KR102436084B1 - Novel peptides and compositions comprising them - Google Patents

Abstract

The present specification relates to a novel peptide and a composition comprising the same, and more specifically, a novel peptide and a composition including the same, which are effective in preventing and treating anti-inflammatory, anti-fiber, wound healing, and anticancer, are disclosed. The novel peptides and compositions comprising the same disclosed herein exhibit effects of improving, preventing and treating symptoms of diseases such as inflammation, fibrosis and wounds and cancer including the above symptoms, thereby providing a method for preventing and treating related diseases. .

Description

Novel peptides and compositions comprising them

The present specification relates to a novel peptide and a composition comprising the same, and more particularly, to a composition comprising the novel peptide and effective for anti-inflammatory, anti-fibrotic, wound healing, skin improvement and anti-cancer treatment.

Tumor necrosis factor (TNF), particularly TNF-α, is known to be released from inflammatory cells to cause a variety of cytotoxic, immune and inflammatory responses. It is known that TNF-α is involved in the onset and naturalization of many inflammatory diseases and autoimmune diseases, and causes severe sepsis and septic shock when released into the blood and acting on the whole body. As described above, since TNF-α is a factor widely related to the immune system of a living body, the development of drugs that inhibit TNF-α is being actively carried out. TNF-α is biosynthesized in an inactive form and cleaved by a protease to become an active form, but the enzyme involved in this activation is called tumor necrosis factor converting enzyme (TACE). Therefore, a substance that inhibits this TACE can treat, improve, and prevent diseases, conditions, abnormal conditions, poor conditions, and unfavorable subjective symptoms caused by TNF-α (KR2011-0060940A).

Fibrosis is a disease in which abnormal production, accumulation and deposition of extracellular matrix by fibroblasts occurs, and refers to abnormal accumulation of collagen matrix according to injury or inflammation that changes the structure and function of various tissues. Irrespective of the location of fibrosis, most etiologies of fibrosis involve excessive accumulation of collagen matrix replacing normal tissue. In particular, fibrosis caused by kidney, liver, lung, heart, bone or bone marrow, and skin leads to organ failure and, in the worst case, death. The fibroblasts function to form a fibrous tissue by generating a precursor of the extracellular matrix in a normal state. The extracellular matrix, which is an intercellular substance of connective tissue, exists in the form of proteins such as fibronectin, laminin, chondronectin, and collagen.

On the other hand, TGF-β has very diverse roles such as abnormal production and accumulation of extracellular matrix by fibroblasts, such as cell proliferation, inflammatory response, and cancer cell metastasis, and many cellular signaling pathways and targets have been identified. have. Therefore, studies on TGF-β have been conducted in many disease models, and fibrotic diseases and cancer are the fields in which research and drug development are most active. TGF-β is reported to play an important role in the pathogenesis of various diseases, including cancer, heart disease, and diabetes, by inducing or limiting cell proliferation as a cell growth regulator, and various physiological activities have been reported. For example, inhibition of TGF-β synthesis (inhibition of cell proliferation regulator production), TGF-β antagonist (disturbing TGF receptor, interfering with signal transduction), Platelet-Derived Growth Factor (PDGF) antagonist (inhibiting angiogenesis-inducing factor), It has actions such as p38 MAP kinase inhibitor (inhibits cell proliferation signal transduction enzyme) and anti-inflammatory (inhibits production of TNF-alpha and MAPK). Therefore, if it is possible to more directly inhibit TGF-β or block the signaling process involving TGF-β and to develop a new pharmaceutical composition without side effects, it is possible to prevent and treat various diseases and aging caused by fibrosis. You can do it.

The wound healing process is largely divided into four stages: inflammation, granulation, epithelialization, and fibroplasia. In the inflammatory phase, necessary cells (fibroblasts, epithelial cells, etc.) are activated. Then, in the granulation phase, fibroblasts deposit collagen, which increases collagen and makes the wound mature. Also, keratinocyte changes occur at the wound site, the epidermis at the defect site thickens, and epithelial cells migrate from the basal cells under the epidermis to the epidermis. This is called the epithelialization stage. And, going through the epithelialization stage to the fibrous growth stage, collagen fibers form a collagen matrix to fill the wound defect site, and when this is done for a long period of time, it will be healed. Therefore, it can be said that epithelial cell proliferation and collagen production are also one of the important mechanisms of wound healing and anti-aging action.

Under this background, the present inventors have developed novel peptides, found that there are effects such as anti-inflammatory, anti-fibrotic, wound healing, skin improvement and anti-cancer effects through TNF-α reduction and TGF-β inhibition, and completed the present invention.

In one aspect, an object of the present invention is to provide a novel peptide having anti-inflammatory, anti-fibrotic, wound healing and anti-cancer effects, and a composition for preventing and treating diseases comprising the same.

In one aspect, the present invention provides a peptide comprising the amino acid sequence represented by SEQ ID NO: 1, or a peptide that is a fragment of the peptide sequence, or a pharmaceutically acceptable salt thereof.

In one aspect, the present invention provides an anti-inflammatory composition comprising the peptide, or a pharmaceutically acceptable salt thereof.

In one aspect, the anti-inflammatory composition according to the present invention may be an anti-inflammatory composition, characterized in that it has anti-inflammatory activity by inhibiting TNF-α.

In one aspect, the anti-inflammatory composition according to the present invention is rheumatoid arthritis, psoriasis, psoriatic arthritis, atopic dermatitis, inflammatory bowel disease such as ulcerative colitis and Crohn's disease, ankylosing spondylitis, multiple sclerosis, systemic lupus erythematosus (SLE), chronic occlusion It may be a composition characterized in that it prevents or treats any one or more inflammation-related diseases selected from the group consisting of sexual pulmonary disease (COPD), sepsis, endotoxin shock, hepatitis, and type 1 diabetes.

