KR102523216B1 - Housekeeping gene of chicken, and method for measuring expression of the target gene using the same - Google Patents

Abstract

The present invention relates to a chicken housekeeping gene and a method for measuring the expression of a target gene using the same. Specifically, since the housekeeping gene of the present invention is expressed regardless of tissue type, developmental state, cell cycle or external environment, gene expression research It can be usefully used as a reference gene as a control for, and since overexpression or suppression of the gene is directly related to various diseases and cancers, it can be usefully used in the process of gene expression research related to disease.

Description

Housekeeping gene of chicken and method for measuring expression of the target gene using the same {Housekeeping gene of chicken, and method for measuring expression of the target gene using the same}

The present invention relates to a chicken housekeeping gene and a method for measuring the expression of a target gene using the same.

A housekeeping gene is a constitutive gene essential for maintaining the life activity and function of a cell regardless of any specific conditions, and has a characteristic of very little change in expression even under various conditions and stages of development. Housekeeping genes perform various functions such as DNA replication in cells, cell life cycle maintenance such as cell division, proliferation, and death, energy metabolism, and metabolism. For example, heat shock proteins, which prepare for shocks such as cell stimulation, and ribosomal proteins, which are involved in intracellular protein expression, also belong to housekeeping genes.

In terms of gene structure, the housekeeping gene has a shorter intron than other genes (non-housekeeping gene, non-HK gene), thereby minimizing the transcription process and showing high expression. For example, while the average intron length of housekeeping genes in humans is 2,573 bp, other genes are about twice as long at 5,025 bp, and the average length of exons in housekeeping genes is 212 bp, which is 240 bp in other genes. As a result, untranslated regions (UTRs) and protein coding regions are shorter in housekeeping genes than in other genes. Furthermore, tissue-specific genes that are expressed only in specific tissues exist longer than housekeeping genes because they have more than 15 times more functional domains, resulting in complex protein structures.

In many studies, a housekeeping gene that is constantly expressed is used as a reference gene (control gene) for relatively comparing the expression of a target gene in different cells in different tissues or in the same tissue. A large amount of target genes can be discovered from information on the functions of various genes and the regulatory network of interacting genes by comparing the expression of genes between normal and abnormal states at a certain measurement point using the housekeeping gene.

If gene expression patterns are investigated by microarray or RNA-Seq methods or experimentally verified, relative expression differences may vary depending on which housekeeping gene is selected as a criterion. . In particular, when comparing the relative expression level of the target gene under different conditions, direct comparison must be made after normalization by dividing the expression level of the target gene by the expression level of the housekeeping gene under each condition. Unlike tissue-specific genes that are expressed only in specific tissues, housekeeping genes must: 1) be expressed in all tissues or cells; At that time, 2) the difference in expression between tissues or cells to be expressed should not be more than twice; 3) no non-expressed tissues or cells; It can be a standard (control). When performing comparative analysis of gene expression in several tissues and when comparing gene expression in one specific tissue, it is important to select which gene to standardize as a standard among housekeeping genes.

On the other hand, the chicken is ideal for the development of animal growth factors and is well known as a biomedical model for studying basic biology, behavior and disease. Birds are the most well-studied genomic sequences and, because of their unique and evolutionary features, are applied to phenotype-associated transcript analysis in comparison with other species. This is because it is used to understand the evolution of gene regulation and functional elements in vertebrate species. Studies comparing chickens have been applied to a wide range of studies, including behavior, ecology, disease, and neurobiology.

In the case of expression experiments using chicken genes, 18S (18S ribosomal RNA), ACTB, and GAPDH are frequently used without verification, while several studies have reported the stability evaluation of housekeeping genes such as pigs, cattle, and sheep. there is

Therefore, the present inventors, while trying to find the optimal reference gene before proceeding with phenotypic, economic traits, or disease resistance-related gene expression studies in chickens, 11 housekeeping genes (B2M, SDHA, GAPDH, RPL13, VIM) in chickens , EEF1A1, HPRT1, GUSB, RPL19, ACTB and ABL1) were selected and the expression stability of the housekeeping genes was analyzed. As a result, GAPDH (heart), HPRT1 (leg muscle) and RPL13 (breast) were the most stable reference genes. By confirming that, the present invention was completed.

