WO2008077938A1

WO2008077938A1 - Modulators of talin/integrin association and use thereof

Info

Publication number: WO2008077938A1
Application number: PCT/EP2007/064441
Authority: WO
Inventors: Frédéric SALTEL; Bernhard Wehrle-Haller
Original assignee: Universite De Geneve
Priority date: 2006-12-22
Filing date: 2007-12-21
Publication date: 2008-07-03

Abstract

The present invention is related to a method for treating a disorder related to talin/integrin interactions such as cancer, angiogenesis, inflammation and adenoviral uptake. In particular, the invention provides molecules useful in the treatment of these cancer, angiogenesis, inflammation and adenoviral uptake conditions. More particularly, the present invention provides peptides, DNA encoding thereof, processes for production thereof, pharmaceutical compositions, kits containing thereof and use of these in the preparation of pharmaceutical compositions for the treatment of disorders related to talin/integrin interactions such as cancer, angiogenesis, inflammation and adenoviral uptake.

Description

Modulators of Talin/Integrin association and use thereof

Field of the Invention The present invention relates to a method for treating a disorder related to talin/integrin interactions such as cancer, angiogenesis, inflammation, thrombosis and adenoviral uptake. In particular, the invention provides molecules useful in the treatment of these cancer, angiogenesis, inflammation, thrombosis and adenoviral uptake conditions. More particularly, the present invention provides peptides, DNA encoding thereof, processes for production thereof, pharmaceutical compositions, kits containing thereof and use of these in the preparation of pharmaceutical compositions for the treatment of disorders related to talin/integrin interactions such as cancer, angiogenesis, inflammation, thrombosis and adenoviral uptake.

Background of the Invention Integrins are heterodimeric transmembrane receptors consisting of an α and β subunits that are crucial for cell adhesion, migration, control of differentiation during development and for tissue homeostasis in the adult organism. The role of integrins in cell migration has been previously reviewed {Wehrle-Haller, 2006, in Integrins and Development, Ed. Erik Danen, Landes Bioscience, 25-48). Further, integrins are involved in numerous physiological processes such as embryogenesis, angiogenesis, thrombosis, tumor cell metastasis, inflammation and immune response. Each subunit has a large (700-1200 residues) N-terminal extracellular domain. Each subunit further contains a single membrane-spanning domain linking the extracellular domain to a generally short (13-70 residue) cytoplasmic domain Hynes, 2002, Cell 110, 673-87). Integrins link the actin cytoskeleton to the extracellular matrix (ECM) through a connection that responds dynamically to mechanical, chemokine-induced or growth factor-induced signals. In the low affinity state, the ectodo mains of the α and β subunits of integrins are in a folded configuration with laterally associated transmembrane and cytoplasmic domains and this configuration is stabilized by a salt bridge formed between the (X and β-integrin cytoplasmic tails. Deletion of this salt bridge, perturbation of the transmembrane domain association or their removal results in the conversion from the low to the high affinity state. Upon integrin activation, integrins can undergo an allosteric switch (or "integrin activation"), which converts them from a low to a high-affinity state, enabling their reversible association with extracellular ligands. The allosteric switch results from changes in the conformation of the extracellular domain occurring via the opening of the distal parts of both ectodomains in a switch-blade movement followed by the separation of the transmembrane and cytoplasmic domains. This process associated with conformational changes of the extracellular domain can be monitored by electron microscopy, gel filtration chromatography and conformation specific antibodies. The integrin β subunit cytoplasmic domain is known to be essential for talin-induced integrin activation (inside-out activation) (Calderwood, 2004, J. cell ScL, 117: 657-66).

It is known that integrin-cytoskeleton linkages play a crucial role in the signaling activities of integrins on cell growth, survival and differentiation and in the regulatory properties of integrins on cell adhesion. In particular, changes in integrin affinity for ligand (activation) and valency regulations such as differential integrin clustering regulate integrin-mediated cell adhesion processes.

The clustering of integrins requires the cytoplasmic adaptor protein talin which is an actin- binding protein. The clustering results in the formation of integrin-dependent cell-substrate adhesion sites. The Talin protein is composed of approximately 2'500 amino acids and exhibits a (50 kDa) globular head domain and a larger C-terminal rod domain (200 kDa), while the two domains are separated by a calpain proteolytic cleavage site {Tanentzapf et al., 2005, J. of Cell ScL, 119 (8), 1632-1644). The head domain is a FERM (band four.l, ezrin, radixin, merlin) domain subdivided in three sub-domains (Fl, F2 and F3). The N- terminal FERM-domain of talin binds to phosphatidylinositol-4,5-phosphate (PI(4,5)P2) enriched membranes (Martel et al., 2001, Journal of Biological Chemistry 276, 21217-27) and to a conserved W/NPXY motif located in the cytoplasmic domain of β3-integrins (W739-Y747 in β3-integrin) (Garcia-Alvarez, et al., 2003, MoI. Cell. 11, 49-58). When over-expressed, the talin FERM domain increases integrin affinity and induces integrin clustering (Cluzel et al., 2005, J. cell Biol., 171, 383-392).

However, NMR data have demonstrated talin interaction with the W/NPXY motif even when the cytoplasmic domains of the (X and β-integrins are clasped together as in their low- affinity conformation (Ulmer et al, 2003, Biochemistry 42, 8307-8312).

Currently, small, extracellular ligand-based inhibitors for certain integrins such as Cilengitide are used in clinical trials to treat neo-angiogenesis. These inhibitors are thought to act by blocking the binding of the integrins (e.g. β3-integrin) to its extracellular ligand, thus preventing the contact to the extracellular matrix, which is required for migration. As the talin/integrin association has a dual role in signaling and adhesive functions in processes such as cell spreading, migration, survival and proliferation associated with pathologies such as cancer, angiogenesis and thrombosis, it would be more than desirable to develop new methods of treatments that specifically target talin integrin association, in order to prevent pathological conditions associated with β3-integrin-dependent cell spreading, and/or migration in disorders such as cancer, angiogenesis, inflammation, thrombosis and adenoviral uptake.

Summary of the Invention

The present invention is directed towards methods for decreasing or altering talin/integrin interactions and reducing cell spreading, migration and/or adhesion signaling induced by talin/integrin interaction. More particularly, the present invention is directed towards methods of treatment of disorders related to talin/integrin interactions such as disorders associated with cell spreading, migration and/or adhesion signaling such as cancer, angiogenesis, inflammation, thrombosis and adenoviral uptake. In particular, the invention provides molecules useful in the treatment of these cancer, angiogenesis, inflammation, thrombosis and adenoviral uptake conditions. More particularly, the present invention provides peptides, DNA encoding thereof, processes for production thereof, pharmaceutical compositions, kits containing thereof and use of these in the preparation of pharmaceutical compositions for the treatment of disorders associated with cell spreading, migration and/or adhesion signaling such as cancer, angiogenesis, inflammation, thrombosis and adenoviral uptake. In particular, the invention provides molecules useful in the treatment of these cancer, angiogenesis, inflammation, thrombosis and adenoviral uptake conditions.

A first aspect, of the invention provides an isolated polypeptide comprising the following amino acid: Z D/E-X!-K/R-E/D-X₂-X₃- X₄-A-X₅ in which

Z, X i, X₂, X₃, X₄, X₅, X₆, X7 and Xs are defined below, as well as salt and any derivative, analogue or conjugate thereof.

A second aspect of the invention relates to an isolated nucleic acid consisting of a nucleotide sequence encoding a peptide according to the invention. A third aspect of the invention resides in a peptide according to the invention for use as a medicament.

A fourth aspect of the invention relates to a pharmaceutical composition comprising peptide according to the invention and a physiologically acceptable carrier, diluent or excipient. A fifth aspect of the invention relates to a method for inhibiting or altering the interaction of integrin and talin.

A sixth aspect of the invention is a method for treating a disease or condition associated with integrin dependant cell spreading and/or migration such as cancer, angiogenesis, inflammation and adenoviral uptake. A seventh aspect of the invention relates to a use of a peptide according to the invention for the manufacture of a medicament for the treatment of a disease or condition associated with integrin dependant spreading and migration such as cancer, angiogenesis, inflammation, thrombosis and adenoviral uptake.

An eighth aspect of the invention is a method for inhibiting angiogenesis in a tissue. A ninth aspect of the invention is an isolated DNA sequence that encodes a peptide according to the invention.

A tenth aspect of the invention relates to a recombinant expression vector comprising a nucleic acid molecule according to the invention. An eleventh aspect of the invention is a host cell transfected or transformed with a recombinant expression vector or a nucleic acid according to the invention. A twelfth aspect is a process for producing cells capable of expressing a peptide according to the invention A thirteenth aspect is a method for screening for an inhibitor of the interaction of integrin and talin and in particular the β-3-integrin-dependant cell spreading and/or migration. Other features and advantages of the invention will be apparent from the following detailed description.