In one aspect, the present invention also provides a composition for preventing, treating or improving body organ fibrosis comprising the peptide, or a pharmaceutically acceptable salt thereof.

In one aspect, the composition for preventing, treating or improving body organ fibrosis according to the present invention may be a composition characterized in that it has an activity of inhibiting body organ fibrosis by inhibiting TGF-beta signaling.

In one aspect, the composition for preventing, treating or improving body organ fibrosis according to the present invention is a composition for preventing and treating fibrosis induced by at least one selected from the group consisting of cancer, anticancer drug administration, and radiation exposure can

In one aspect, the composition for preventing, treating or improving body organ fibrosis according to the present invention is selected from the group consisting of pancreatic cancer, colorectal cancer, stomach cancer, prostate cancer, non-small cell lung cancer, breast cancer, melanoma and ovarian cancer. It may be a composition characterized in that it prevents or treats.

In one aspect, the present invention also provides a composition for treating or improving a wound comprising the peptide, or a pharmaceutically acceptable salt thereof.

In one aspect, the composition for wound treatment or improvement according to the present invention may be a composition characterized in that it has a wound healing effect by inducing collagen synthesis.

In one aspect, the composition for treating or improving wounds according to the present invention is selected from the group consisting of skin wrinkles, dry skin, scars, skin pits, epidermal burns, epidermal lacerations, epidermal wounds, and combinations thereof. Prevention of skin diseases or exacerbations Or it may be a composition characterized in that it is treated.

In an embodiment of the present invention, the composition may be a composition for improving skin condition including the one or more peptides, or a salt thereof. In one embodiment, the skin condition may be any one or more of skin wrinkles, dry skin, reduced elasticity, and skin dents due to skin aging. In one embodiment, the composition may be a cosmetic composition.

In one embodiment of the present invention, the composition may be an anticancer composition comprising the one or more peptides, or a salt thereof.

In one aspect, the present invention also provides a composition comprising the peptide, or a pharmaceutically acceptable salt thereof; And it provides a kit used for the efficacy of any one or more of anti-inflammatory, anti-fibrotic, anti-cancer, wound healing, and skin condition improvement, including instructions disclosing one or more of the dosage, administration route, administration frequency, and indications of the composition. .

In one aspect, the present invention also administers a composition comprising the peptide, or a pharmaceutically acceptable salt thereof, to a subject in need of any one or more effects of anti-inflammatory, anti-fibrotic, anti-cancer, wound healing and skin condition improvement. It provides a method for improving, preventing or treating inflammation, fibrosis, cancer, or wounds, including methods for improving skin conditions.

In one aspect, the present invention provides a novel use of the peptide, or a pharmaceutically acceptable salt thereof. In one embodiment, the use may be amelioration, prevention and treatment of inflammation, fibrosis, cancer or wounds. In another embodiment, the use may be for improving skin condition. In one embodiment, the skin condition may be any one or more of skin wrinkles, dry skin, reduced elasticity, and skin dents due to skin aging. For example, it may be used as a cosmetic composition.

In one aspect, the present invention may be a peptide or a salt thereof for improving, preventing or treating inflammation, fibrosis, cancer or wounds.

In one aspect, the peptides or fragments of the peptides comprising the sequence of SEQ ID NO: 1 according to the present invention have anti-inflammatory, anti-fibrotic, wound healing and anti-cancer effects, thereby preventing or treating inflammation, fibrosis, wounds and cancer-related diseases is expected to provide

1 is a novel peptide SEQ ID NO: 1 (ALTSKLRG) and positive control peptide SEQ ID NO: 2 (ALTSKLRA) in LPS-treated THP-1 cell line at each concentration (1, 5, 10 μM) after treatment with TNF-α It is a graph showing the inhibition ratio after measuring the mRNA expression level through RT-qPCR.
2 is a group administered with a novel peptide, SEQ ID NO: 1 (ALTSKLRG) and a positive control peptide, SEQ ID NO: 2 (ALTSKLRA), at each concentration (0.05, 0.5, 5 μM) in the LPS-induced THP-1 cell line; It is a graph showing the amount of TNF-α measured by ELISA after dividing it into a control group untreated and a positive control group treated with estradiol (E2).
3 shows a control group not treated with anything in the HepG2 cell line, a fibrosis control group treated only with TGF-β, a positive control group treated with TGF-β and SB43152, a novel peptide SEQ ID NO: 1 (ALTSKLRG) and a positive control peptide SEQ ID NO: 2 ( ALTSKLRA) was divided into groups treated with each concentration (1 and 10 μM), and the fibrosis markers phosphor-Smad 2/3 and Smad 2/3 and the expression of the reference gene GAPDH were analyzed by Western blotting and image analyzer. It is a photograph (top) and graph (bottom) showing this after measurement.
Figure 4 is a wound-inducing animal model inducing a wound in SD rats immediately after the wound and every 2 days, 50 μl of a new peptide at a concentration of 100 μg / ml each time treated immediately (0 day) and 1, 3, 5, 7, 10 , is a graph showing the area of the wound every 11 measured with the control group that was not treated at all.
Figure 5 shows a wound induction animal model inducing a wound in SD rats immediately after the wound and at intervals of 2 days in an experimental group treated with 100 μg/ml of a new peptide at a concentration of 50 μl each time and a control group untreated on the 3rd and 5th days, respectively. It is a graph showing the degree of collagen production by measuring the average fluorescence intensity by performing a biopsy of two animals and staining the tissue with masson trichrome.