The present invention is a housekeeping gene containing nucleotides encoding GAPDH (glyceraldehyde-3-phosphate dehydrogenase), HPRT1 (hypoxanthine phosphoribosyltransferase 1) and RPL13 (ribosomal protein L13) to provide existing genes that serve as a control for gene expression studies. It aims to provide a housekeeping gene.

In addition, an object of the present invention is to provide a composition for measuring the expression of a target gene in chickens, including an agent for determining the expression level of the housekeeping gene.

In addition, an object of the present invention is to provide a kit for measuring the expression of a target gene in chickens, including the above composition.

In addition, the present invention is 1) measuring the expression level of the target gene in a sample isolated from the chicken; and

2) comparing the expression level of the target gene with the expression level of the housekeeping gene of claim 1;

In order to achieve the above object, the present invention provides a housekeeping gene containing nucleotides encoding GAPDH (glyceraldehyde-3-phosphate dehydrogenase), HPRT1 (hypoxanthine phosphoribosyltransferase 1) and RPL13 (ribosomal protein L13). .

In addition, the present invention provides a composition for measuring the expression of a target gene in chickens, including an agent for determining the expression level of the housekeeping gene.

In addition, the present invention provides a kit for measuring the expression of a target gene in chickens, including the above composition.

In addition, the present invention is 1) measuring the expression level of the target gene in a sample isolated from the chicken; and

2) comparing the expression level of the target gene with the expression level of the housekeeping gene of claim 1;

The present invention relates to a chicken housekeeping gene and a method for measuring the expression of a target gene using the same. Specifically, since the housekeeping gene of the present invention is expressed regardless of tissue type, developmental state, cell cycle or external environment, gene expression research It can be usefully used as a reference gene as a control for, and since overexpression or suppression of the gene is directly related to various diseases and cancers, it can be usefully used in the process of gene expression research related to disease.

Figure 1a shows 11 housekeeping genes (B2M, SDHA, GAPDH, RPL13, VIM, EEF1A1, HPRT1, GUSB, RPL19, ACTB and ABL1) derived from heart tissue of long-tailed chickens were amplified using respective gene primers, It is a diagram showing the result of electrophoresis using 2% agarose gel.
Figure 1b shows 11 housekeeping genes (B2M, SDHA, GAPDH, RPL13, VIM, EEF1A1, HPRT1, GUSB, RPL19, ACTB and ABL1) derived from leg muscle tissues of long-tailed chickens were amplified using respective gene primers. , It is a diagram showing the result of electrophoresis using a 2% agarose gel.
Figure 1c shows 11 housekeeping genes (B2M, SDHA, GAPDH, RPL13, VIM, EEF1A1, HPRT1, GUSB, RPL19, ACTB and ABL1) derived from breast tissue of long-tailed chickens were amplified using each gene primer, It is a diagram showing the result of electrophoresis using 2% agarose gel.
Figure 2 measures the expression level of 11 housekeeping genes (B2M, SDHA, GAPDH, RPL13, VIM, EEF1A1, HPRT1, GUSB, RPL19, ACTB and ABL1) derived from leg muscle tissues of long-tailed chickens through RT-qPCR It is a diagram confirming the melting curve for each gene.
3a shows the expression levels of 11 housekeeping genes (B2M, SDHA, GAPDH, RPL13, VIM, EEF1A1, HPRT1, GUSB, RPL19, ACTB and ABL1) in heart tissue of long-tailed chickens through RT-qPCR, It is a diagram confirming the ranking of housekeeping genes with high expression stability in heart tissue using Excel software BestKeeper, geNorm, and NormFinder and web-based software RefFinder.
Figure 3b is after measuring the expression level of 11 housekeeping genes (B2M, SDHA, GAPDH, RPL13, VIM, EEF1A1, HPRT1, GUSB, RPL19, ACTB and ABL1) in leg muscle tissues of long-tailed chickens through RT-qPCR , It is a diagram confirming the ranking of housekeeping genes with high expression stability in leg muscle tissue using Excel software BestKeeper, geNorm, and NormFinder and web-based software RefFinder.
Figure 3c shows the expression levels of 11 housekeeping genes (B2M, SDHA, GAPDH, RPL13, VIM, EEF1A1, HPRT1, GUSB, RPL19, ACTB and ABL1) in breast tissue of long-tailed chickens through RT-qPCR, It is a diagram confirming the ranking of housekeeping genes with high expression stability in breast tissue using Excel software BestKeeper, geNorm, and NormFinder and web-based software RefFinder.