Description of the figures Figure 1 shows the quantification of the clustering of β3-EGFP integrin fluorescence by TIRF microscopy. Mouse B 16Fl melanoma cells were transfected with wildtype, W739A/Y747A or DelW739-T762 mutant β3-EGFP integrin and grown in control medium, stimulated for 20 min with 0.5 mM Mn²⁺, or co-transfected with ECFP-humanTalinl- FERM domain (aal-435) and stimulated with Mn ⁺ for 20 min prior to fixation. The relative distribution of the integrin fluorescence over the entire surface of a cell was represented by averaged intensity histograms (n>20) (A). ECFP-humanTalinl-FERM domain expression was confirmed by epifluorescence. The vertical dashed line (in A) represents an arbitrary fluorescence intensity threshold (>200 12-bit gray levels) that was used to calculate the percentage of the cell surface covered by integrin clusters (defined by exhibiting a fluorescent intensity above 200 12-bit gray levels; hatched area) of different constructs and conditions (B). Data are from one out of several (n>3) experiments.

Figure 2 shows FACS analysis of cell surface expression levels of β3-integrins in mock (B 16Fl), wildtype (WT) and W₇₃₉A/Y₇₄₇A mutant β3-EGFP-integrin transfected B 16Fl melanoma cells, detected with a hamster anti-mouse β3 antibody. Figure 3 shows the averaged β3-EGFP integrin fluorescence histograms (n>20) were obtained from TIRF images of Mn²⁺ stimulated mouse B 16Fl melanoma cells co- expressing wildtype ECFP-humanTalinl-FERM together with different β3-EGFP integrin mutants: β3-T_72θA/l₇₂iA (similar to wildtype), β3-E₇₂eA, β3-E₇₂eK, and β3-E₇₂₆K/E₇₃₃K. An arbitrary fluorescence intensity threshold (>200 12-bit gray levels) was used to calculate the cell surface coverage of integrin clusters of the different mutants. Data are from one out of several (n>3) similar experiments.

Detailed Description of the invention

As used herein, "treatment" and "treating" and the like generally mean obtaining a desired pharmacological and physiological effect. The effect may be prophylactic in terms of preventing or partially preventing a disease, symptom or condition thereof and/or may be therapeutic in terms of a partial or complete cure of a disease, condition, symptom or adverse effect attributed to the disease. The term "treatment" as used herein covers any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; or relieving the disease, i.e., causing regression of the disease and/or its symptoms or conditions. The term "subject" as used herein refers to mammals. For examples, mammals contemplated by the present invention include human, primates, domesticated animals such as cattle, sheep, pigs, horses and the like.

The term "isolated" is used to indicate that the molecule is free of association with other proteins or polypeptides, for example as a purification product of recombinant host cell culture or as a purified extract. The term "inhibitor" is defined as a molecule that inhibits or alter completely or partially the activity of a biological molecule.

The term "inhibitor" comprises all inhibitors of integrin/talin interactions able to inhibit or alter the interaction of integrin and talin by blocking the amino acids from the talin-1 sequence (SEQ ID NO: 22) selected from the following group: Leu3H, Lys3i6, Lys324, Leu325, Prθ327, Glu342, Lys364, Gln38i, Thr382, Thr383 and Glu384. In another aspect, an inhibitor according to the invention is able to inhibit or alter the interaction of integrin and talin by blocking the amino acids from the talin-1 sequence (SEQ ID NO: 22) selected from the following group: LeU₃₁₄, Lys3i6, Lys3is, Asn323, Lys324, Leu325, Prθ327, GIU342, Lys364, Ghi38i, Thr38₂, Thr383, and Glu38₄ In one aspect, the inhibitor according to the invention is able to inhibit or antagonize one or more biological activities of integrin/talin interactions such as β3-integrin -dependent cell spreading, and/or migration.

The term "inhibitor" includes but is not limited to: talin specific antibodies of any sort

(polyclonal, monoclonal, antibody fragments, antibody variants), chimaeric proteins, natural or unnatural proteins with integrin/talin interactions inhibitory activities, small molecules, nucleic acid derived polymers (such as DNA and RNA aptamers, PNAs, or

LNAs), peptidomimetics, fusion proteins, or gene therapy vectors driving the expression of such inhibitors. Examples of the inhibitor according to the invention are the peptides according to the invention described below. An inhibitor, as an isolated, purified or homogeneous protein according to the invention, may be produced by recombinant expression systems as described herein or purified from naturally occurring cells.

Suitable expression of inhibitors according to the invention include prokaryotes, yeast or higher eukaryotic cells. Appropriate cloning and expression vectors for use with bacterial, fungal, yeast and mammalian cellular hosts are described for example in Pouwels et al,

1985, Cloning Vectors: A laboratory manual, Elsevier, New York.

Prokaryotes include gram negative and gram positive organism such as E. CoIi or Bacilli.

Suitable prokaryotic host cells include for example E. CoIi BL21 strain. In prokaryotic host cells, such as E. coli, an inhibitor according to the invention may include a N-terminal methionine residue to facilitate the expression of recombinant polypeptide in the prokaryotic host cell. The N-terminal Met may be cleaved from the expressed peptide.

The term "peptide" is ordinarily applied to a polypeptidic chain containing from 3 to 30 or more contiguous amino acids, usually from 3 to 20 contiguous amino acids. Such peptides can be generated by methods known to those skilled in the art, including partial proteolytic cleavage of a larger protein, chemical synthesis, or genetic engineering.

The term "peptidomimetic" is defined as a peptide analog containing non-peptidic structural elements, which peptide is capable of mimicking or antagonizing the biological action(s) of a natural parent peptide. A peptidomimetic does no longer have classical peptide characteristics such as enzymatically scissile peptide bonds. The term "derivatives" as herein used refers to derivatives which can be prepared from the functional groups present on the lateral chains of the amino acid moieties or on the N-/ or C-terminal groups according to known methods. Such derivatives include for example esters or aliphatic amides of the carboxyl-groups and N-acyl derivatives of free amino groups or O-acyl derivatives of free hydroxyl-groups and are formed with acyl-groups as for example alcanoyl- or aroyl-groups. The term "derivatives" includes also "chiral derivatives".

The term "conjugates" as herein used refers to a peptide wherein the peptide of the invention is linked (e.g. covalently) to a membrane anchor. The linkage between the peptide of the invention and the membrane anchor can be direct or indirect, via a linker moiety. Direct linkage may occur through any convenient functional group on the peptide of the invention such as hydroxy, carboxy, amino group, preferably at one terminus. The direct linkage can be performed, the resulting conjugate being one continuous peptide. Indirect linkage can occur through a linking group. Examples of linking group include multifunctional alkyl, aryl, aralkyl, organic polymers or short peptidic moieties of 1 to 4 residues such as a Glycine or a Lysine residue placed just before the N-terminal Aspartic acid of the peptide according to the invention.

C₁-C₁₈ -alkyl" refers to monovalent branched or unbranched alkyl groups having 1 to 18 carbon atoms. This term is exemplified by groups such as methyl, ethyl, n-propyl, myristyl (CI-CH), palmitoyl (Ci-Ci₆) and stearyl (Ci-Ci₈) and the like.

"C₂-C is Acyl" refers to a group -C(O)R where R includes "Ci-Cis-alkyl" groups. This term is exemplified by groups such as formyl, acetyl, propionoyl and butyroyl and the like. The term "charged amino acids" refers to basic amino acids or acidic amino acids. The term "basic amino acids" refers to amino acids positively charged. Examples of basic amino acids are Lysine (Lys) and Arginine (Arg) and derivatives thereof.

The term "acidic amino acids" refers to amino acids negatively charged. Examples of acidic amino acids are Glutamic acid (GIu) Aspartic Acid (Asp) or and derivatives thereof. The term "analogues" refers to polypeptides with a sequence having at least one conservatively substituted amino acid, meaning that a given amino acid residue is replaced by a residue having similar physiochemical characteristics. Generally, substitutions for one or more amino acids present in the native polypeptide should be made conservatively. Examples of conservative substitutions include substitution of amino acids outside of the active domain(s), and substitution of amino acids that do not alter the secondary and/or tertiary structure. Examples of conservative substitutions include substitution of one aliphatic residue for another, such as He, VaI, Leu, or Ala for one another, or substitutions of one polar residue for another, such as between Lys and Arg; GIu and Asp; or GIn and Asn. Other such conservative substitutions, for example, substitutions of entire regions having similar hydrophobicity characteristics, are well known (Kyte, et al, 1982, J. MoI. Biol, 157: 105- 131). For example, a "conservative amino acid substitution" may involve a substitution of a native amino acid residue with a non native residue such that there is little or no effect on the polarity or charge of the amino acid residue at that position. Desired amino acid substitutions (whether conservative or non-conservative) can be determined by those skilled in the art at the time such substitutions are desired. Exemplary amino acid substitutions are presented in Table 1 below:

Table 1

The following three letter code or one letter code are employed for the following amino acids:

Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic Acid (Asp D), Glutamine (GIn, Q), Glutamic acid (GIu, E), Glycine (GIy, G), Isoleucine (He, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Theonine (Thr, T) and Valine (VaI, V).