Best mode for carrying out the invention

The present invention can apply various transformations and can have various embodiments. Hereinafter, the present invention will be described in more detail. However, this is not intended to limit the present invention to specific embodiments, and should be understood to include all modifications, equivalents, and substitutes included in the spirit and scope of the present invention. In describing the present invention, if it is determined that a detailed description of a related known technology may obscure the gist of the present invention, the detailed description thereof will be omitted.

In one aspect of the present invention, a novel peptide comprising the sequence of SEQ ID NO: 1 (ALTSKLRG) or a fragment thereof is disclosed. In one embodiment a novel peptide consisting of the sequence of SEQ ID NO: 1 (ALTSKLRG) is disclosed. The molecular weight of the sequence SEQ ID NO: 1 is 844.51.

The peptides disclosed herein include peptides comprising SEQ ID NO: 1 or fragments thereof and one or more amino acids, two or more amino acids, three or more amino acids, four or more amino acids, five or more amino acids, six or more amino acids or 7 It may comprise a peptide in which more than one amino acid has been changed.

In one aspect of the present invention, the amino acid change belongs to a property that causes the physicochemical properties of the peptide to be altered. For example, amino acid changes can be performed to improve the thermostability of the peptide, alter substrate specificity, change the optimum pH, and the like.

As used herein, "amino acid" includes the 22 standard amino acids that are naturally incorporated into peptides, as well as D-isomeric and modified amino acids. Accordingly, in one aspect of the present invention, the peptide may be a peptide comprising a D-amino acid. Meanwhile, in another aspect of the present invention, the peptide may include post-translational modified non-standard amino acids and the like. Examples of post-translational modifications include phosphorylation, glycosylation, acylation (including, e.g., acetylation, myristoylation, and palmitoylation), alkylation ), carboxylation, hydroxylation, glycation, biotinylation, ubiquitinylation, changes in chemical properties (eg, beta-elimination deimidation) , deamidation) and structural changes (eg, formation of disulfide bridges). Also includes changes in amino acids caused by chemical reactions occurring in the course of binding with crosslinkers to form peptide conjugates, such as changes in amino acids, such as changes in amino groups, carboxy groups or side chains.

The peptides disclosed herein may be wild-type peptides identified and isolated from a pristine source. On the other hand, the peptide disclosed herein may be an artificial variant, comprising an amino acid sequence in which one or more amino acids are substituted, deleted and/or inserted as compared to the peptide fragments of SEQ ID NO: 1. Amino acid changes in wild-type polypeptides as well as in artificial variants include conservative amino acid substitutions that do not significantly affect the folding and/or activity of the protein. Examples of conservative substitutions are basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine, valine and methionine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine and threonine). Amino acid substitutions that generally do not alter specific activity are known in the art. The most common exchanges are Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, and Asp/Gly, and vice versa. Other examples of conservative substitutions are given in the table below.

original amino acids Exemplary residue substitutions Preferred residue substitutions Ala (A) val; leu; ile Val Arg (R) lys; gln; asn Lys Asn (N) gln; his; asp, lys; arg Gln Asp (D) glu; asn Glu Cys (C) ser; ala Ser Gln (Q) asn; glu Asn Glu (E) asp; gln Asp Gly (G) Ala Ala His (H) asn; gln; lys; arg Arg Ile (I) leu; val; met; ala; phe; norleucine Leu Leu (L) norleucine; ile ; val; met; ala; phe Ile Lys (K) arg; gln; asn Arg Met (M) leu; phe; ile Leu Phe (F) leu; val; ile; ala; tyr Tyr Pro (P) Ala Ala Ser (S) thr Thr Thr (T) Ser Ser Trp (W) tyr; phe Tyr Tyr (Y) trp; phe; thr; ser Phe Val (V) ile; leu; met; phe; ala; norleucine Leu

Substantial modifications in the biological properties of the peptides may include (a) their effect on maintaining the structure of the polypeptide backbone within the region of substitution, e.g., a sheet or helical conformation, (b) the charge of the molecule at the target site. or by selecting substituents that differ significantly in their effect in maintaining hydrophobicity, or (c) in maintaining the bulk of the side chains. Natural residues are divided into the following groups based on common side chain properties:

(1) hydrophobic: norleucine, met, ala, val, leu, ile;

(2) neutral hydrophilicity: cys, ser, thr;

(3) acidic: asp, glu;

(4) basic: asn, gln, his, lys, arg;

(5) residues that affect chain orientation: gly, pro; and

(6) Aromatics: trp, tyr, phe.

Non-conservative substitutions will be made by exchanging a member of one of these classes for another class. Any cysteine residue not involved in maintaining the proper conformational structure of the peptide may be substituted, generally with serine, to improve the oxidative stability of the molecule and prevent aberrant crosslinking. Conversely, cysteine bond(s) can be added to the peptide to improve its stability.

Another type of amino acid variant of a peptide is one in which the glycosylation pattern of the antibody is altered. A change refers to the deletion of one or more carbohydrate moieties found in the peptide and/or the addition of one or more glycosylation sites not present in the peptide.

Glycosylation of peptides is typically either N-linked or O-linked. N-linked refers to the attachment of a carbohydrate moiety to the side chain of an asparagine moiety. The tripeptide sequences asparagine-X-serine and asparagine-X-threonine, where X is any amino acid except proline, are recognition sequences for enzymatic attachment of carbohydrate moieties to the asparagine side chain. Thus, the presence of one of these tripeptide sequences in the polypeptide creates a potential glycosylation site. O-linked glycosylation refers to the attachment of one of the sugars N-acetylgalactosamine, galactose or xylose to a hydroxyamino acid, most commonly serine or threonine, but 5-hydroxyproline or 5-hydroxylysine can also be used.