Hereinafter, the present invention will be described in detail.

The present invention provides housekeeping genes including nucleotides encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hypoxanthine phosphoribosyltransferase 1 (HPRT1), and ribosomal protein L13 (RPL13).

In the present invention, the term "GAPDH (glyceraldehyde-3-phosphate dehydrogenase)" is an enzyme involved in the glucose decomposition process in cells, and refers to a housekeeping gene that is always expressed in cells but whose expression level does not change well. The GAPDH housekeeping gene is highly expressed in inflammation, diabetes, hypoxia and respiratory diseases, and dysfunction of the oxidative enzyme GAPDH may contribute to memory loss, cognitive decline and loss of neuronal function in the brain in Alzheimer's disease.

As used herein, the term "HPRT1 (hypoxanthine phosphoribosyltransferase 1)" refers to a housekeeping gene involved in producing purine bases. Deficiency of the HPRT1 housekeeping gene can lead to Lesch-Nyhan disease in humans, which is characterized by mental retardation, movement disorders and overproduction of uric acid.

In the present invention, the term "RPL13 (ribosomal protein L13)" is one of the ribosomal proteins involved in protein synthesis, and is a housekeeping gene that is standard for aging research. As the cell surface type and metabolic efficiency change with aging, the expression of RPL13, which is the standard for aging studies, is constant.

As used herein, the term "nucleotide" is a deoxyribonucleotide or ribonucleotide that exists in single-stranded or double-stranded form, and includes analogs of natural nucleotides unless otherwise specified.

In addition, the present invention provides a composition for measuring the expression of a target gene in chickens, including an agent for determining the expression level of the housekeeping gene.

The chicken may be a long-tailed chicken, but is not limited thereto.

The term "agent for determining the expression level of a housekeeping gene" of the present invention refers to an agent capable of specifically binding to and recognizing a specific site in a housekeeping gene or amplifying the specific site, specifically, It may be a probe capable of specifically binding to the specific site, or a primer capable of specifically amplifying a polynucleotide containing the specific site or a polynucleotide complementary thereto.

The primers can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. These primers can be modified using a number of means known in the art, as long as they exhibit an effect capable of detecting a specific site in the housekeeping gene. Examples of such modifications include methylation, capping, substitution of one or more homologs of the native nucleotide, and modifications between nucleotides, such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates). , carbamates, etc.) or charged linkages (eg, phosphorothioates, phosphorodithioates, etc.). A nucleic acid can contain one or more additional covalently linked moieties, such as proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalants (eg, acridine). , proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents. In addition, if necessary, the primer may include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Examples of labels include enzymes (eg horseradish peroxidase, alkaline phosphatase), radioactive isotopes (eg ³² P), fluorescent molecules and chemical groups (eg biotin), etc. there is

The primer may include any one or more of the polynucleotides represented by SEQ ID NOs: 1 to 6, and preferably, the primers comprising the polynucleotides represented by SEQ ID NOs: 1 and 2 are glyceraldehyde-3-phosphate dehydrogenase (GAPDH) ), and the primers containing the polynucleotides represented by SEQ ID NOs: 3 and 4 may be primers for amplifying the gene encoding HPRT1 (hypoxanthine phosphoribosyltransferase 1), the Primers containing the polynucleotides represented by SEQ ID NOs: 5 and 6 may be primers for amplifying a gene encoding ribosomal protein L13 (RPL13).

As used herein, the term "probe" refers to a nucleic acid fragment corresponding to several to hundreds of bases capable of specifically binding to DNA or RNA, and includes oligonucleotide probes and single stranded DNA probes. , It can be produced in the form of a double stranded DNA probe or an RNA probe.

The probe can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such a probe can be modified using many means known in the art, as long as it has an effect of detecting a specific site in the housekeeping gene. Examples of such modifications include methylation, capping, substitution of one or more homologs of the native nucleotide, and modifications between nucleotides, such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates). , carbamates, etc.) or charged linkages (eg, phosphorothioates, phosphorodithioates, etc.). A nucleic acid can contain one or more additional covalently linked moieties, such as proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalants (eg, acridine). , proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents.