Integrin

Integrin includes Integrin β-1 ,-2,-3,-5,-6 to -7 integrin cytoplasmic tail. These sequences have been disclosed in Calderwood, 2004, J. of Cell Science, 117, 657-666.

Talin

Talin F2 and F3 sequences have been disclosed in Garcia-Alvarez, 2003 above and comparison of complete Talin-1 (SEQ ID NO: 22) and Talin-2 sequences in Monkley et ah, 2001, Biochem. Biophys. Res. Commun, 286, 880-885.

Integrin/talin interaction inhibitors The integrin/talin interaction inhibitors according to the invention are able to inhibit or alter the interaction of integrin and talin by blocking the amino acids from the human talin-1 sequence (SEQ ID NO: 22) (accession number NP 006280 2541 aa) selected from the following group: Leu3H, Lys3i6, Lys324, Leu325, Prθ327, GIU342, Lys364, Ghi38i, Thr₃₈2, Thr₃₈₃

In another aspect, integrin/talin interaction inhibitors according to the invention are able to inhibit or alter the interaction of integrin and talin-1 by blocking the amino acids from the talin sequence (SEQ ID NO: 22) selected from the following group: LeU₃₁₄, Lys3i6, Lys3is, Asn₃₂3, Lys₃24, Leu₃25, Pro₃27, GIU342, Lys₃64, GIn₃₈I, Thr₃₈₂, Thr₃₈₃, and Glu₃₈4 In another aspect of the invention, the integrin/talin interaction inhibitors inhibit or alter the β3 -integrin dependant cell spreading and/or migration.

In another aspect of the invention, the integrin/talin interaction inhibitors according to the invention are selected from the group consisting of a small molecule and a peptide. In one embodiment, the invention integrin/talin interaction inhibitor according to the invention is an isolated polypeptide comprising the following amino acid:

Z D/E-Xi-K/R-E/D-Xj-Xs- X₄-A-X₅ in which

Z is an optional membrane anchor; Xi is an amino acid selected from the group consisting of Lys, Arg, GIn, Asn, VaI, Leu, Ser, Ala and Thr;

X₂ and X3 are amino acids independently selected from the group consisting of Ala, Ser, Thr and VaI;

X4 is selected from Lys, Arg, Leu, He and VaI; X₅ is an optional peptidic moiety selected from the group consisting of (-X₆), (-X₆-X₇) and (-X₆-X₇-Xs) in which X₆ is an amino acid selected from the group consisting of Asn, GIn, GIu and Ala; X₇ is an amino acid selected from the group consisting of Arg, Lys, GIn, GIu and Asn and Xs is an amino acid selected from the group consisting of GIu and Asp; as well as salt and any derivative, analogue or conjugate thereof.

Conjugates

In order to increase the efficiency of the peptides according to invention, the peptides of the invention may be conjugated to a membrane anchor. In a preferred aspect of the invention, the peptide anchor has an affinity to lipid raft structures and/or is able to increase the inhibitory activity of the peptide according to the invention towards the membrane bound talin. The membrane anchor according to the invention are either directly linked to the N- terminus of the Aspartic acid of the peptide according to the invention or via a linker wherein the linker is selected from a Glycine or a Lysine residue placed just before the N- terminal Aspartic acid of the peptide according to the invention. Examples of membrane anchor are peptide carriers such as poly-Arg, Drosophila Antennapedia homeodomain, penetratin which is a 16-mer peptide (pAntp) derived from the third helix domain of Antennapedia homeoprotein (amino acids from 43 to 58) and its derivatives known as a cell translocation sequence (Derossi et al. 1994, J. Biol. Chem., 269, 10444-10450; Rousselle et al, 2000, MoL Pharmacol. 57, 679-686). Examples of peptide carriers and membrane translocation vectors useful to shuttle hydrophilic molecules are given in US 2004/000992, WO 00/29427, WO 01/09170, WO 00/63246, WO 98/3886 and WO 02/062989 which are incorporated herein by reference in their entirety. Other examples of membrane anchors are selected from C₂-C₆ acyl groups, preferably acetyl; C₁-C₁₈ -alkyl groups such as preferably C_I-C_H -alkyl groups or Ci-Ci₆ -alkyl groups and lipidic moieties such as phosphatidic acids, phosphatidylinositol, cholesterol and fatty acids such as ceramide.

The invention provides pharmaceutical or therapeutic agents as compositions and methods for treating a patient, preferably a mammalian patient, and most preferably a human patient who is suffering from a medical disorder, and in particular a disorder mediated by talin/integrin association such as β3-integrin-dependent cell spreading and/or migration such as for treating disorders such as cancer, angiogenesis, inflammation and adenoviral uptake.

Pharmaceutical compositions of the invention can contain one or more inhibitor according to the invention such as peptides according to the invention (including from recombinant and non-recombinant sources) in any form described herein. Compositions of this invention may further comprise one or more pharmaceutically acceptable additional ingredient(s) such as alum, stabilizers, antimicrobial agents, buffers, coloring agents, flavoring agents, adjuvants, and the like. The inhibitors of the invention, together with a conventionally employed adjuvant, carrier, diluent or excipient may be placed into the form of pharmaceutical compositions and unit dosages thereof, and in such form may be employed as solids, such as tablets or filled capsules, or liquids such as solutions, suspensions, emulsions, elixirs, or capsules filled with the same, all for oral use, or in the form of sterile injectable solutions for parenteral (including subcutaneous) use. Such pharmaceutical compositions and unit dosage forms thereof may comprise ingredients in conventional proportions, with or without additional active compounds or principles, and such unit dosage forms may contain any suitable effective amount of the active ingredient commensurate with the intended daily dosage range to be employed. Compositions according to the invention are preferably injectable. Compositions of this invention may also be liquid formulations including, but not limited to, aqueous or oily suspensions, solutions, emulsions, syrups, and elixirs. Liquid forms suitable for oral administration may include a suitable aqueous or non-aqueous vehicle with buffers, suspending and dispensing agents, colorants, flavors and the like. The compositions may also be formulated as a dry product for reconstitution with water or other suitable vehicle before use. Such liquid preparations may contain additives including, but not limited to, suspending agents, emulsifying agents, non-aqueous vehicles and preservatives. Suspending agent include, but are not limited to, sorbitol syrup, methyl cellulose, glucose/sugar syrup, gelatin, hydroxyethylcellulose, carboxymethyl cellulose, aluminum stearate gel, and hydrogenated edible fats. Emulsifying agents include, but are not limited to, lecithin, sorbitan monooleate, and acacia. Nonaqueous vehicles include, but are not limited to, edible oils, almond oil, fractionated coconut oil, oily esters, propylene glycol, and ethyl alcohol. Preservatives include, but are not limited to, methyl or propyl p- hydroxybenzoate and sorbic acid. Further materials as well as processing techniques and the like are set out in Part 5 of Remington 's Pharmaceutical Sciences, 20 Edition, 2000, Marck Publishing Company, Easton, Pennsylvania, which is incorporated herein by reference.

Solid compositions of this invention may be in the form of tablets or lozenges formulated in a conventional manner. For example, tablets and capsules for oral administration may contain conventional excipients including, but not limited to, binding agents, fillers, lubricants, disintegrants and wetting agents. Binding agents include, but are not limited to, syrup, accacia, gelatin, sorbitol, tragacanth, mucilage of starch and polyvinylpyrrolidone. Fillers include, but are not limited to, lactose, sugar, microcrystalline cellulose, maizestarch, calcium phosphate, and sorbitol. Lubricants include, but are not limited to, magnesium stearate, stearic acid, talc, polyethylene glycol, and silica. Disintegrants include, but are not limited to, potato starch and sodium starch glycollate. Wetting agents include, but are not limited to, sodium lauryl sulfate. Tablets may be coated according to methods well known in the art.

