's disease patient for the first time and to provide a method for early diagnosis of Parkinson's disease from the expression of a runny nose transcript-specific Parkinson's disease marker.

Figure 1a is a flow chart of the process for quantifying the transcript of the target gene from the runny nose according to an embodiment of the present application, Figure 1b is an electrophoresis result confirming that the transcript of the target gene is normally purified from the runny nose.
Figure 2 shows the PCR and melting curve measurement conditions of the cDNA of the gene of interest performed according to an embodiment of the present application.
Figure 3 is a graph showing the melting curve of the PCR product of the target genes expressed in the runny nose of the normal group and Parkinson's patients according to an embodiment of the present application.
Figures 4a to 4c is a graph showing the quantitative results of the target genes expressed in the runny nose of the normal group and Parkinson's patients, Figure 4d is a table showing the number of samples used in the experiment.

DETAILED DESCRIPTION Hereinafter, exemplary embodiments of the present disclosure will be described in detail with reference to the accompanying drawings so that those skilled in the art may easily implement the present disclosure. As those skilled in the art would realize, the described embodiments may be modified in various different ways, all without departing from the spirit or scope of the present invention. In the drawings, parts irrelevant to the description are omitted in order to clearly describe the present application.

Throughout this specification, when a part is said to "include" a certain component, it means that it can further include other components, without excluding the other components unless specifically stated otherwise.

As used throughout this specification, the terms "about", "substantially" and the like are used at, or in the sense of, numerical values when a manufacturing and material tolerance inherent in the stated meanings is indicated, Accurate or absolute figures are used to assist in the prevention of unfair use by unscrupulous infringers. As used throughout this specification, the term "step to" or "step of" does not mean "step for."

Throughout this specification, the term "combination of these" included in the expression of the makushi form means one or more mixtures or combinations selected from the group consisting of constituents described in the expression of the makushi form, wherein the constituents It means to include one or more selected from the group consisting of.

Throughout this specification, description of "A and / or B" means "A, B, or A and B."

Throughout this specification, "diagnosis" means identifying the presence or characteristic of a pathological condition. Among them, the present invention is useful for the diagnosis of Parkinson's disease. This disclosure includes predicting the onset and progression of Parkinson's disease. In particular, it is very important to be able to predict early onset of Parkinson's disease. According to the present method, Parkinson's level of Parkinson's disease-related genes or proteins in runny nose that can be easily collected from suspected Parkinson's disease patients with olfactory abnormalities. It can be used as a disease diagnosis marker. Here, the "diagnosis marker or diagnosis marker (diagnosis marker) is a substance that can diagnose the cells of Parkinson's disease patients from the cells of the settler who does not have Parkinson's disease, and increases or decreases in the cells of Parkinson's disease patients compared to the cells of normal people. Organic biomolecules such as polypeptides, nucleic acids, lipids, glycolipids, glycoproteins, sugars (monosaccharides, disaccharides, polysaccharides, etc.) and the like.

Throughout this specification, “nucleic acid” is meant to include any DNA or RNA, eg, chromosomes, mitochondria, viruses and / or bacterial nucleic acids present in tissue samples. One or both strands of a double stranded nucleic acid molecule and any fragment or portion of an intact nucleic acid molecule.

Throughout this specification, "gene" refers to any nucleic acid sequence or portion thereof that has a functional role in protein coding or transcription or in the regulation of other gene expression. The gene may consist of any nucleic acid encoding a functional protein or only a portion of a nucleic acid encoding or expressing a protein. Nucleic acid sequences may include gene abnormalities in exons, introns, initiation or termination regions, promoter sequences, other regulatory sequences, or unique sequences adjacent to genes.

Throughout this specification, the term "gene expression" generally refers to a cellular process in which a transcript, and further biologically active polypeptide, is generated from a DNA sequence and exhibits biological activity in a cell. In that sense, gene expression includes not only transcriptional and translational processes, but also posttranscriptional and posttranslational processes that can affect the biological activity of a gene or gene product. The processes include, but are not limited to, RNA synthesis, processing and transport, as well as post-translational modifications of polypeptide synthesis, transport and polypeptide. As used herein, one aspect of gene expression includes both mRNA expression and protein expression.