The probe may further conjugate a reporter to its 5' end. The reporter is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), fluorescein chlorotriazinyl (fluorescein chlorotriazinyl), HEX (2', 4', 5', 7'-tetrachloro -6-carboxy-4,7-dichlorofluorescein), rhodamine green, rhodamine red, tetramethylrhodamine, fluorescein isothiocyanate (FITC), oregon green, Alexa Fluoro (alexa fluor), JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), TET (Tetrachloro-Fluorescein), TRITC ( tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes, and thiadicarbocyanine. However, other than those known in the art as materials that can be used as reporters, all may be used.

The probe may further conjugate a quencher to its 3' end. The photon is TAMRA, BHQ (black hole quencher) 1, BHQ2, BHQ3, NFQ (nonfluorescent quencher), dabcyl, Eclipse, DDQ (deep dark quencher), Blackberry Quencher, Iowa black ), but may be any one or more selected from the group consisting of, in addition, any material known in the art that can be used as a quencher may be used.

The "agent for determining the expression level of a housekeeping gene" may include reverse transcription polymerase, DNA polymerase, cofactors such as Mg ²⁺ , dATP, dCTP, dGTP and dTTP. In order to amplify the reverse transcribed cDNA, various DNA polymerases can be used in the amplification step of the present invention. Examples of DNA polymerases include Klenow fragment of E.coli DNA polymerase I, thermostable DNA polymerase or bacteriophage T7 DNA polymerization there are enzymes The polymerase may be isolated from the bacteria itself, purchased commercially, or obtained from cells expressing high levels of a cloned gene encoding the polymerase.

In addition, the present invention provides a kit for measuring the expression of a target gene in a chicken, including the composition for measuring the expression of a target gene in a chicken.

The chicken may be a long-tailed chicken, but is not limited thereto.

The composition may have characteristics as described above. For example, primers containing any one or more of the polynucleotides represented by SEQ ID NOs: 1 to 6 may be included, and preferably, the primers containing the polynucleotides represented by SEQ ID NOs: 1 and 2 are GAPDH (glyceraldehyde- 3-phosphate dehydrogenase) may be a primer for amplifying a gene encoding, and the primers containing the polynucleotides represented by SEQ ID NOs: 3 and 4 may be primers for amplifying a gene encoding HPRT1 (hypoxanthine phosphoribosyltransferase 1) The primers containing the polynucleotides represented by SEQ ID NOs: 5 and 6 may be primers for amplifying a gene encoding ribosomal protein L13 (RPL13).

The kit may be a PCR kit or a kit for DNA analysis, but is not limited thereto.

The kit of the present invention can be confirmed by amplifying a specific region of the housekeeping gene provided in the present invention using the above composition. The kit provided by the present invention may be a kit including essential elements necessary for performing RT-PCR.

For example, the RT-PCR kit, in addition to a specific primer pair for a polynucleotide containing a specific region of the housekeeping gene or a polynucleotide complementary thereto, may be used in a tube or other appropriate container, reaction buffer (pH and magnesium concentration may vary) ), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase inhibitors, RNase inhibitors, DEPC-water and sterile water, and the like. On the other hand, the components included in the kit may be prepared in a liquid form, or may be prepared in a dried form to improve the stability of the product by lowering the degree of freedom of the included components. For the production of such a dried form, the application of a drying step is required, and at this time, heating drying, natural drying, reduced pressure drying, freeze drying, or a combination process thereof may be used.

In the present invention, when applied to the PCR amplification process, the "kit" optionally includes reagents necessary for PCR amplification, such as buffers, DNA polymerases (eg, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , thermostable DNA polymerase obtained from Thermisflavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), DNA polymerase cofactors and dNTPs. The kit may be manufactured in a number of separate packaging or compartments containing the reagent components described above.

In addition, the present invention comprises the steps of 1) measuring the expression level of the target gene in a sample isolated from chicken; and

2) comparing the expression level of the target gene with the expression level of the housekeeping gene of claim 1;

Hereinafter, the method for measuring the target gene expression in chickens of the present invention will be described step by step in detail.

In the method for measuring the expression of the target gene in chickens of the present invention, step 1) is a step of measuring the expression level of the target gene in a sample isolated from the chicken.

The chicken may be a long-tailed chicken, but is not limited thereto.

The separated sample may be one or more selected from the group consisting of heart, leg muscle, and breast meat, but is not limited thereto.