Injectable compositions are typically based upon injectable sterile saline or phosphate- buffered saline or other injectable carriers known in the art. Compositions of this invention may also be formulated as suppositories, which may contain suppository bases including, but not limited to, cocoa butter or glycerides. Compositions of this invention may also be formulated for inhalation, which may be in a form including, but not limited to, a solution, suspension, or emulsion that may be administered as a dry powder or in the form of an aerosol using a propellant, such as dichlorodifiuoromethane or trichlorofiuoromethane. Compositions of this invention may also be formulated transdermal formulations comprising aqueous or non-aqueous vehicles including, but not limited to, creams, ointments, lotions, pastes, medicated plaster, patch, or membrane. Compositions of this invention may also be formulated for parenteral administration including, but not limited to, by injection or continuous infusion. Formulations for injection may be in the form of suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulation agents including, but not limited to, suspending, stabilizing, and dispersing agents. The composition may also be provided in a powder form for reconstitution with a suitable vehicle including, but not limited to, sterile, pyrogen-free water. Compositions of this invention may also be formulated as a depot preparation, which may be administered by implantation or by intramuscular injection. The compositions may be formulated with suitable polymeric or hydrophobic materials (as an emulsion in an acceptable oil, for example), ion exchange resins, or as sparingly soluble derivatives (as a sparingly soluble salt, for example). Compositions of this invention may also be formulated as a liposome preparation. The liposome preparation can comprise liposomes which penetrate the cells of interest or the stratum corneum, and fuse with the cell membrane, resulting in delivery of the contents of the liposome into the cell. Other suitable formulations can employ niosomes. Niosomes are lipid vesicles similar to liposomes, with membranes consisting largely of non-ionic lipids, some forms of which are effective for transporting compounds across the stratum corneum. The compounds of this invention can also be administered in sustained release forms or from sustained release drug delivery systems. A description of representative sustained release materials can also be found in the incorporated materials in Remington 's Pharmaceutical Sciences. Mode of administration

Compositions of this invention may be administered in any manner including, but not limited to, orally, parenterally, sublingually, transdermally, rectally, transmuco sally, topically, via inhalation, via buccal or intranasal administration, or combinations thereof. Parenteral administration includes, but is not limited to, intravenous, intra-arterial, intraperitoneal, subcutaneous, intramuscular, intra-thecal, and intra-articular. The compositions of this invention may also be administered in the form of an implant, which allows slow release of the compositions as well as a slow controlled i.v. infusion. In a preferred embodiment, the inhibitors according to the invention, including the peptides according to the invention are administered intravenously or subcutaneous Iy.

This invention is further illustrated by the following examples that are not intended to limit the scope of the invention in any way.

The dosage administered, as single or multiple doses, to an individual will vary depending upon a variety of factors, including pharmacokinetic properties, patient conditions and characteristics (sex, age, body weight, health, size), extent of symptoms, concurrent treatments, frequency of treatment and the effect desired.

Patients

In an embodiment, patients according to the invention are patients suffering from disorders related to talin integrin association such as β3-integrin-dependent cell spreading and/or migration e.g. disorders such as cancer, angiogenesis, inflammation, thrombosis and adenoviral uptake.

In particular, the inhibitors according to the invention are useful in the inhibition of a critical step in the transmission and potentiation of extracellular signals (e.g. growth factors and chemokines) via integrin receptors which controls cell movements, also referred to as synergy and playing a role in all processes of cell migration.

Under many pathological conditions concerning cell migration, the amount of released chemokines or increased expression of specific versions of integrin receptors is observed In one aspect, the inhibitors according to the invention do not affect the integrin binding to other cytoskeletal integrin adaptors such as myosin-X, kindlerin/mig-2, alpha-actinin and fϊlamin, nor the integrin alpha6beta4 which is linked to intermediate filaments and is critical for the functional integrity of the skin.

Furthermore, the talin functions within the actin cytoskeleton are not perturbed by the inhibitors according to the invention. For these reasons, the inhibitors according to the invention can be used for the treatment of pathological conditions involving excessive cell adhesion and migration, including: (i) the treatment and prevention of thrombosis, (ii) the treatment and prevention of acute or chronic inflammation, (iii) the treatment of invasive cancer, through the prevention of dissemination and (iv) the treatment of tumors via inhibition of tumor induced angiogenesis.

Use according to the invention

The nucleic acids encoding inhibitors to talin integrin association and inhibitors to talin integrin association according to the invention may be used to express recombinant polypeptides for analysis, characterization and therapeutic use. Inhibitors of talin integrin association according to the invention are useful to inhibit or alter the talin integrin association and are useful in the treatment of disorders related to - integrin-dependent cell spreading and/or migration e.g. disorders such as cancer, angiogenesis, inflammation, thrombosis and adenoviral uptake. The disclosed nucleic acid sequences or nucleic acid sequences, or fragments thereof and combinations of fragment thereof may be used as probes or primers.

The disclosed amino acid sequences and combinations thereof may be used in a process for the preparation of inhibitors according to the invention.

Within the context of this invention, the beneficial effect includes but is not limited to an attenuation, reduction, decrease or diminishing of the pathological development after onset of the disease.

One process for producing inhibitors according to the invention comprises culturing a host cell transformed with an expression vector comprising a DNA sequence that encodes a inhibitor according to the invention under conditions sufficient to promote expression of the inhibitor, respectively. An inhibitor according to the invention is then recovered from culture medium or cell extracts, depending upon the expression system employed. As known to the skilled artisan, procedures for purifying a recombinant protein will vary according to such factors as the type of host cells employed and whether or not the recombinant protein is secreted into the culture medium. For example, when expression systems that secrete the recombinant protein are employed, the culture medium first may be concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. Following the concentration step, the concentrate can be applied to a purification matrix such as a gel filtration medium. Alternatively, an anion exchange and/or an affinity resin can be employed. The matrices can be acrylamide, agarose, dextran, cellulose or other types commonly employed in protein purification. Alternatively, a cation exchange step can be employed. Finally, one or more reversed-phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media can be employed to further purify inhibitors according to the invention. Some or all of the foregoing purification steps, in various combinations, are well known and can be employed to provide a substantially homogeneous recombinant protein.

Recombinant peptide produced in bacterial culture can be isolated by initial disruption of the host cells, centrifugation, extraction from cell pellets if an insoluble polypeptide, or from the supernatant fluid if a soluble polypeptide, followed by one or more concentration, salting-out, ion exchange, affinity purification or size exclusion chromatography steps. Microbial cells can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents.

A desired DNA sequence may be chemically synthesized using techniques known per se. DNA fragments also may be produced by restriction endonuclease digestion of a full length cloned DNA sequence, and isolated by electrophoresis on agarose gels. Linkers containing restriction endonuclease cleavage site(s) may be employed to insert the desired DNA fragment into an expression vector, or the fragment may be digested at cleavage sites naturally present therein. The well known polymerase chain reaction procedure also may be employed to amplify a DNA sequence encoding a desired protein fragment. As a further alternative, known mutagenesis techniques may be employed to insert a stop codon at a desired point, e. g. immediately downstream of the codon for the last amino acid of the receptor-binding domain.

Typically, the efficacy of the inhibitors according to the invention may be assayed in various assays such as integrin clustering assays, cell spreading, cell migration assays.

In one embodiment, the invention integrin/talin interaction inhibitor according to the invention is an isolated polypeptide comprising the following amino acid: Z D/E-X!-K/R-E/D-X₂-X₃- X₄-A-X₅ in which

Z is an optional membrane anchor;

Xi is an amino acid selected from the group consisting of Lys, Arg, GIn, Asn, VaI, Leu, Ser, Ala and Thr;

X₂ and X₃ are amino acids independently selected from the group consisting of Ala, Ser,

Thr and VaI;

X4 is selected from Lys, Arg, Leu, He and VaI;

X5 is an optional peptidic moiety selected from the group consisting of (-X₆), (-X₆-X₇) and (-X₆-X₇-Xs) in which X₆ is an amino acid selected from the group consisting of Asn, GIn,

GIu and Ala; X₇ is an amino acid selected from the group consisting of Arg, Lys, GIn, GIu and Asn and Xs is an amino acid selected from the group consisting of GIu and Asp; as well as salt and any derivative, analogue or conjugate thereof.

In a further embodiment, the invention provides an isolated polypeptide according to the invention wherein when X₅ is a peptidic moiety (-X₆-X₇), X₅ optionally further comprises a peptidic moiety (-X9-X10), wherein X9 is an amino acid selected from the group consisting of GIu, Asp, Phe, He and Leu and X₁₀ is an amino acid selected from the group consisting of GIu and Asp.

In another further embodiment, the invention provides an isolated polypeptide according to the invention wherein when X₅ is a peptidic moiety selected from EEFE (SEQ ID NO: 2), EEIE (SEQ ID NO: 3), EELE (SEQ ID NO: 4), EEFD (SEQ ID NO: 5), EEID (SEQ ID NO: 6) and EELD (SEQ ID NO: 7). In another further embodiment, the invention provides an isolated polypeptide according to the invention wherein when X5 is EEFE (SEQ ID NO: 2).