Addition of glycosylation sites to the peptide is conveniently accomplished by changing the amino acid sequence to contain one or more of the aforementioned tripeptide sequences (for N-linked glycosylation sites). Such changes may also be made by adding or substituting one or more serine or threonine residues to the sequence of the original antibody (for O-linked glycosylation sites).

In addition, the peptide of SEQ ID NO: 1 according to an aspect of the present invention has advantages of low intracellular toxicity and high in vivo stability. In one aspect of the present invention, there is provided a pharmaceutical composition comprising at least one peptide comprising the amino acid sequence of SEQ ID NO: 1 or a peptide fragment thereof as an active ingredient.

In one aspect, the pharmaceutical composition for preventing and treating inflammation, fibrosis, wounds, and cancer-related diseases according to an aspect of the present invention contains 0.01 mg/mL to 0.1 mg/mL, 1 mg of a peptide comprising SEQ ID NO: 1 or a fragment thereof. It can be included in the amounts of /mL, 10mg/mL, and 100mg/mL, but if there is a difference in the effect depending on the dose, it can be appropriately adjusted. When included in the above range or less, it is appropriate to exhibit the intended effect of the present invention, and both stability and safety of the composition may be satisfied, and it may be appropriate to include in the above range in terms of cost-effectiveness. .

The composition according to one aspect of the present invention can be applied to all animals including humans, dogs, chickens, pigs, cattle, sheep, guinea pigs or monkeys.

The pharmaceutical composition according to one aspect of the present invention may be administered orally, rectal, transdermally, intravenously, intramuscularly, intraperitoneally, intramedullary, intrathecally or subcutaneously.

Formulations for oral administration may be tablets, pills, soft or hard capsules, granules, powders, solutions, or emulsions, but are not limited thereto. Formulations for parenteral administration may be injections, drops, lotions, ointments, gels, creams, suspensions, emulsions, suppositories, patches, or sprays, but is not limited thereto.

The pharmaceutical composition according to one aspect of the present invention may contain additives such as diluents, excipients, lubricants, binders, disintegrants, buffers, dispersants, surfactants, colorants, flavorings or sweeteners, if necessary. The pharmaceutical composition according to one aspect of the present invention may be prepared by a conventional method in the art.

The active ingredient of the pharmaceutical composition according to an aspect of the present invention will vary depending on the age, sex, weight, pathological condition and severity of the subject to be administered, the route of administration, or the judgment of the prescriber. Determination of the dosage based on these factors is within the level of one skilled in the art, and the daily dose thereof is for example 0.1 μg/kg/day to 100 g/kg/day, specifically 10 μg/kg/day to 10 g/kg / day, more specifically, 100 μg/kg/day to 1 g/kg/day, and more specifically 500 μg/kg/day to 100 mg/kg/day, but the difference in effect depending on the dose If it is visible, it can be appropriately adjusted. The pharmaceutical composition according to one aspect of the present invention may be administered 1 to 3 times a day, but is not limited thereto.

The formulation of the composition according to one aspect of the present invention is not particularly limited, but may be formulated as, for example, tablets, granules, powders, liquids, solid formulations, and the like. Each formulation can be formulated by appropriately selecting components commonly used in the field other than the active ingredient without difficulty depending on the formulation or purpose of use, and when applied simultaneously with other raw materials, a synergistic effect may occur.

The composition comprising the peptide according to one aspect of the present invention is rheumatoid arthritis, psoriasis, psoriatic arthritis, atopic dermatitis, inflammatory bowel disease such as ulcerative colitis and Crohn's disease, ankylosing spondylitis, multiple sclerosis, systemic lupus erythematosus (SLE), It can be used as a pharmaceutical composition for preventing or treating any one or more inflammation-related diseases selected from the group consisting of chronic obstructive pulmonary disease (COPD), sepsis, endotoxin shock, hepatitis and type 1 diabetes.

The composition comprising the peptide according to one aspect of the present invention can be used as a pharmaceutical composition for preventing and treating fibrosis induced by at least one selected from the group consisting of cancer, anticancer agent administration, and radiation exposure.

The pharmaceutical composition for preventing and treating fibrosis comprising the peptide according to one aspect of the present invention is a cancer cell tissue selected from the group consisting of pancreatic cancer, colorectal cancer, stomach cancer, prostate cancer, non-small cell lung cancer, breast cancer, melanoma and ovarian cancer. It may have the effect of inhibiting fibrosis.

The composition comprising the peptide according to one aspect of the present invention prevents or treats and improves skin diseases or exacerbations selected from the group consisting of skin wrinkles, dry skin, skin pits, epidermal burns, epidermal lacerations, epidermal wounds, and combinations thereof It can be used to show the effect as a pharmaceutical composition for

One aspect of the present invention provides a cosmetic composition comprising the peptide or a salt thereof. The cosmetic composition contains a cosmetically or dermatologically acceptable medium or base. These are all formulations suitable for topical application, for example, solutions, gels, solids, kneaded dry products, emulsions obtained by dispersing an oil phase in an aqueous phase, emulsions obtained by dispersing an aqueous phase in an oil phase, multi-emulsions, suspensions, micro-emulsions, micro-emulsions. It can be used in the form of capsules, microgranulocytes, ionic (liposomes) and non-ionic vesicular dispersants, foams, aerosols or patches further containing compressed propellants. These compositions can be prepared according to conventional methods in the art.