In step 1), the target gene expression is measured by real-time qRT-PCR (Real-time quantitative reverse transcription PCR), microarray, RNA-sequencing (RNA-Seq), Northern blot, and RPA ( RNase protection assay) may be used, but is not limited thereto.

In the method for measuring the expression of a target gene in chickens of the present invention, step 2) is a step of comparing the expression level of the target gene with the expression level of the housekeeping gene of claim 1.

The housekeeping gene may have the above-described characteristics. For example, the housekeeping gene may include a housekeeping gene encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hypoxanthine phosphoribosyltransferase 1 (HPRT1), and ribosomal protein L13 (RPL13).

In one embodiment of the present invention, the present inventors obtained three tissues (heart, leg muscle and breast meat) from three long-tailed chickens and obtained total RNA therefrom (see Example 1), and then in chickens Eleven housekeeping genes (B2M, SDHA, GAPDH, RPL13, VIM, EEF1A1, HPRT1, GUSB, RPL19, ACTB and ABL1) previously studied were selected, and sequence information was obtained from NCBI (National Center for Biotechnology Information) for each gene. The mRNA sequences were collected to prepare primers (see Example 2). As a result of performing RT-qPCR using the primers, the PCR efficiency of each housekeeping gene was between 81 and 106%, and the melting temperature was between 78 and 86°C. In addition, 11 housekeeping genes showed the formation of a single band in electrophoresis (see Figs. 1a, 1b and 1c), and no non-specific amplification reaction of the gene was observed in the melting curve of RT-qPCR (see Fig. 2). In addition, as a result of analyzing the stability of each housekeeping gene, GAPDH was the most suitable for the heart (see Fig. 3a), and HPRT1 was the most suitable for the leg muscle (Fig. 3b). Reference), RPL13 was most suitable for breast meat (see FIG. 3c), and it was confirmed that HPRT1 gene was the most stable reference gene in all tissues (see Experimental Example 1).

Hereinafter, the present invention will be described in detail by examples and experimental examples.

However, the following Examples and Experimental Examples illustrate the present invention, and the content of the present invention is not limited by the Examples and Experimental Examples.

<Example 1> RNA extraction from tissue samples

Three types of tissue (heart, leg muscle and breast meat) were obtained and stored from 3 long-tailed chickens. The stored tissue was rapidly cooled in liquid nitrogen in a mortar and then finely ground into 1 mL of Trizol (Ambion, USA) and added with 200 μL chloroform ( Sigma-Aldrich, Germany) and mixed (vortexing). Then, centrifugation was performed at 13000 rpm for 15 minutes, and the transparent supernatant was dispensed into a new tube. The same amount of isopropanol was added to the tube containing the supernatant, and after centrifugation at 13000 rpm for 10 minutes, the supernatant except for the pellet was removed. The precipitate was washed with 70% ethanol (ethanol, EtOH) and dried at room temperature for 10 minutes to finally obtain total RNA. After dissolving the extracted RNA in DEPC (diethylpyrocarbonate) water, the purity of the RNA was checked using an ND-1000 spectrophotometer (Nanodrop, USA), and electrophoresis was performed on a 2% agarose gel (BioD, Korea) to detect RNA degradation. ) was confirmed.

<Example 2> Housekeeping gene screening and primer construction

The present inventors selected 11 housekeeping genes (B2M, SDHA, GAPDH, RPL13, VIM, EEF1A1, HPRT1, GUSB, RPL19, ACTB and ABL1) previously studied in chickens, and sequence information was obtained from NCBI (National Center for Biotechnology Information ), mRNA sequences of each gene were collected and primers were prepared. The basic settings are the length of the amplification product (100-170bp), primer length (20mers), annealing temperature (60-61 ℃) and GC content (GC content, 55-60%), and Primer 3 Plus (http: //primer3plus.com/cgi-bin/dev/ primer3plus.cgi) program (Table 1). The PCR efficiency value (Efficiency %) of each primer was diluted 1, 101, 102, and 103 times to obtain a slope value through a standard curve (see the equation below).