Throughout this specification, "primers" are oligos that hybridize to complementary RNA or DNA target polynucleotides and serve as a starting point for the stepwise synthesis of polynucleotides from mononucleotides by the action of nucleotidyltransferases, eg, occurring in PCR. Nucleotide sequence.

Hereinafter, a composition for diagnosing Parkinson's disease, a kit for diagnosing Parkinson's disease, and a method for providing information for diagnosing Parkinson's disease will be described in detail with reference to embodiments, examples, and drawings. However, the present application is not limited to these embodiments, examples and drawings.

The first aspect of the present application relates to a composition for diagnosing Parkinson's disease, including an agent for measuring the expression level of a Parkinson's disease related gene in isolated runny nose.

The composition of the present application is for diagnosing Parkinson's disease using a runny nose, which is easier to collect than cerebrospinal fluid, which is generally used for diagnosing Parkinson's disease. By collecting a runny nose and measuring the expression level of Parkinson's disease-related genes from it, Parkinson's disease can be diagnosed early with high accuracy.

For example, the runny nose solution may be obtained from a nasal wash, but may not be limited thereto. For example, the nasal wash may be performed using saline or water (distilled water), but may not be limited thereto.

Measuring the expression level of Parkinson's disease-related genes in the isolated runny nose may be to isolate the cells in the runny nose and measure the expression level of the gene in the cells, but may not be limited thereto.

According to one embodiment of the present invention, the Parkinson's disease-related gene is one selected from the group consisting of α-synuclein (or SNCA), parkin (parkin), ZNF746 (or PARIS), RNF146, OMP, c-Abl and AIMP2. It may be, but is not limited thereto, and genes that are otherwise expressed in the runny nose of Parkinson's patients compared to those of normal persons may be used without limitation.

According to one embodiment of the present application, the agent for measuring the expression level is specifically directed to a nucleic acid primer or a peptide or protein expressed by a Parkinson's disease gene, or a nucleic acid primer that binds to a nucleic acid sequence or a corresponding sequence of a Parkinson's disease related gene. It may include an antibody or aptamer to bind, but may not be limited thereto, and any method may be used without limitation as long as it is a quantitative method for gene expression commonly performed in the art.

A second aspect of the present application relates to a Parkinson's disease diagnostic kit comprising another composition in the first aspect of the present application.

If the kits herein are subjected to a PCR amplification process, the kits may optionally contain reagents necessary for PCR amplification, such as buffers, DNA polymerases (eg Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis). , Thermis flavus, Thermococcus literalis or thermally stable DNA polymerase obtained from Pyrococcus furiosus (Pfu)), DNA polymerase cofactors and dNTPs.

When the kits of the present application are subjected to an immunoassay, the kit may optionally comprise a substrate of a secondary antibody and a label. Furthermore, the kits according to the invention can be produced in a number of separate packaging or compartments comprising the reagent components described above.

A third aspect of the present disclosure is directed to separating a runny nose from a patient suspected of Parkinson's disease; Measuring expression levels of Parkinson's disease related genes or transcripts thereof, or peptides or proteins expressed therefrom from cells in the runny nose and normalizing them for expression of standard genes; A method of providing information for diagnosing Parkinson's disease, comprising comparing normalized expression levels with those measured for normal individuals and normalized expression levels.

According to one embodiment of the present invention, the Parkinson's disease-related gene may be selected from the group consisting of α-synuclein (SNCA), parkin (parkin), ZNF746 (PARIS), RNF146, c-Abl and AIMP2, but is not limited thereto. It may not be.

According to the exemplary embodiment of the present application, the standard gene may be GAPDH, but any gene showing a constant expression among individuals with or without Parkinson's disease may be used without limitation.

According to one embodiment of the present invention, the expression level of the gene is reverse transcriptase polymerase (RT-PCR), competitive reverse transcriptase polymerase (competitive RT-PCR), real time quantitative RT-PCR (real time quantitative RT-PCR) ), Quantitative RT-PCR, RNase protection method, Northern blotting or DNA chip technology, but are not limited thereto. Can be.

According to one embodiment of the present invention, the expression level of the protein or peptide is Western blot, ELISA (enzyme linked immunosorbent assay), immunoprecipitation assay (Immunoprecipitation Assay), complement fixation assay (Complement Fixation Assay), flow cytometry (Fluorecence Activated Cell Sorter, FACS), or may be measured using a protein chip (protein chip), but may not be limited thereto.