The cosmetic composition may contain other ingredients that can give a synergistic effect to the main effect, preferably within the range that does not impair the main effect, in addition to the above substances, and other ingredients in addition to the active ingredient of the present invention According to the formulation or purpose of use of the composition, a person skilled in the art can appropriately select and mix the composition without difficulty. For example, the cosmetic composition of the present invention may include other ingredients commonly formulated in cosmetic compositions, if necessary, in addition to the active ingredient, and examples thereof include oil and fat ingredients, moisturizing agents, emollients, surfactants, organic and inorganic pigments, organic powder, ultraviolet absorber, preservative, bactericide, antioxidant, stabilizer, thickener, glycerin, pH adjuster, alcohol, colorant, fragrance, blood circulation promoter, cooling agent, limiting agent, purified water, and the like. Other compounding components that may be included in the cosmetic composition are not limited thereto, and the compounding amount of the components is possible within a range that does not impair the purpose and effect of the present invention.

The formulation of the cosmetic composition is not particularly limited and may be appropriately selected according to the purpose. For example, soap formulations, softening lotions, nourishing lotions, essences, nourishing creams, massage creams, packs, gels, makeup bases, foundations, powders, lipsticks, patches, sprays, eye creams, eye essences, cleansing creams, cleansing foams , cleansing water, cleanser, hair shampoo, hair conditioning, hair treatment, hair essence, hair lotion, scalp hair tonic, scalp essence, hair gel, hair spray, hair pack, body lotion, body cream, body oil and body essence. It may be prepared in one or more formulations selected from the group, but is not limited thereto.

The formulation of the food composition according to the present specification is not particularly limited, but may be formulated in, for example, tablets, granules, powders, liquids such as drinks, caramel, gels, bars, and the like. In addition to the active ingredient, the food composition of each dosage form can be appropriately selected by those skilled in the art without difficulty depending on the dosage form or purpose of use in addition to the active ingredient, and a synergistic effect may occur when applied simultaneously with other raw materials.

In the food composition according to the present specification, the determination of the dosage of the active ingredient is within the level of those skilled in the art, and the daily dosage thereof is, for example, 0.1 mg/kg/day to 5000 mg/kg/day, more specifically 50 It may be mg/kg/day to 500 mg/kg/day, but is not limited thereto, and may vary depending on various factors such as age, health status, and complications of the subject to be administered.

The food composition according to the present specification is, for example, various foods such as chewing gum, caramel products, candies, ice creams, and confectionery, beverage products such as soft drinks, mineral water and alcoholic beverages, and health functional foods including vitamins and minerals. can

In addition to the above, the food composition of one aspect of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, colorants and enhancers (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like. In addition, the functional food compositions of the present invention may include natural fruit juice, fruit juice, and pulp for the production of fruit juice beverages and vegetable beverages. These components may be used independently or in combination. The proportion of these additives is not so critical, but is generally included in the range of 0 to about 20 parts by weight per 100 parts by weight of the composition of the present invention.

The terminology used herein is intended for the purpose of describing particular embodiments only and is not intended to limit the present invention. A term with a number omitted before a noun is not intended to limit the quantity, but rather indicates the presence of one or more of the mentioned noun item. The terms “comprising,” “having,” and “containing” are to be construed as open terms (ie, meaning “including but not limited to”).

Recitation of a range of numerical values is merely an easy alternative to recitation of each separate numerical value falling within that range, and each separate numerical value is individually recited in the specification, unless it is explicitly stated otherwise. It is incorporated herein as is. All ranges end values are included within that range and are independently combinable.

All methods mentioned herein can be performed in any suitable order unless otherwise indicated or otherwise clearly contradicted by context. The use of any one and all embodiments or exemplary language (eg, “such as”) is merely to better describe the invention and not to limit the scope of the invention, unless included in the claims. It is not intended to be limiting. No language in the specification should be construed as constituting any non-claimed element as essential to the practice of the invention. Unless otherwise defined, technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs.

Preferred embodiments of the invention include the most optimal mode known to the inventor for carrying out the invention. Variations of the preferred embodiments will become apparent to those skilled in the art upon reading the preceding description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors expect the invention to be practiced otherwise than as described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the appended claims as permitted by patent law. Moreover, within all possible variations any combination of the above-mentioned elements is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context. While the present invention has been particularly shown and described with reference to exemplary embodiments, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention as defined by the following claims.

Modes for carrying out the invention

Hereinafter, the configuration and effect of the present invention will be described in more detail with reference to Examples and Experimental Examples. However, the following examples and experimental examples are provided only for the purpose of illustration to help the understanding of the present invention, and the scope and scope of the present invention are not limited thereto.

Example 1: Synthesis of novel peptides

A novel peptide of SEQ ID NO: 1 was prepared according to a conventionally known solid-phase peptide synthesis method. Specifically, peptides were synthesized by coupling amino acids one by one from the C-terminus through Fmoc solid phase peptide synthesis (SPPS) using ASP48S (Peptron, Inc., Daejeon, Korea). As follows, the first amino acid at the C-terminus of the peptides attached to the resin was used. For example:

NH ₂ -Lys(Boc)-2-chloro-Trityl Resin

NH ₂ -Ala-2-chloro-Trityl Resin

NH ₂ -Arg(Pbf)-2-chloro-Trityl Resin

Trt, Boc, t-Bu (t-butylester), Pbf (2,2,4,6, Pbf (2,2,4,6, 7-pentamethyl dihydro-benzofuran-5-sulfonyl) and the like were used. For example:

Fmoc-Ala-OH, Fmoc-Arg(Pbf)-OH, Fmoc-Glu(OtBu)-OH, Fmoc-Pro-OH, Fmoc-Leu-OH, Fmoc-Ile-OH, Fmoc-Phe-OH, Fmoc- Ser(tBu)-OH, Fmoc-Thr(tBu)-OH, Fmoc-Lys(Boc)-OH, Fmoc-Gln(Trt)-OH, Fmoc-Trp(Boc)-OH, Fmoc-Met-OH, Fmoc -Asn(Trt)-OH, Fmoc-Tyr(tBu)-OH, Fmoc-Ahx-OH, Fmoc-Gln-OH, Trt-Mercaptoacetic acid.