Efficiency value (Efficeincy %) = 10(-1/Slope)-1)×100

Gene symbol Discription RefSeq Amplicon size (bp) Sequence(5'→3') Sequence number GAPDH Glyceraldehyde-3-phosphate dehydrogenase NM_204305 116 F: TCACAGCCACACAGAAGACG One R: TTTCCCCACAGCCTTAGCAG 2 HPRT1 Hypoxanthine phosphoribosyltransferase 1 NM_204848 147 F: CAGAGAGACTGGCACGTGAA 3 R: TGGGGATTGACTTGTCACTG 4 RPL13 Ribosomal protein L 13 NM_204999 118 F: GGATCCCAGGCGAAGAAAACA 5 R: TCCTTTCTTCGGTGCAGACG 6 B2M β-2-microglobulin NM_001001750 166 F: CAAGGTGCAGGTGTACTCCC 7 R: CCAGTCGTCGTTGAAGGACA 8 VIM Vimentin NM_001048076 112 F: GCCAGATGCGTGAAATGGAG 9 R: TGGCGAGCCATTTCTTCCTT 10 EEF1A1 Eukaryotic translation elongation factor 1 α 1 NM_001321516 109 F: GGTTACCCGGAAAGATGGCA 11 R: TTGAAGAGGCAGACGCAGAG 12 SDHA Succinate dehydrogenase complex flavoprotein subunit A NM_001277398 107 F: ACCATTTACCACCCCAGCAG 13 R: AGGCAAAACGGGAATAGGCT 14 GUSB Glucuronidase-β NM_001039316 111 F: TGGGTGAATGGAGTGCAAGT 15 R: AACAGTGATGCGGCAGAGAA 16 RPL19 Ribosomal protein L 19 NM_001030929 116 F: GGAAGAGAAAGGGTACGGCC 17 R: GCGGTCGATCTTCTTTGGACT 18 ACTB β-actin NM_205518 101 F: TCTGTATGCCAACACAGTGCT 19 R: TCATTGTGCTAGGTGCCAGG 20 ABL1 ABL proto-oncogene 1, non-receptor tyrosine kinase XM_015279734 141 F: GCCTTGTAGGGGAGAACCAC 21 R: ACTTGTTGTAGGCCAGGCTC 22

<Experimental Example 1> Expression stability analysis of housekeeping genes

In order to select a housekeeping gene set that is a reference in relation to tissue-specific gene expression in chickens, RT-qPCR was used to select B2M, SDHA, GAPDH, RPL13, VIM, EEF1A1, HPRT1, GUSB, RPL19, ACTB and ABL1. After measuring the expression of 11 housekeeping genes, the expression stability of each gene was analyzed.

Specifically, cDNA synthesis was performed using the SuperScript®III First-Strand Synthesis System for RT-PCR (Invitrogen, USA) kit. Reaction solution I prepared from 4μL of extracted RNA (40ng), 1μL of random hexamers (50ng/μL), 1μL of dNTP (10mM), and 4μL of DEPC-treated water was reacted at 65℃ for 5 minutes and then reacted on ice for 1 minute. Then, 10μL of 10X RT buffer, 4μL of MgCl2 (25mM), 2μL of DTT (0.1M), 1μL of RNaseOUT™ (40U/μL), and 1μL of SuperScript® (200U/μL) were used to make a total reaction solution of 10μL, followed by reaction solution Ⅰ After mixing and reacting at 25℃ for 10 minutes, 50℃ for 50 minutes, and 85℃ for 5 minutes, the mixture was immediately reacted with ice. Finally, 1 μL of RNase H was added and reacted at 37 ° C for 20 minutes to remove RNA and stored at -20 ° C. GeneAmp PCR system 9700 (Applied Biosystems, USA) was used for the PCR reaction for gene amplification of each primer in the synthesized cDNA, cDNA 2μL, 10X Buffer 2μL, dNTP (2.5mM) 1.6μL, forward/reverse primer (10pmol ) 0.4 μL each, 0.6 μL of HS Taq polymerase (2.5 units/μL) and 13 μL of sterile distilled water were added to adjust the total to 20 μL. The reaction conditions were 37 times of 30 seconds at 94 ℃, 30 seconds at 60 ℃, 45 seconds at 72 ℃ after 11 minutes reaction at 95 ℃, 30 minutes reaction at 60 ℃ stored at 8 ℃. PCR products were confirmed through electrophoresis on a 2% agarose gel.