According to one embodiment of the present disclosure, the comparison of normalized expression levels may be compared with a predetermined cutoff value, but may not be limited thereto. In this case, the cutoff value may be determined according to a receiver operation characteristic curve (ROC curve), which is a curve drawn with sensitivity and 1-specificity of the inspected value. That is, after normalizing the gene expression level in the runny nose solution of Parkinson's patient and the normal expression level in the runny nose solution of the Parkinson's patient, the cutoff value is determined in advance from the ROC curve results using the same, and the gene expression level in the runny nose of the subject to be diagnosed. By comparing the normalized value of and the predetermined cutoff value may provide information for the diagnosis of Parkinson's disease, but may not be limited thereto.

In the information providing method for diagnosing Parkinson's disease according to the present invention, Parkinson's disease-related gene expression level (normalized expression level) measurement may be compared to the result of the measurement for the normal group Parkinson's disease, or predetermined cut-off You can also diagnose against the value.

According to one embodiment of the present application, it may be determined that there is Parkinson's disease when the normalized expression level of Parkin is lower than the cutoff value.

According to an embodiment of the present disclosure, the cutoff value may be 0.65 in normalized expression of Parkin, but may not be limited thereto.

According to one embodiment of the present application, it may be determined that there is Parkinson's disease when the normalized expression level of AIMP2 is higher than the cutoff value.

According to an embodiment of the present disclosure, the cutoff value may be 1.9 in normalized expression of AIMP2 of Parkin, but may not be limited thereto.

The present application relates to a novel early diagnosis method of Parkinson's disease, and for the first time, it is possible to diagnose Parkinson's disease by analyzing a transcript from a runny nose. In addition, Parkin and AIMP2 among Parkinson's disease-related genes suggest that Parkinson's disease-specific biomarkers can be usefully used.

Hereinafter, the present invention will be described in more detail with reference to the following examples, but the following examples are for illustrative purposes only and are not intended to limit the scope of the present application.

[ Example ]

One. Runny nose  Whole in cells Transcript  Purification and cDNA Synthesis

Confirmation experiments were first conducted to see if detectable levels of transcripts could be purified from runny nose cells (FIG. 1A). Total RNA was purified using QIAzol on cell pellets of human nasal washes. In order to completely separate trace runny RNA, yeast tRNA was added as a carrier for purification. After synthesizing the cDNA library from the isolated RNA, PCR was performed using primer pairs for GAPDH, and it was confirmed that the cDNA library-specific PCR product was synthesized on an agarose gel (FIG. 1B). Comparison with the cDNA library synthesized from the purified RNA in the neuroblastoma cell line SH-SY5Y showed that there was a small amount of GAPDH transcript that was detectable by PCR.

2. RTQ PCR  through target  Quantification of genes

After synthesizing the cDNA library for the runny nose of normal and Parkinson's patients, Parkinson's disease linkage genes (α-synuclein, c-Abl, RNF146, OMP, AIMP2, Parkin and ZNF746 (PARIS)) Specific primer pairs were designed to perform RTQ PCR. The primers used are shown in Table 1 and Sequence Listing, and RTQ PCR performance conditions are shown in FIG. 2. Specifically, for the sample having the composition as shown in the table at the bottom of FIG. Fluorescence of SYBR green was measured at each amplification step, and peaks were identified for amplicons of the target gene at the melt curve stage to confirm the selectivity of the PCR products.