As a coupling reagent, HBTU[2-(1H-Benzotriazole-1-yl)-1,1,3,3-tetamethylaminium hexafluorophosphate] / HOBt [N-Hydroxxybenzotriazole] /NMM [4-Methylmorpholine] is used did. For Fmoc removal, piperidine in DMF was used in 20% DMF. Cleavage Cocktail [TFA (trifluoroacetic acid) /TIS (triisopropylsilane) / EDT (ethanedithiol) / H ₂ O=92.5/2.5/2.5/2.5] is used to separate the synthesized peptide from the resin and remove the protecting group of the residue did.

Each peptide was synthesized by repeating the process of reacting the respective amino acids with the starting amino acid to which the amino acid protecting group is bound to the solid support, washing with a solvent, and then deprotecting. After the synthesized peptide was cut off from the resin, it was purified by HPLC, and the success of the synthesis was confirmed by LC/MS and freeze-dried.

As a result of high performance liquid chromatography on the peptides used in this example, the purity of all peptides was 95% or higher.

ALTSKLRA (SEQ ID NO: 2) was prepared as a positive control peptide in the same manner as above.

Example 2: Anti-inflammatory activity of novel peptides

In order to verify the anti-inflammatory activity of the novel peptide, the expression level of TNF-α, known as a cytokine that exhibits inflammatory activity, in a cell line induced with inflammation with LPS (Lipopolysaccharide) was measured using RT-qPCR and ELISA method to determine the new peptide, SEQ ID NO. 1 (ALTSKLRG) and positive control peptide, SEQ ID NO: 2 (ALTSKLRA), respectively.

Preparation of experimental reagents and materials

Experiments were conducted using THP-1 cells (American Type Culture Collection (ATCC), Manassas, VA, USA), a human acute monocytic leukemia cell line. THP-1 was suspended in RPMI 1640 medium to 1 X 10 ⁵ cells per well in a 96-well plate and cultured for 24 hours. At this time, PMA (phorbol 12-myristate 13-acetate, Sigma) was treated for differentiation into macrophages.

Lipopolysaccharide (LPS, Sigma) was dissolved in PBS (Phosphate buffered saline), and PMA was dissolved in DMSO (Dimethyl sulfoxide).

The peptide was synthesized and used in Peptron (Daejeon, Korea) according to the synthesis method in Example 1.

Experimental method

The RT-qPCR test method was as follows. THP-1 cells were plated in a 6-well plate at 2 x 10 ⁶ /well, and then treated with PMA at a concentration of 100 ng/ml for 24 hours to differentiate them into Macrophage. After removing the media and washing the differentiated THP-1 cells with SFM (serum-free media) twice, the new peptide SEQ ID NO: 1 (ALTSKLRG) and positive for each concentration of 10 ng/ml LPS and 1, 5, and 10 μM The control peptide, SEQ ID NO: 2 (ALTSKLRA), was treated and cultured for 6 hours. RNA was extracted using RNeasy® Plus Mini Kit (Qiagen), and after quantifying the extracted RNA, cDNA synthesis was performed using the Reverse Transcription system (Promega). RT-qPCR was performed using CFX96-Real-Time System (Bio-rad) to analyze mRNA expression of TNF-α, and GAPDH was used as a reference gene. PCR conditions were 40 cycles (95 at 15 sec, 55 at 30 sec, 72 at 30 sec) and the sequences of the primers used are shown in Table 3 below.

Gene Forward Sequence (5′-3′) Reverse sequence (5′-3′) TNF-α CTATCTGGGAGGGGTCTTCC (SEQ ID NO: 3) ATGTTCGTCCTGCTCACAG (SEQ ID NO: 4) GAPDH AGGCTGCTTTTAACTCTGGT (SEQ ID NO: 5) CCCCACTTGATTTTGGAGGGA (SEQ ID NO: 6)

The ELISA test method was as follows. THP-1, a monocyte cell line distributed from ATCC, is subcultured to prepare for the P3 stage, and the cell line is dispensed on a well-plate and treated with PMA to differentiate into macrophages. Differentiated cells were treated with LPS to induce an inflammatory response (inducing TNF-alpha production), and a novel peptide SEQ ID NO: 1 (ALTSKLRG) and a positive control peptide, SEQ ID NO: 2 (ALTSKLRA), were added to the cells by concentration ( 0.05, 0.5, 5 μM), and the amount of TNF-α was measured by ELISA. The relative values for the non-inflammatory group and the complete inflammation group were calculated, and an untreated cell line that was not treated with the novel peptide was set as an estrogen (E2) positive control and a general control group and compared. E2 is known as a steroid that inhibits the production of TNF-α in THP-1.

Statistical processing

All data were expressed as mean ± standard error (mean ± S.E.M.), and statistical processing was performed by ANOVA test. SigmaStat statistical program was used and statistical analysis was performed using Kruskal-Wallis test and Mann-Whitney U-test. In addition, the comparison between each group was determined to be statistically significant when the p-value was less than 0.05 by performing a post-hoc test (Tukey test).

Experimental results and analysis

The results measured through the above experimental method are as follows.