Then, RT-qPCR for gene expression analysis was performed with a 7500 Real-time PCR System (Applied Biosystems, USA), and the reaction solution was cDNA 2μL, 2X SYBR Green Master MIX (Applied Biosystemes, USA) 10μL, forward/ After adding 1 μL of each reverse primer (10 pmol), 6 μL of DEPC water was added last to make a total of 20 μL. PCR conditions were repeated 40 times at 50 ° C for 2 minutes and 95 ° C for 10 minutes, followed by 95 ° C for 15 seconds and 60 ° C for 1 minute. And finally, it was reacted at 95 ℃ for 15 seconds, 60 ℃ for 1 minute, 95 ℃ for 30 seconds, 60 ℃ for 15 seconds. The gene expression level of each primer was checked through a threshold cycle (Ct) and a non-specific amplification reaction was confirmed through a melting curve.

Gene expression stability evaluation was analyzed by dividing into heart, leg muscle and breast meat. The analysis program used the Microsoft-Excel-based software Bestkeeper, NormFinder and geNorm tools, and finally RefFinder (https://www.heartcure.com), a web-based software that integrates the three tools to compare all housekeeping genes. .au/reffinder/?type=reference#) to rank overall stability. Bestkeeper analysis calculates expression variation through standard deviation (SD) and coefficient of variation (CV) with the Ct value of each gene, and the gene with the lowest standard deviation value is not represented as the optimal reference gene. However, genes with SD>1 are considered inconsistent. Unlike bestkeeper, NormFinder and geNorm analysis determine genetic stability with a 2-ΔCt value (at this time, the Ct value is converted into a relative quantity using the formula ΔCt = Ct value - lowest Ct value). geNorm analysis determines mutual stability as pairwise variations (V) through comparison between genes, and sets the lowest M value as high stability through the average expression stability (M) value of each gene. NormFinder determines the optimal reference gene ranking by analyzing the stability values of housekeeping genes based on expression variation within and between groups.

As a result of RT-qPCR, the PCR efficiency of each housekeeping gene was between 81 and 106%, and the melting temperature was between 78 and 86°C. In addition, 11 housekeeping genes showed the formation of single bands in electrophoresis (Figs. 1a, 1b and 1c), and no non-specific amplification of genes was observed in the melting curve of RT-qPCR (Fig. 2).

As a result of analyzing the stability of each housekeeping gene, GAPDH was most suitable for heart (Fig. 3a), HPRT1 was most suitable for leg muscle (Fig. 3b), and breast meat RPL13 was the most appropriate (Fig. 3c), and the HPRT1 gene was selected as the most stable reference gene in all tissues.

Therefore, the three housekeeping genes (GAPDH, HPRT1 and RPL13) can be applied as the most stable reference gene set according to various experimental conditions and tissue types in future gene expression studies using chickens.