In another further embodiment, the invention provides an isolated polypeptide according to the invention wherein Xi to X4 and optionally X5 to Xs are selected such as the propensity to form an alpha-helix of the peptide according is not perturbed such as for example predicted by to Chou-Fasman algorithm.

In another further embodiment, the invention provides an isolated polypeptide according to the invention selected from the following group:D-R-K-E-A-A-K-A-E-E-E (SEQ ID NO: 8); D-R-K-E-A-A-K-A-E-K-E (SEQ ID NO: 9); D-R-K-E-A-A-K-A-Q-E-E (SEQ ID NO: 10); D-R-K-E-A-A-K-A-Q-K-E (SEQ ID NO: 11); D-A-K-E-A-A-K-A-E-E-E (SEQ ID NO: 12); D-A-K-E-A-A-K-A-E-K-E (SEQ ID NO: 13); D-A-K-E-A-A-K-A-Q-E-E (SEQ ID NO: 14); D-A-K-E-A-A-K-A-Q-K-E (SEQ ID NO: 15); D-R-K-E-A-A-L-A-E-E-E (SEQ ID NO: 16); D-R-K-E-A-A-L-A-E-K-E (SEQ ID NO: 17); D-A-K-E-A-A-L-A-Q-E- E (SEQ ID NO: 18); and D-A-K-E-A-A-L-A-Q-K-E (SEQ ID NO: 19).

In another further embodiment, the invention provides an isolated polypeptide according to the invention selected from the following group: D-R-K-E-V-A-L-A-E (SEQ ID NO: 20) and D-R-K-E-V-A-L-A-E-E-F-E (SEQ ID NO: 21).

In another further embodiment, the invention provides an isolated polypeptide according to the invention linked to a membrane anchor "Z" at the N-terminus.

In another embodiment, the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a peptide according to the invention.

In another embodiment, the invention provides a peptide according to the invention for use as a medicament.

In another embodiment, the invention provides a pharmaceutical composition comprising peptide according to the invention and a physiologically acceptable carrier, diluent or excipient. In another embodiment, the invention provides a method for inhibiting or altering the interaction of integrin and talin comprising the step of blocking the integral or portions of the interaction surface on talin-1 created by the following amino acids: Leu3_H, Lys₃i6, Lys₃24, Leu₃25, Pro₃27, Glu₃42, Lys₃64, GIn₃₈I, Thr₃₈₂, Thr₃₈₃ and GIu₃₈₄.

In a further embodiment, the invention provides a method for inhibiting or altering the interaction of integrin and talin comprising the step of blocking the integral or portions of the interaction surface on talin-1 created by the following amino acids: Leu_3H, LyS₃I₆, Lys₃i₈, Asn₃₂₃, Lys₃₂4, Leu₃₂s, PrO₃₂₇, Glu₃₄2, Lys₃₆4, GIn₃₈I, Thr₃₈₂, Thr₃₈₃, and GIu₃₈₄

In another further embodiment, this surface is formed by a hydrophobic center, composed of Pro₃₂7. This center residue is surrounded (listed clockwise) by hydrophilic, charged or hydrophobic amino acid in the following sequence: Lys₃24, Leu₃25, Lys₃i6, GIn₃₈I, LyS₃₆₄, Thr₃₈2, Thr₃₈₃, Glu₃₈4, Leu₃i4, and Glu₃42. These amino acids are positioned in such a way, that one side of the surface is formed by essentially basic amino acids (Lys₃₂₄, Lys₃i6, GIn₃₈] and LyS₃₆₄), while the opposite side of the recognition surface is formed by acidic amino acids (GIu₃₈₄ and Glu₃₄₂). The inhibitor will completely or partially cover this surface, inhibiting integrin association to this surface. Typically, an inhibitor according to the invention may be identified by using a method as described in Example 5.

In a further embodiment, the invention provides a method for inhibiting or altering the interaction of integrin and talin wherein the step of blocking includes functionalising, derivitising and capping the integral or portions of the interaction surface on talin-1 created by the following amino acids: Leu₃i₄, Lys₃i6, Lys₃2₄, Leu₃25, Pro₃27, Glu₃₄2, LyS₃₆₄, GIn₃₈I, Thr₃₈₂, Thr₃₈₃ and GIu₃₈₄.

In another further embodiment, the invention provides a method for inhibiting or altering the interaction of integrin and talin wherein the step of blocking includes functionalising, derivitising and capping the integral or portions of the interaction surface on talin-1 created by the following amino acids: Leu₃i₄, Lys₃i₆, Lys₃i₈, Asn₃2₃, Lys₃2₄, Leu₃25, Pro₃27, Glu₃₄2, LyS₃₆₄, GIn_38I, Thr₃₈₂, Thr₃₈₃, and GIu₃₈₄ In a further embodiment, the invention provides a method for inhibiting or altering the interaction of integrin and talin wherein the step of blocking is achieved by an inhibitor selected from the group consisting of a small molecule and a peptide.

In a further embodiment, the invention provides a method for inhibiting or altering the interaction of integrin and talin wherein the step of blocking is achieved by an inhibitor wherein the inhibitor is a peptide according to the invention.

In another embodiment, the invention provides a method for treating a disease or condition associated with integrin dependant spreading and migration such as cancer, angiogenesis, inflammation, thrombosis and adenoviral uptake, comprising the administration of a therapeutically effective amount in a mammal in need thereof of an inhibitor blocking the integral or portions of the interaction surface on talin- 1 created by the following amino acids: LeU₃₁₄, LyS₃I₆, Lys₃24, Leu₃25, PrO₃₂₇, GIU342, Lys₃64, GIn₃Si, Thr₃₈2, Thr₃₈₃ and Glu₃₈4.

In another embodiment, the invention provides a method for treating a disease or condition associated with integrin dependant spreading and migration such as cancer, angiogenesis, inflammation, thrombosis and adenoviral uptake, comprising the administration of a therapeutically effective amount in a mammal in need thereof of an inhibitor blocking the integral or portions of the interaction surface on talin- 1 created by the following amino acids: Leu₃i₄, Lys₃i₆, Lys₃is, Asn₃₂₃, Lys₃₂4, Leu₃₂s, PrO₃₂?, GIu₃₄₂, Lys₃₆4, GIn₃₈I, Thr₃₈2, Thr₃₈₃, and Glu₃₈₄

In another further embodiment, the invention provides a method according to the invention wherein the blocking step includes functionalising, derivatizing and capping the Leu₃i₄ amino acid from the talin- 1 sequence (SEQ ID NO: 22).

In another further embodiment, the invention provides a method according to the invention wherein the blocking step includes functionalising, derivatizing and capping the Lys₃i6 amino acid from the talin- 1 sequence (SEQ ID NO: 22). In another further embodiment, the invention provides a method according to the invention wherein the blocking step includes functionalising, derivatizing and capping the Lys3is amino acid from the talin-1 sequence (SEQ ID NO: 22).

In another further embodiment, the invention provides a method according to the invention wherein the blocking step includes functionalising, derivatizing and capping the Asn323 amino acid from the talin-1 sequence (SEQ ID NO: 22).

In another further embodiment, the invention provides a method according to the invention wherein the blocking step includes functionalising, derivatizing and capping the Lys324 amino acid from the talin-1 sequence (SEQ ID NO: 22).

In another further embodiment, the invention provides a method according to the invention wherein the blocking step includes functionalising, derivatizing and capping the Leu325 amino acid from the talin-1 sequence (SEQ ID NO: 22).

In another further embodiment, the invention provides a method according to the invention wherein the blocking step includes functionalising, derivatizing and capping the Prθ327 amino acid from the talin-1 sequence (SEQ ID NO: 22).

In another further embodiment, the invention provides a method according to the invention wherein the blocking step includes functionalising, and capping the GIU342 amino acid from the talin-1 sequence (SEQ ID NO: 22).

In another further embodiment, the invention provides a method according to the invention wherein the blocking step includes functionalising, derivatizing and capping the Lys364 amino acid from the talin-1 sequence (SEQ ID NO: 22).

In another further embodiment, the invention provides a method according to the invention wherein the blocking step includes functionalising, derivatizing and capping the Gln₃₈i amino acid from the talin-1 sequence (SEQ ID NO: 22). In another further embodiment, the invention provides a method according to the invention wherein the blocking step includes functionalising, derivatizing and capping the Thr382 amino acid from the talin-1 sequence (SEQ ID NO: 22).