Through RT-qPCR, compared to the LPS-induced inflammatory response in THP-1 cells, As a result of comparing the mRNA inhibition rate of TNF-α, which exhibits anti-inflammatory activity, the novel peptide SEQ ID NO: 1 (ALTSKLRG) showed an excellent TNF-α gene expression inhibitory effect at all concentrations, and among them, the positive control peptide at 1uM and 5uM SEQ ID NO: 2 (ALTSKLRA) showed an excellent effect, and in particular, at the lowest concentration of 1 uM, the anti-inflammatory activity was significantly superior to that of SEQ ID NO: 2 (ALTSKLRA), which is a positive control peptide (see FIG. 1 ).

As a result of confirming the anti-inflammatory activity of the novel peptides by the ability to inhibit TNF-α production in THP-1 cells through ELISA, the peptide of SEQ ID NO: 1 exhibited an inhibitory effect on TNF-α production at all concentrations. In particular, it exhibited an excellent effect compared to the positive control E2 and SEQ ID NO: 2 (ALTSKLRA) (see FIG. 2).

Through the two experimental results, it can be seen that the novel peptide according to the present invention exhibits anti-inflammatory activity shown by the inhibition of TNF-α. The experiment on the inhibition of TNF-α is known as the most basic experiment to prove the overall anti-inflammatory effect, and through this, it can be seen that the novel peptide of the present invention can have an overall anti-inflammatory effect.

Example 3: Antifibrotic activity of novel peptides

In order to confirm the inhibitory effect of TGF-β, which is considered to be the main cause of fibrosis, an experiment to confirm the inhibitory effect of TGF-β signaling in the HepG2 cell line was performed as follows.

Preparation of experimental reagents and materials

The reagents and materials used for this experiment are as follows. The new peptides in powder state were dissolved in distilled water filtered through a 0.2 μm filter (0.2 μm filtered sterile water), aliquoted at -70° C., and stored, and used after being dissolved. HepG2 (ATCC HB-8065; American Type Culture Collection) was used as the cell line, and recombinant human TGF-β was dissolved in 4 mM HCl to prepare a 10 μg/mL stock. SEQ ID NO: 1 (ALTSKLRG) as a novel peptide as an experimental group and SEQ ID NO: 2 (ALTSKLRA) as a positive control peptide were prepared according to Example 1 above. In addition, SB431542 (Sigma) used as a positive control was prepared as a 10 mM stock and used.

Cell line preparation

After seeding (seeding) of 2x10 ⁶ HepG2 cells (ATCC HB-8065;) in a 60mm Petri-dish (petri-dish), incubated in a CO ₂ incubator for 16 hours. Thereafter, the medium is exchanged with SFM (serum-free medium) and incubated for an additional 24 hours. Thereafter, the medium was exchanged with TGF-β1 at a concentration of 10 ng/ml, and the peptides were further treated with each concentration (1, 10 μM) and incubated for 72 hours. Each peptide treatment group is further incubated in a CO ₂ incubator at 37° C. for 1 hour.

Experimental method

In order to measure the antifibrotic activity of the novel peptide, Western blotting was used to measure the degree of inhibition of TGF-β signaling, and the specific experimental method is as follows.

After washing the peptide-treated cells twice with PBS, collect them in a 1.5 mL EP tube with a cell scraper, remove the supernatant with a centrifuge (1,000rpm, 4℃, 2 minutes), and then transfer to RIPA-treated HepG2 cells Add 100 μL at a time. After incubation on ice for 40 minutes, shake every 10 minutes (cool the vortex, micro-centrifuge at 4°C in advance) and mix the sample 40-50 times using a 1ml syringe. Finally, centrifuge at 13,000 rpm for 15 minutes to use the supernatant.

30 ug of protein was transferred to PVDF membranes (polyvinylidene difluoride membranes, Millipore) by performing 8% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). The PVDF membrane is blocked with 5% skim milk and incubated with specific primary antibodies. The antibodies used in this experiment are as follows. Smad 2/3 (60, 52 kDa, 5% BSA 1:1000, #3102, Cell signaling), pSmad2/3 (cell signaling #3102), GAPDH (37 kDa, 5% BSA 1:1000, #2118, Cell signaling). Then, the PVDF membrane was washed with TBST (Tris-buffered saline containing 0.1% Tween-20), and then reacted with HRP-conjugated anti-rabbit antibody (Jackson Immuno Research Laboratories, INC.). Then, ECL detection (detection, Amersham Pharmacia Biotech) was performed, and the obtained image was analyzed with an image analyzer (GE Healthcare, ImageQuant LAS 4000).

To measure TGF-β inhibitory ability, pSmad2/3 Smad2/3 was used as TGF-β signaling activity markers, and GAPDH was used as a reference group during electrophoresis. As the TGF-β signaling activity markers, those that were expressed at higher concentrations as TGF-β was inhibited were used.

Statistical processing

All data were expressed as mean ± standard error (mean ± S.E.M.), and statistical processing was performed by ANOVA test. SigmaStat statistical program was used and statistical analysis was performed using Kruskal-Wallis test and Mann-Whitney U-test. In addition, the comparison between each group was determined to be statistically significant when the p-value was less than 0.05 by performing a post-hoc test (Tukey test).

Experimental results and analysis

The results measured through the above experimental method are as follows.

As a result of measuring the degree of inhibition of TGF-β of the novel peptide through the western blotting method, the expression of markers that appear higher as TGF-β is inhibited was higher than that of the untreated group treated only with fibrosis-inducing TGF-β. appeared (see FIG. 3). This can be said to be a result indicating that TGF-β was inhibited by treatment with the novel peptide. In addition, the expression level of pSmad2/3 was significantly higher than that of the positive control, SB431542, and the positive control peptide, SEQ ID NO: 2 (ALTSKLRA). Through this, it was found that the peptide of SEQ ID NO: 1 showed higher TGF-β inhibitory activity.