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Housekeeping gene of chicken, and method for measuring expression of the target gene using the same <130> 2020P-10-024 <160> 22 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> GAPDH forward primer <400> 1 tcacagccac acagaagacg 20 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> GAPDH reverse primer <400> 2 tttccccaca gccttagcag 20 <210> 3 <211> 20 <212> DNA <213> artificial sequence <220> <223> HPRT1 forward primer <400> 3 cagagagact ggcacgtgaa 20 <210> 4 <211> 20 <212> DNA <213> artificial sequence <220> <223> HPRT1 reverse primer <400> 4 tggggattga cttgtcactg 20 <210> 5 <211> 20 <212> DNA <213> artificial sequence <220> <223> RPL13 forward primer <400> 5 ggatcccagg cgaagaaaca 20 <210> 6 <211> 20 <212> DNA <213> artificial sequence <220> <223> RPL13 reverse primer <400> 6 tcctttcttc ggtgcagacg 20 <210> 7 <211> 20 <212> DNA <213> artificial sequence <220> <223> B2M forward primer <400> 7 caaggtgcag gtgtactccc 20 <210> 8 <211> 20 <212> DNA <213> artificial sequence <220> <223> B2M reverse primer <400> 8 ccagtcgtcg ttgaaggaca 20 <210> 9 <211> 20 <212> DNA <213> artificial sequence <220> <223> VIM forward primer <400> 9 gccagatgcg tgaaatggag 20 <210> 10 <211> 20 <212> DNA <213> artificial sequence <220> <223> VIM reverse primer <400> 10 tggcgagcca tttcttcctt 20 <210> 11 <211> 20 <212> DNA <213> artificial sequence <220> <223> EEF1A1 forward primer <400> 11 ggttacccgg aaagatggca 20 <210> 12 <211> 20 <212> DNA <213> artificial sequence <220> <223> EEF1A1 reverse primer <400> 12 ttgaagaggc agacgcagag 20 <210> 13 <211> 20 <212> DNA <213> artificial sequence <220> <223> SDHA forward primer <400> 13 accatttacc accccagcag 20 <210> 14 <211> 20 <212> DNA <213> artificial sequence <220> <223> SDHA reverse primer <400> 14 aggcaaaacg ggaataggct 20 <210> 15 <211> 20 <212> DNA <213> artificial sequence <220> <223> GUSB forward primer <400> 15 tgggtgaatg gagtgcaagt 20 <210> 16 <211> 20 <212> DNA <213> artificial sequence <220> <223> GUSB reverse primer <400> 16 aacagtgatg cggcagagaa 20 <210> 17 <211> 20 <212> DNA <213> artificial sequence <220> <223> RPL19 forward primer <400> 17 ggaagagaaa gggtacggcc 20 <210> 18 <211> 20 <212> DNA <213> artificial sequence <220> <223> RPL19 reverse primer <400> 18 gcggtcgatc ttcttggact 20 <210> 19 <211> 21 <212> DNA <213> artificial sequence <220> <223> ACTB forward primer <400> 19 tctgtatgcc aacacagtgc t 21 <210> 20 <211> 20 <212> DNA <213> artificial sequence <220> <223> ACTB reverse primer <400> 20 tcattgtgct aggtgccagg 20 <210> 21 <211> 20 <212> DNA <213> artificial sequence <220> <223> ABL1 forward primer <400> 21 gccttgtagg ggagaaccac 20 <210> 22 <211> 20 <212> DNA <213> artificial sequence <220> <223> ABL1 reverse primer <400> 22 acttgttgta ggccaggctc 20

Claims (14)

delete Nucleotide encoding any one of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) expressed in chicken heart, HPRT1 (hypoxanthine phosphoribosyltransferase 1) expressed in chicken leg muscle, and RPL13 (ribosomal protein L13) expressed in chicken breast Including an agent for determining the expression level of a housekeeping gene comprising
The agent is a primer or probe,
The primer is characterized in that it comprises any one or more of the polynucleotides represented by SEQ ID NOs: 1 to 6, the composition for measuring the expression of the target gene in chickens.
delete delete According to claim 2,
The primers comprising the polynucleotides represented by SEQ ID NOs: 1 and 2 are primers for amplifying a gene encoding GAPDH (glyceraldehyde-3-phosphate dehydrogenase), characterized in that, a composition for measuring the expression of a target gene in chickens.
According to claim 2,
The primers comprising the polynucleotides represented by SEQ ID NOs: 3 and 4 are primers for amplifying the gene encoding HPRT1 (hypoxanthine phosphoribosyltransferase 1), characterized in that, the composition for measuring the expression of the target gene in chickens.
According to claim 2,
The primers comprising the polynucleotides represented by SEQ ID NOs: 5 and 6 are primers for amplifying the gene encoding RPL13 (ribosomal protein L13), characterized in that, the composition for measuring the expression of the target gene in chickens.
According to claim 2,
Characterized in that the chicken is a long-tailed chicken, a composition for measuring the expression of a target gene in a chicken.
A kit for measuring the expression of a target gene in a chicken, comprising the composition of claim 2.
According to claim 9,
Characterized in that the chicken is a long-tailed chicken, a kit for measuring the expression of a target gene in a chicken.
1) measuring the expression level of a target gene in a sample isolated from chickens; and
2) comparing the expression level of the target gene and the expression level of the housekeeping gene;
The separated sample is at least one selected from the group consisting of heart, leg muscle and breast meat,
Wherein the housekeeping gene is any one of GAPDH expressed in chicken heart, HPRT1 expressed in chicken leg muscle, and RPL13 expressed in chicken breast meat.
According to claim 11,
Characterized in that the chicken is a long-tailed chicken, a method for measuring the expression of a target gene in a chicken.
delete According to claim 11,
In step 1), the target gene expression is measured by real-time qRT-PCR (Real-time quantitative reverse transcription PCR), microarray, RNA-sequencing (RNA-Seq), Northern blot, and RPA ( RNase protection assay) characterized in that using a method selected from the group consisting of, measuring the expression of the target gene in chickens.

Images