In another further embodiment, the invention provides a method according to the invention wherein the blocking step includes functionalising, derivatizing and capping the Thr₃₈₃ amino acid from the talin-1 sequence (SEQ ID NO: 22).

In another further embodiment, the invention provides a method according to the invention wherein the blocking step includes functionalising, derivatizing and capping the Glu₃₈₄ amino acid from the talin-1 sequence (SEQ ID NO: 22).

In another embodiment, the invention provides a method for treating a disease or condition associated with integrin dependant spreading and migration such as cancer, angiogenesis, inflammation, thrombosis and adenoviral uptake, comprising the administration of a therapeutically effective amount of a peptide according to the invention in a mammal in need thereof.

In another embodiment, the invention provides a use of a peptide according to the invention for the manufacture of a medicament for the treatment of a disease or condition associated with integrin dependant spreading and migration such as cancer, angiogenesis, inflammation, thrombosis and adenoviral uptake.

In another embodiment, the invention provides a method for inhibiting angiogenesis in a tissue comprising: (a) providing: (i) a tissue;

(ii) an agent which inhibits specifically interaction of integrin and talin-1 by blocking the amino acids from the talin-1 sequence (SEQ ID NO: 22), selected from the following group: LeU₃H, Lys₃i₆, Lys₃₂4, LeU₃₂₅, PrO₃₂?, GIu₃₄₂, Lys₃₆4, GIn₃₈I, Thr₃₈₂, Thr₃₈₃ and

GIu₃₈₄; (b) Treating said tissue with said agent under conditions such that specific interactions between integrin and talin are inhibited and a treated tissue is produced and angiogenesis in said treated tissue is inhibited.

In another embodiment, the invention provides a method for inhibiting angiogenesis in a tissue according to the invention, wherein the agent inhibits specifically interaction of integrin and talin-1 by blocking the amino acids from the talin- 1 sequence (SEQ ID NO: 22), selected from the following group: LeU₃₁₄, LyS₃I₆, Lys3is, ASn₃₂₃, Lys₃₂4, Leu₃₂s, PrO₃₂₇, Glu342, Lys₃64, GIn₃₈I, Thr₃₈₂, Thr₃₈₃, and Glu₃₈4

In another embodiment, the invention provides a method for inhibiting angiogenesis in a tissue wherein the tissue is selected from an ocular tissue, skin tissue, bone tissue and a synovial tissue.

In another embodiment, the invention provides a method for inhibiting angiogenesis in a tissue wherein the tissue is a tumor, such as a malignant tumor, optionally metastatic.

In another embodiment, the invention provides a method for inhibiting angiogenesis in a tissue wherein the agent is selected from a small molecule, a peptide or an antibody. In a further embodiment, the invention provides a method for inhibiting angiogenesis in a tissue wherein the agent is a peptide according to the invention.

In another embodiment, the invention provides a method of treatment wherein the subject has a pathological condition associated with angiogenesis in the tissue.

In another aspect of the invention, cancer condition or the malignant tumor is selected form lung cancer, breast cancer, prostate cancer, cervical cancer, pancreatic cancer, colon cancer, ovarian cancer; stomach cancer, esophagus cancer, mouth cancer, tongue cancer, gum cancer, skin cancer, muscle cancer, heart cancer, liver cancer, bronchial cancer, cartilage cancer, bone cancer, testis cancer, kidney cancer, endometrium cancer, uterus cancer, bladder cancer, bone marrow cancer, lymphoma cancer, spleen cancer, thymus cancer, thyroid cancer, brain cancer, neuron cancer, mesothelioma, gall bladder cancer, ocular cancer, joint cancer, glioblastoma, lymphoma, leukemia, osteosarcoma, and Kaposi's sarcoma.

In another embodiment, the invention provides an isolated DNA sequence that encodes a peptide according to the invention.

In another embodiment, the invention provides a recombinant expression vector comprising a nucleic acid molecule according to the invention, wherein the vector optionally comprises an expression control sequence, allowing expression in prokaryotic or eukaryotic host cells of the encoded polypeptide, operably linked to the nucleic acid molecule.

In another embodiment, the invention provides a host cell transfected or transformed with a recombinant expression vector or a nucleic acid according to the invention.

In another embodiment, the invention provides a process for producing cells capable of expressing a peptide according to the invention comprising genetically engineering cells with a vector or a nucleic acid according to the invention.

In another embodiment, the invention provides a process for producing a peptide according to the invention comprising culturing a host cell transformed with an expression vector according to the invention under conditions that promotes expression of said peptide and recovering said peptide.

In another embodiment, the invention provides a method of inhibiting or altering the interaction of integrin and talin wherein the step of blocking the selected talin amino acids selected above invention, comprising exposing cells that express talin, to a peptide according to the invention, such that the integrin-dependant cell spreading and migration is altered or inhibited.

In another embodiment, the invention provides a method for screening for an inhibitor of the interaction of integrin and talin and in particular the β-3-integrin-dependant cell spreading and migration comprising the following steps:

(i) Combining cells that express talin, in presence/absence of a compound to be screened; (ii) Determining the ability of the compound to block the amino acids from the talin-1 sequence (SEQ ID NO: 22), selected from the following group: Leu3i4, Lys3i6, Lys324, Leu₃25, Pro₃27, Glu342, Lys₃64, GIn₃₈I, Thr₃₈₂, Thr₃₈₃ and GIu₃₈₄.

In another embodiment, the invention provides a method for screening for an inhibitor of the interaction of integrin and talin and in particular the β-3-integrin-dependant cell spreading and migration, wherein the compound to block the amino acids from the talin-1 sequence (SEQ ID NO: 22), selected from the following group: Leu₃i4, Lys₃i6, Lys₃i₈, Asn₃₂₃, Lys₃₂4, Leu₃₂s, PrO₃₂₇, Glu₃₄2, Lys₃₆4, GIn₃₈I, Thr₃₈₂, Thr₃₈₃, and GIu₃₈₄

References cited herein are hereby incorporated by reference in their entirety. The present invention is not to be limited in scope by the specific embodiments described herein, which are intended as single illustrations of individual aspects of the invention, and functionally equivalent methods and components are within the scope of the invention. Indeed, various modifications of the invention, in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims.

The invention having been described, the following examples are presented by way of illustration, and not limitation.

Examples The following abbreviations refer respectively to the definitions below:

Da (Dalton), Kb (Kilobase), mM (millimolar), min (minute), mW (MilliWatt), nm (nanometer), ECFP (Enhanced Cyan Fluorescent Protein), DMEM (Dulbecco's Modified Eagle Medium), ECFP (Enhanced Cyan Fluorescent Protein), EGFP (Enhanced Green Fluorescent Protein), FACS (fluorescence activated cell sorter), FCS (Fetal Calf Serum), FERM (band four.l , ezrin, radixin, merlin), i.v. (intra-veinous), GFP (Green Fluorescent Protein), PBS (Phosphate Buffered Saline), PFA (paraformaldehyde), s.c. (subcutaneous), RFP (Red Fluorescent Protein), TIRF (total internal reflection fluorescence). Example 1: Role of W/NPXY motif in talin-dependent integrin clustering

In order to investigate the mechanisms of integrin clustering at the cell to substrate interface, we used total internal reflection fluorescence (TIRF) microscopy to quantify the clustering of wildtype or mutant EGFP-tagged β3-integrins. Integrin clustering was analyzed in living cells under three different experimental conditions: (1) normal culture medium; (2) treatment with 0.5 mM Mn ⁺ alone or (3) after co-expression of ECFP-tagged human talin-1 FERM domain (talin-1 residues 1-435 from sequence genebank record see below; Monkely et al, 2001, above; SEQ ID NO: 22). Condition (3) was used to reveal talin-1 FERM domain-dependent integrin clustering, and was characterized by the Mn ⁺ induced formation of extensive integrin clusters that we named "integrin carpets". From acquired TIRF images, the pixel/intensity distribution, averaged from more than 20 cells, was quantified and presented in form of a histogram, reflecting the degree of integrin clustering (Figure IA). In order to determine the fraction of the cell substrate contact area occupied by clustered integrins, we used an arbitrary intensity threshold within these histograms (>200 12-bit gray levels), which allowed comparing different clustering conditions and integrin mutants (Figure IB). In order to make the quantitative analysis meaningful, we assured similar surface expression levels of the transfected GFP-integrins by FACS (Figure 2). The β3-EGFP integrins W/NPXY motif (cytoplasmic tail of mouse β3-Integrin wildtype: SEQ ID NO: 25) and mutated motifs thereof (W739A, Y747A or double W₇₃₉AfY₇₄₇A mutant) were transciently expressed using JetPel, according to the manufacturer's recommandation in B 16Fl melanoma cells (and cultured in DMEM containing 10% FCS, glutamine and antibiotics. Two days after transfection, cells were trypsinized and cell surface expression levels were determined by anti-mouse-β3 -integrin antibody staining (Figure 2).