From the above experimental results, it can be seen that the novel peptide according to the present invention exhibits anti-fibrotic activity shown by the inhibition of TGF-β. Experiments on the inhibition of TGF-β are known to be widely used experiments among anti-fibrotic activity experiments, and it can be seen that the novel peptides of the present invention can have anti-fibrotic activity effects.

Example 4: Wound healing activity of novel peptides

In order to confirm the wound healing efficacy of the novel peptide, an experiment was conducted to confirm the collagen production efficacy required for the wound size reduction and healing process after the new peptides were treated in the wound induction animal model.

Experimental animal preparation

In the case of mice, SD rats (Sprague-Dawley Rat) were selected because the skin was thin and it was difficult to make a constant wound. In order to exclude the effects of hormonal changes, males were selected, and after wearing 6 weeks of age, the acclimatization period was performed for about 1 week. Since experimental animals are sensitive to their sense of smell and can harm other individuals, each individual was separated from the wounds and bred for observation, one per cage.

Experimental method

In order to form a full-thickness excision in the prepared experimental animal, the following method was followed. In order to induce anesthesia, 10 mg of xylazine-HCl per kg of body weight of the experimental animal and 100 mg of ketamine HCl per kg were mixed and injected intraperitoneally into mice or a respiratory anesthetic was used. After anesthesia is induced, in a prone position, shave the hairs on the back of the experimental animal cleanly, disinfect with betadine, and use a 16 mm punch to place one at a distance of about 1 cm from the highest part of the back to the left and right, respectively. A circular full-thickness wound was made. No separate dressing was applied to the wound site.

Animal models in which full-thickness wounds were induced were divided into groups as follows, and drugs were applied immediately after wound formation and at intervals of two days. As for the application method, the material was made to a concentration of 1 mg/ml and diluted 10-fold to 100 μg/ml immediately before the experiment. For application, 50 μl was instilled per wound.

1) Control: 50 μl of physiological saline per wound instilled

2) Experimental group 1: 0.1 mg/ml of SEQ ID NO: 1 peptide instilled by 50 μl per wound

Observations and photographs were taken immediately after wound formation and on days 2, 4, 7, 9, 11, and 14 after the wound. If the wound was completely healed, the date of healing was recorded. Typically, on the 9th day, individuals began to shrink to the level of 5% of the original wound. After the wound area was photographed with a ruler, the photographed image was analyzed by Image J program (NIH, USA) to calculate the wound area and compared.

Biopsies for collagen formation were performed by sacrificing 2 animals in the control group and 2 mice in the experimental group on the 3rd and 5th days after the wounding, respectively, and collecting wound sites on both sides of the back. In order to compare collagen synthesis, the average fluorescence intensity was obtained after performing Masson trichrome staining.

Experimental results and analysis

When the experimental group was compared with the control group, the wound size was smaller than that of the control group on the 1st day after induction of the full-thickness wound (see FIG. 4). When both the control group and the experimental group were observed until the 11th day, the difference in the size of the wound was not large and healed. can

In addition, as a result of observing collagen formation after wound induction, as a result of measuring the average fluorescence intensity of collagen generation in the control group and the experimental group, it was found that all experimental groups were higher than the control group (see FIG. 5 ). This can be considered to indicate that the novel peptide promotes collagen formation, which is essential when healing of the wound site is made.

Through the above experimental results, it can be seen that the novel peptide according to the present invention exhibits an activity of reducing the wound area and increasing collagen synthesis. Through this, it can be seen that the novel peptide of the present invention can have a wound healing active effect.

Combining the results of the above experimental examples, it can be seen that the novel peptides according to the present invention have anti-inflammatory, anti-fibrotic and wound healing effects, and development of a therapeutic agent for preventing and treating inflammation, fibrosis and wounds using this In addition, it is expected that it will be possible to develop agents for preventing and treating cancer and various diseases accompanied by inflammation and fibrosis, and improving symptoms.

<110> GEMVAX & KAEL CO., LTD. Kim, Sang-Jae <120> Novel Peptides and the Composition Comprising the Same <130> OF17P166PCT <160> 6 <170> KopatentIn 2.0 <210> 1 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Short peptide <400> 1 Ala Leu Thr Ser Lys Leu Arg Gly 1 5 <210> 2 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Positive control peptide <400> 2 Ala Leu Thr Ser Lys Leu Arg Ala 1 5 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNF-a forward primer <400> 3 ctatctggga ggggtcttcc 20 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> TNF-a reverse primer <400> 4 atgttcgtcc tgctcacag 19 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 5 agggctgctt ttaactctgg t 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 6 ccccacttga ttttggaggg a 21

Claims (16)

A pharmaceutical composition for wound treatment or improvement, comprising a peptide consisting of the amino acid sequence represented by SEQ ID NO: 1, or a pharmaceutically acceptable salt thereof. delete delete delete delete delete delete delete delete According to claim 1, wherein the pharmaceutical composition is characterized in that it has a wound healing effect by inducing collagen synthesis, the pharmaceutical composition for wound treatment or improvement. The pharmaceutical composition for treating or improving wounds according to claim 1, wherein the pharmaceutical composition treats or improves a wound selected from the group consisting of epidermal burns, epidermal lacerations, epidermal wounds, and combinations thereof. A food composition for wound improvement, comprising a peptide consisting of an amino acid sequence represented by SEQ ID NO: 1, or a pharmaceutically acceptable salt thereof. delete delete 12. A composition comprising the peptide according to any one of claims 1, 10, and 11, or a pharmaceutically acceptable salt thereof; And a kit for use in wound healing, comprising instructions disclosing one or more of the dosage, route of administration, frequency of administration, and indications of the composition. delete

Images