gene Primer direction order One c-Abl Forward CATCACGCCAGTCAACAGTCT (SEQ ID NO: 1) Reverse GTACACCCTCCCTTCGTATCT (SEQ ID NO: 2) 2 α-synuclein Forward AAGAGGGTGTTCTCTATGTAGGC (SEQ ID NO: 3) Reverse GCTCCTCCAACATTTGTCACTT (SEQ ID NO: 4) 3 AIMP2 Forward AGGTAAAGCCCTATCACGGG (SEQ ID NO: 5) Reverse ACAGGTTAGACTCTTCCTGCA (SEQ ID NO: 6) 4 Parkin Forward CAGCAGTATGGTGCAGCGGA (SEQ ID NO: 7) Reverse TCAAATACGGCACTGCACTC (SEQ ID NO: 8) 5 PARIS Forward GCTGGAATTTCCGGTGTAAACC (SEQ ID NO: 9) Reverse GGGGTCCAAGATGGCCTCT (SEQ ID NO: 10) 6 RNF146 Forward ATTCCCGAGGATTTCCTTGACA (SEQ ID NO: 11) Reverse GCTCATCGTACTGCCACCA (SEQ ID NO: 12) 7 OMP Forward TACCGCCTCAACTTCACCCA (SEQ ID NO: 13) Reverse CCTCCTTGCGCCAGAAGATG (SEQ ID NO: 14) 8 GAPDH Forward AAACCCATCACCATCTTCCAG (SEQ ID NO: 15) Reverse AGGGGCCATCCACAGTCTTCT (SEQ ID NO: 16)

Since the amplicon of the PCR product for the normal group and the Parkinson's patient's runny nose cDNA library had a single main peak for the target genes, the PCR for the nasal fluid library was successfully performed.

Quantification of each genome in the runny nose of the normal group (CTRL) and Parkinson's patient (IPD) was normalized to the quantitative value of GAPDH used as internal loading control to identify the relative amounts of target genes in each group. It was. 4A shows the relative transcript amounts of α-synuclein (SNCA), c-Abl (cAbl) and RNF146, FIG. 4B shows OMP and AIMP2, and FIG. 4C shows Parkin (PK) and PARIS. An unpaired two-tailed student t test was performed for significance (* P <0.05, ** P <0.01, *** P <0.001, ns = no significance). Quantitative values for each gene were normalized to the expression level of GAPDH and calculated as relative values in each group. For each experiment, the number of samples used in the experiment is shown in FIG. 4D. α-synuclein, c-Abl, RNF146, and Parkin showed a significant quantitative decrease in the runny nose of Parkinson's patients, with an increase in OMP and AIMP2 (FIGS. 4A-4C). Surprisingly, RNF146, AIMP2 and Parkin had little variation between samples in the normal group (FIGS. 4B and 4C), especially AIMP2 and Parkin showed significant changes in the runny nose of Parkinson's disease patients with significance at high confidence levels. appear.

Parkin and AIMP2 are known genes that are linked to Parkinson's disease pathology. Parkin is an E3 ligase enzyme that mediates ubiquitination labeling of substrate proteins and degradation via proteasomes. Mutations in this gene are known to cause recessive inheritance of Parkinson's disease by inhibiting Parkin's enzymatic activity. Parkin's mutations as well as reduction of nitrosylation, phosphorylation, and solubility have also been reported to be involved in sporadic Parkinson's disease pathology. There has been no previously reported linkage of Parkin transcripts with Parkinson's disease in nasal lavage. AIMP2 is a toxic protein regulated by Parkin, which is present at low levels in normal conditions but quantitative accumulation occurs in Parkinson's patients with Parkinson's midbrain tissue autopsy. In particular, animal studies have shown that AIMP2 accumulation plays an important pathological role in inducing major lesions in Parkinson's disease, including the death of dopamine neurons. Similarly, changes in AIMP2 transcripts and disease linkages in nasal lavage in Parkinson's disease patients have not been previously reported. Therefore, the present application first confirmed that the reduction of Parkin transcripts and the increase of AIMP2 transcripts in the runny nose can be utilized as an early diagnostic marker as a risk factor for the development of Parkinson's disease.

In particular, the cutoff value of the normalized gene expression level calculated from the ROC curve was about 0.654918 for Parkin (reversal value), with a sensitivity of about 91% and a specificity of about 87%. For AIMP2, the cutoff value was about 1.9472, sensitivity about 82%, and specificity about 71%. Therefore, quantification of Parkin and AIMP2 transcripts in runny nose using these cutoff values is expected to be an accurate and useful means for early diagnosis of Parkinson's disease.

The above description of the present application is intended for illustration, and it will be understood by those skilled in the art that the present invention may be easily modified in other specific forms without changing the technical spirit or essential features of the present application. Therefore, it should be understood that the embodiments described above are exemplary in all respects and not limiting. For example, each component described as a single type may be implemented in a distributed manner, and similarly, components described as distributed may be implemented in a combined form.