The integrin-intensity histogram showed an identical pattern when compared to cells transfected with wildtype integrins, resulting in a similar percentage of clustered integrins. After addition of Mn ⁺, a partial rescue of cell spreading as well as an increase in integrin clustering was observed for the different W/NPXY mutants, resulting in a clustering histogram similar to wildtype integrins (Figure IB). ECFP-tagged talin FERM domain was then introduced and integrin clustering after Mn addition was measured. Extensive integrin "carpets" were observed, irrespective of whether the β3-integrin was carrying a wildtype or mutant W/NPXY motif in its cytoplasmic domain (Figure IB). The W/NPXY independent integrin clustering was confirmed by expressing a C-terminal deletion mutant (DelW739-T762) lacking both the proximal and distal NPXY motifs. In this case, as observed with W/NPXY mutants, cell spreading was blocked and cells were unable to form peripheral focal adhesions under control conditions or in the presence OfMn²⁺. However, in cells co-expressing the talin FERM domain, this truncated integrin formed clusters and integrin carpets comparable to wildtype after stimulation with Mn ⁺ (Figure IB). These data suggest that the W/NPXY motif is not required for talin-dependent integrin clustering, but instead is crucial for adhesion signaling and cell spreading. In transiently trans fected CS-I hamster melanoma cells which do not express endogenous β3-integrins, we observed similar results to those obtained in B 16Fl cells: clustering of wildtype and W/NPXY mutant β3-EGFP-integrins in the presence Of Mn²⁺ and transfected talin FERM domain. It was observed that the talin FERM domain was able to increase integrin clustering despite the disruption of the W/NPXY motif or C-terminal deletion of the cytoplasmic tail of β3 integrin (DelW739-T₇62).

The Mn²⁺ induced W/NPXY-independent integrin clustering suggested that the W/NPXY motif is required for integrin activation but not its clustering. The Mouse B 16Fl melanoma cells and hamster CS-I melanoma cells were grown in DMEM containing 10% FCS, glutamine, and antibiotics (Ballestrem, et ah, 2001, above). Cells were transfected using Jet-Pel (Polyplus-Transfection, San Marcos, CA).

Example 2: Clustering of β 3 -integrin mutants

Site directed mutagenesis in the membrane proximal region of β3-EGFP-integrin was performed as follows:

The constructs encoding full-length mouse β3-EGFP-integrin and β3-mRFP-integrin in pcDNA3 have been described (Ballestrem et al, 2001, J Cell Biol, 155, 1319-32; Cluzel et ah, 2005, above). The β3-EGFP-integrin mutations were introduced by primer overlap extension using PfuTurbo DNA polymerase and were cloned into pcDNA3. The NH₂- terminal fragment of human talin-1 (residues 1—435) from SEQ ID NO: 22 (Monkley et ah, 2001, above) was amplified with PfuTurbo DNA polymerase from IMAGE clone 3844238 (obtained from GenBank/EMBL/DDBJ under accession no. BE732988: and cloned into the Xhol and EcoRI sites of pECFP-Cl (ECFP-humanTalinl -FERM) (CLONTECH Laboratories, Inc.) using the primers GATCTCGAGCCATGGTTGCACTTTCACTG (SEQ ID NO: 23) and TATGAATTCTATTGCTGCTGCAGGACTG (SEQ ID NO: 24). DNA sequence analysis was performed for all constructs to ensure error-free amplification and correct base replacement. The mutants were tested for cell surface expression by FACS and subjected to the three different integrin clustering assays (control culture condition, in the presence of Mn2+, and both in the presence of Mn2+ and co-expressed CFP-talin FERM domain) The mutants were characterized by their inability to form integrin clusters under control conditions as well as after Mn ⁺ treatment. Furthermore, the transfection of the talin FERM domain did not lead to increased clustering of these mutant integrins resulting in progressively reduced clustering 27, 23 and 17% in the E₇₂₆A, E₇₂₆K and E₇₂₆KyE₇₃₃K mutants, respectively (Figure 3), in comparison the clustering obtained by a mutant (T₇₂oA/I₇₂iA) which behaves as wildtype is 49%. Interestingly, the clustering defect in these mutants, such as the E₇₂₆K mutation, increased in severity by mutations at aspartic acid 723 (e.g. D₇₂₃KZE₇₂₆K). This mutation exhibited a phenotype identical to the E₇₂₆KZE₇₃₃K mutation, suggesting a role for aspartic acid 723 in talin-dependent integrin clustering.

In order to test whether these clustering incompetent integrins were still able to bind ligand, we performed soluble ligand binding studies in CS-I cells transiently expressing wildtype or mutant integrins.

Example 3: Integrin Clustering mediated by talin FERM domain mutants ECFP-tagged wildtype and mutant talin FERM domain constructs (described below) were co-expressed with wildtype β3-EGFP-integrin in B 16Fl cells and integrin clustering was analyzed after incubation with Mn for 20 minutes.

The talin-1 FERM domain mutations were created using primer overlap extension using PfuTurbo DNA polymerase. An EGFP variant of the ECFP-humanTalinl -FERM construct was generated by the exchange of the ECFP with EGFP (EGFP-humanTalinl -FERM). The talin/integrin fusion constructs (β3-integrin-EGFP-humanTalinl -FERM) were produced by the in-frame replacement of the C-terminal EGFP sequence of the β3-EGFP-integrin construct with the EGFP-humanTalinl -FERM fragment. Wildtype and mutant β3-EGFP- integrin and/or ECFP-humanTalinl-FERM domain expressing B 16Fl cells were obtained by transfection with JetPel (Polyplus-Transfection) according to the manufacturers recommendation. After 6 hours cells were detached, re -plated and cultured in complete medium in glass bottom dishes. At 48 hrs, cells were fixed for 10 min with 4% PFA, and rinsed with PBS. Mn²⁺ activation (0.5 mM Mn²⁺) of B16F1 was performed for 20 min in complete medium. Total internal reflection fluorescence (TIRF) microscopy was performed on a Zeiss Axiovert IOOM (Carl Zeiss AG, Feldbach, Switzerland) equipped with a combined epi-fluorescence/TIRF adapter (TILLphotonics, Grafelfϊng, Germany) and a high numerical aperture objective (10Ox NA 1.45; Carl Zeiss AG, Feldbach, Switzerland). EGFP-fusion proteins were excited with the 488 nm line of a 150 mW argon-ion laser (Reliant 150m, Laserphysics) and mRFP was excited with the 535 nm line of a 20 mW diode laser (Compass 215M-20; Coherent AG, Lubeck, Germany). The Openlab software (Improvision, Basel, Switzerland) controled image capture by a 12-bit CCD camera (Orca 9742-95; Hamamatsu, Japan) as well as the operation of the laser shutters and microscope. For publication, background and contrast were adjusted using adjust level command in Photoshop (Adobe). Intensity histograms of cells were obtained from 12-bit images after smoothing, background subtraction, and manual selection of the cell surface using MetaMorph software (Molecular Devices) and exported to Excel (Microsoft) for further analysis. Histograms were normalized in respect to the cell surface area and averaged (n > 20). The relative surface occupied by clustered integrins in (%) was obtained from intensity histograms by determining the sum of the pixels brighter than the arbitrary fluorescence intensity threshold of 200 (12-bit) gray levels.

In comparison to wildtype talin-1 (72%) and R358A mutation (59%) and the double mutation (K₃₁₈A/K₃₂₀A) (58%), a partial deletion of the basic loop according to the sequence of radixin and ezrin (DelK322-L32s) or double lysine to alanine mutation at residues K322 and K324 (K322A/K324A) reduced integrin clustering to 28 and 33%, respectively. Interestingly, alanine substitutions at lysine 316 and leucine 325, which are positioned at the base of the basic loop were the only "single-mutants" which prevented the formation of integrin carpets. This suggests a functional redundancy between lysines 322 and 324, and points to lysine 316 as a residue critical for integrin clustering.

Example 4: New Talin binding interface

While the combination of wildtype constructs with the (K_3I6E) mutant talin FERM domain or the E₇₂₆K mutant β3-integrin construct prevented the formation of integrin carpets, the co-expression of both mutants PS-E₇₂₆KZTaI-K_3I6E resulted in the formation of integrin carpets comparable to wildtype. This demonstrates that the talin/integrin interaction at the membrane proximal domain is direct, involving a charge interaction at residues E₇₂₆ (integrin) and K_3I6 (talin). This identified a new binding interface that is critical for talin- dependent β3 -integrin clustering. This new interaction interface between integrins and talin stabilizes the high-affinity conformation of integrins, creating the prerequisite for integrin clustering.