The scope of the present application is indicated by the following claims rather than the above description, and it should be construed that all changes or modifications derived from the meaning and scope of the claims and their equivalents are included in the scope of the present application.

<110> Research and Business Foundation SUNGKYUNKWAN UNIVERSITY <120> METHOD FOR DIAGNOSING PARKINSONS DISEASE USING NASAL MUCUS,          COMPOSITION THEREFORE AND KIT COMPRISING THE SAME <130> R-2017-0855-KR-1 <160> 16 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> c-Abl F <400> 1 catcacgcca gtcaacagtc t 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> c-Abl R <400> 2 gtacaccctc ccttcgtatc t 21 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> a-synuclein F <400> 3 aagagggtgt tctctatgta ggc 23 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> a-synuclein R <400> 4 gctcctccaa catttgtcac tt 22 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AIMP2 F <400> 5 aggtaaagcc ctatcacggg 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> AIMP2 R <400> 6 acaggttaga ctcttcctgc a 21 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Parkin F <400> 7 cagcagtatg gtgcagcgga 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Parkin R <400> 8 tcaaatacgg cactgcactc 20 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PARIS F <400> 9 gctggaattt ccggtgtaaa cc 22 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PARIS R <400> 10 ggggtccaag atggcctct 19 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> RNF146 F <400> 11 attcccgagg atttccttga ca 22 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> RNF146 R <400> 12 gctcatcgta ctgccacca 19 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OMP F <400> 13 taccgcctca acttcaccca 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OMP R <400> 14 cctccttgcg ccagaagatg 20 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH F <400> 15 aaacccatca ccatcttcca g 21 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH R <400> 16 aggggccatc cacagtcttc t 21

Claims (14)

Parkinson's disease diagnostic composition comprising an agent for measuring the level of expression of Parkinson's disease-related genes in isolated runny nose.
The method of claim 1,
The Parkinson's disease related gene is selected from the group consisting of α-synuclein (SNCA), parkin (parkin), ZNF746 (PARIS), RNF146, OMP, c-Abl and AIMP2.
The method of claim 1,
The agent for measuring the expression level may be a nucleic acid primer that binds to a nucleic acid sequence or a corresponding sequence of a Parkinson's disease related gene, or an antibody or aptamer that specifically binds to a peptide or protein expressed by a Parkinson's disease related gene. It comprises, composition.
A kit for diagnosing Parkinson's disease, comprising the composition of any one of claims 1 to 3.
Separating a runny nose from a patient suspected of Parkinson's disease;
Measuring expression levels of Parkinson's disease related gene transcripts, or peptides or proteins expressed therefrom, from cells in the runny nose and normalizing them for expression of standard genes;
A method of providing information for diagnosing Parkinson's disease, comprising comparing normalized expression levels with those measured and normalized for normal individuals.
The method of claim 5,
The Parkinson's disease-related gene is selected from the group consisting of α-synuclein (SNCA), parkin (parkin), ZNF746 (PARIS), RNF146, OMP, c-Abl and AIMP2.
The method of claim 5,
The standard gene is GAPDH.
The method of claim 5,
The expression level of the gene is reverse transcriptase polymerase (RT-PCR), competitive reverse transcriptase polymerase (competitive RT-PCR), real time transcriptase polymerase (real time quantitative RT-PCR), quantitative polymerase reaction (quantitative) RT-PCR), RNase protection method (RNase protection method), Northern blotting (Northern blotting) or DNA chip technology (DNA chip technology) information measuring method.
The method of claim 5,
The expression level of the protein or peptide is Western blot, ELISA (enzyme linked immunosorbent assay), immunoprecipitation assay, complement fixation assay, Fluorecence Activated Cell Sorter (FACS) Or measuring information using a protein chip.
The method of claim 6,
The comparison of normalized expression levels is to compare with a predetermined cutoff value.
The method of claim 10,
If the normalized expression level of Parkin is low compared to the cutoff value is to determine that there is Parkinson's disease, information providing method.
The method of claim 11,
And wherein the cutoff value is 0.65 for normalized expression of Parkin.
The method of claim 10,
If the normalized expression level of AIMP2 compared to the cutoff value is determined to have Parkinson's disease, information providing method.
The method of claim 13,
An information providing method, wherein the cutoff value is 1.9 in normalized expression of Parkin's AIMP2.

Images