Example 5: Cell spreading and migration inhibitory activity

The efficiency of an inhibitor according to the invention is evaluated in respect to its ability to prevent cell spreading and migration.

The highly motile B 16Fl mouse melanoma cells are used in order to test the influence of the inhibitors to modify cell mobility. B 16Fl cells are transfected using standard methods (electroporation, fugen6, JetPel, etc) with an eukaryotic expression vector such as pcDNA3 (Invitrogen) carrying the signal peptide and the extracellular domain of the alpha chain of the human IL-2 receptor (T ac) (NP 000408; residues 1-240), reacting specifically with the mouse anti-Tac monoclonal antibody 7G7 {Rubin et al, 1985, Hybridoma, 4, 91-102) followed by the transmembrane domain of the mouse beta-3 integrin (TMβ3) (residues 693-722 of mature protein (AAB94086, McHugh et al, 2001, J. Cell Biochem. 81, 320- 332). This common sequence (Tac-TMβ3) is fused to nucleotide sequences encoding different versions of the inhibitory peptide according to the description and followed by a stop codon. The vector DNA is purified and sequenced using standard techniques. Transfected cells are let to recover and to express the inhibitor construct for about two days. The expression and cell surface presence of the inhibitor construct are identified with the mouse monoclonal antibody (7G7). The same antibody is used to isolate transfected cells and to evaluate the concentration of the inhibitor in the plasma membrane by flow cytometry. Subsequently, cells are plated onto purified extracellular matrix proteins specific for different populations of integrin receptors expressed by the B 16Fl cells (Hangan- Steinman et al, 1999, Biochem. Cell Biol., 77, 409-420; Ballestrem et al, 2001, J. Cell Biol., 155, 1319-1332). This includes Laminin-l/alpha6betal; fibronectin/alpha5betal and vitronectin/alphavbeta3.

The degree of cellular spreading analyzed after 1 hour of culture is used as a read-out of the inhibitor ability to interfere with integrin dependent signaling, required for cell spreading. The capacity of the inhibitor peptide sequence to interfere with directed cell migration towards a chemotactic source is evaluated by using a Boyden chamber assay. Cell mobility is determined by cell tracking from video recordings over a period of 10 hours of cells plated on glass surfaces coated with purified integrin ligands according to standard protocols.

Claims

Claims:

1. An isolated polypeptide comprising the following amino acid sequence:

Z D/E-Xi-K/R-E/D-Xj-Xs- X₄-A-X₅ in which Z is an optional membrane anchor;

X₂ and X3 are amino acids independently selected from the group consisting of Ala, Ser, Thr and VaI; X₄ is selected from Lys, Arg, Leu, He and VaI;

X₅ is an optional peptidic moiety selected from the group consisting of (-X₆), (-X₆- X₇) and (-X₆-X₇-Xs) in which X₆ is an amino acid selected from the group consisting of Asn, GIn, GIu and Ala; X₇ is an amino acid selected from the group consisting of Arg, Lys, GIn, GIu and Asn and Xs is an amino acid selected from the group consisting of GIu and Asp; as well as salt and any derivative, analogue or conjugate thereof.

2. An isolated polypeptide according to claim 1 , wherein when X₅ is a peptidic moiety (-X₆-X₇), X₅ optionally further comprises a peptidic moiety (-X₉-X₁₀), wherein X₉ is an amino acid selected from the group consisting of GIu, Asp, Phe, He and Leu and Xio is an amino acid selected from the group consisting of GIu and Asp.

3. An isolated polypeptide according to claims 1 or 2, wherein when X₅ is a peptidic moiety selected from SEQ ID NO: 2; SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 6 and SEQ ID NO: 7.

4. An isolated polypeptide according to any one of claims 1 to 3, wherein X₅ is SEQ ID NO: 2.

5. An isolated polypeptide according to any one of claims 1 to 4 wherein Xi to X₄ and optionally X5 to Xs are selected such as the propensity to form an alpha-helix is not perturbed.

6. An isolated polypeptide according to any of claims 1 to 5 selected from the following group: SEQ ID NO: 8; SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 1 1 ;SEQ ID NO: 12; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 15; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; and SEQ ID NO: 19.

7. An isolated polypeptide according to any of claims 1 to 5 selected from the following group: SEQ ID NO: 20 and SEQ ID NO: 21 .

8. An isolated polypeptide according to any of claims 1 to 7 linked to a membrane anchor "Z" at the N-terminus.

9. An isolated nucleic acid consisting of a nucleotide sequence encoding a peptide according to any of claims 1 to 8.

10. A peptide according to any of claims 1 to 8 for use as a medicament.

1 1. A pharmaceutical composition comprising a peptide according to any of claims 1 to 8 and a physiologically acceptable carrier, diluent or excipient.

12. A method for inhibiting or altering the interaction of integrin and talin comprising the step of blocking the integral or portions of the interaction surface on talin-1

(SEQ ID NO: 22) created by the following amino acids: LeU₃₁₄, LyS_{3 I6}, Lys₃₂₄, Leu325, Prθ327, Glu342, Lys364, GIn₃₈I, Thr₃₈2 Thr₃₈₃ and Glu₃₈4-

13. A method for inhibiting or altering the interaction of integrin and talin wherein the step of blocking includes functionalising, derivatising and capping the integral or portions of the interaction surface on talin-1 (SEQ ID NO: 22) created by the following amino acids: Leu₃i4, Lys₃i6, Lys₃24, Leu₃25, Pro₃27, Glu₃42, Lys₃64, GIn₃₈I, Thr₃₈₂, Thr₃₈₃ and GIu₃₈₄

14. A method according to any one of claims 12 to 14 wherein the step of blocking is achieved by a peptide according to any one of claims 1 to 8.

15. A method for treating a disease or condition associated with integrin dependant spreading and migration such as cancer, angiogenesis, inflammation, thrombosis and adenoviral uptake, comprising the administration of a therapeutically effective amount in a mammal in need thereof of an inhibitor blocking the amino acids from the talin-1 sequence (SEQ ID NO: 22) selected from the following group: Leu3i4,

Lys₃i6, Lys₃24, LeU₃₂₅, PrO₃₂?, GIu₃₄₂, Lys₃₆4, GIn₃₈I, Thr₃₈₂, Thr₃₈₃ and GIu₃₈₄.

16. A method for treating a disease or condition associated with integrin dependant spreading and migration such as cancer, angiogenesis, inflammation, thrombosis and adenoviral uptake comprising the administration of a therapeutically effective amount in a mammal in need thereof of a peptide according to any one of claims 1 to 8.

17. A method for inhibiting angiogenesis in a tissue comprising:

(a) providing:

(i) a tissue; (ii) an agent which inhibits specifically interaction of integrin and talin by blocking the amino acids from the talin-1 sequence (SEQ ID NO: 22) selected from the following group: Leu₃i₄, Lys₃i6, Lys₃₂₄, Leu₃₂s, PrO₃₂₇, GIu₃₄₂, LyS₃₆₄, GIn_38I, Thr₃₈₂, Thr₃₈₃ and GIu₃₈₄;

(b) Treating said tissue with said agent under conditions such that specific interactions between β3 -integrin and talin are inhibited and a treated tissue is produced and angiogenesis in said treated tissue is inhibited.

18. An isolated DNA sequence that encodes a peptide according to any one of claims 1 to 8.

19. A recombinant expression vector comprising a nucleic acid molecule according to claim 18, wherein the vector optionally comprises an expression control sequence, allowing expression in prokaryotic or eukaryotic host cells of the encoded polypeptide, operably linked to the nucleic acid molecule.

20. A host cell transfected or transformed with a recombinant expression vector or a nucleic acid according to the invention.

21. A process for producing cells capable of expressing a peptide according to any one of claims 1 to 8 comprising genetically engineering cells with a vector or a nucleic acid according to the invention.

22. A method of inhibiting or altering the interaction of integrin and talin wherein the step of blocking the selected talin amino acids selected above invention, comprising exposing cells that express talin, to a peptide according to any one of claims 1 to 8, such that the integrin-dependant cell spreading and migration is altered or inhibited.

23. A method for screening for an inhibitor of the interaction of integrin and talin and in particular the β-3-integrin-dependant cell spreading and migration comprising the following steps:

(i) Combining cells that express talin, in presence/absence of a compound to be screened; (ii) Determining the ability of the compound to block the amino acids from the talin- 1 sequence (SEQ ID NO: 22) selected from the following group: LeU₃₁₄, Lys₃i6, Lys₃24, Leu₃25, Pro₃27, Glu₃42, Lys₃64, GIn₃₈I, Thr₃₈₂, Thr₃₈₃ and Glu₃₈4-