KR102408577B1 - Pharmaceutical composition for preventing or treating alopecia comprising betula platyphylla extract as an active ingredient - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating hair loss comprising a birch extract as an active ingredient. Specifically, the birch extract or birch follicle extract of the present invention increases the expression of genes related to hair growth promotion in human dermal papilla cells and at the same time suppresses the expression of inflammatory cytokine genes that inhibit hair regeneration and growth, and mouse animal model When applied to the skin, it promotes hair growth at high density without toxicity, and by inducing hair follicles, it can be usefully used for hair loss treatment or hair growth promotion purposes.

Description

A pharmaceutical composition for preventing or treating hair loss comprising a birch extract as an active ingredient {PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING ALOPECIA COMPRISING BETULA PLATYPHYLLA EXTRACT AS AN ACTIVE INGREDIENT}

The present invention relates to a pharmaceutical composition for preventing or treating hair loss comprising a birch extract as an active ingredient.

Hair buffers abrasions caused to epithelial tissue, protects the skin from direct UV rays, and plays an important physiological role, such as regulating body temperature and transmitting external stimuli. In particular, scalp hair accounts for about 20% of the total human hair, and is recognized as one of the important factors not only to protect the head, but also to emphasize the outward appearance according to gender, age and personality in interpersonal relationships.

In general, the lifespan of hair is known to be about 3 to 5 years for men and about 4 to 6 years for women, and is determined by the activity cycle of the dermal papilla. 90% of normal hair is in the anagen, growing phase, when the hair papilla is active, and less than 1% is in the catagen, transitional phase, in which growth is delayed due to the contraction of the root and separation of the dermal papilla. have. After that, the activity of the dermal papilla completely stops and the hair follicles dry and become club hair (telogen, resting phase), and hair falls out and new hair is generated (exogen and early anagen). Repeat. This hair cycle does not circulate normally and the activity of the dermal papilla is stopped, and the proportion of hair in the resting period increases or the hair is abnormally lost and does not regenerate after it is called alopecia.

Hair loss, which has been recognized as a part of aging, has recently also appeared in women in their 20s and 30s and students in adolescence. Minoxidill, which is a transdermal application, and finasteride and dutasteride, which are taken orally, are clinically marketed after obtaining FDA approval as the currently used hair loss treatment. However, side effects such as weight gain, edema, angina pectoris, dermatitis and pruritus were reported with minoxidil, and side effects of finasteride such as male sexual dysfunction and birth defects were reported. In addition, as side effects of dutasteride, erectile dysfunction and decreased libido are representative, and concerns about the occurrence of prostate cancer have been raised. Accordingly, attention is focused on the development of novel therapeutic agents derived from natural products that are safe for long-term use and to compensate for the shortcomings of such therapeutic agents for hair loss. In this regard, Korean Patent Laid-Open No. 10-2020-0059175 discloses hair loss using Jeokhasuo, Hanryeoncho, White Jain, Cheonma, Seokchangpo, Acute Jain, Journeyman, Sculptor, Baekbokryeong, Angelica, Songgisaeng, Maca, Chimyang, and Sachainchi. Disclosed is a composition for promoting hair growth that prevents and promotes hair growth.

Republic of Korea Patent Publication No. 10-2020-0059175

It is an object of the present invention to provide a use for treating hair loss and a use for promoting hair growth of a birch extract.

In order to achieve the above object, the present invention provides a pharmaceutical composition for preventing or treating hair loss containing as an active ingredient any one or more selected from the group consisting of birch tree ( Betula platyphylla ) extract and birch cyst extract.

In addition, the present invention provides a health functional food for preventing or improving hair loss containing as an active ingredient any one or more selected from the group consisting of birch extract and birch steam extract.

In addition, the present invention provides a cosmetic composition for preventing or improving hair loss containing as an active ingredient any one or more selected from the group consisting of birch extract and birch steam extract.

In addition, the present invention provides a skin external preparation for preventing or improving hair loss containing as an active ingredient any one or more selected from the group consisting of birch extract and birch steam extract.

Furthermore, the present invention provides a composition for promoting hair growth containing, as an active ingredient, any one or more selected from the group consisting of birch extract and birch steam extract.

The birch extract or birch follicle extract of the present invention increases the expression of genes related to hair growth promotion in human dermal papilla cells, and at the same time suppresses the expression of inflammatory cytokine genes that inhibit hair regeneration and growth, and is applied to mouse animal models. When it promotes hair growth at high density without toxicity, and induces hair follicles, it can be usefully used to treat hair loss or promote hair growth.

1 is a schematic diagram showing a process for preparing a birch extract or birch extract in an embodiment of the present invention.
FIG. 2 is a view showing the results of confirming the antioxidant activity of the birch japonica extract in an embodiment of the present invention to scavenging DPPH radicals (A) and inhibiting proteolysis by hydroxyl radicals (B).
Figure 3 is a graph showing the results confirming that the birch follicle extract increases the activation of human dermal papilla cells (A) and macrophages (B) in one embodiment of the present invention.
Figure 4 is a graph of the result confirming that the expression of FGF7 and Wnt7b genes in human dermal papilla cells significantly increased by birch extract and birch follicle extract in an embodiment of the present invention.
5 is a graph showing the results confirming that the birch cyst extract inhibits the expression of inflammatory cytokines iNOS, COX-2 and IL-6 genes in macrophages in a concentration-dependent manner in an embodiment of the present invention.
6 is a view showing the results confirming that the birch extract and the birch steam extract promote hair growth in a mouse animal model in an embodiment of the present invention (Ctrl: untreated control group, MXD: minoxidil treated group, PTN: D-panthenol) Treatment group, Example 1: Extract treatment group of Example 1, Example 4: Extract treatment group of Example 4).
7 is a graph showing the results of confirming the change in body weight of a mouse animal model by application of a birch extract and birch steam extract in an embodiment of the present invention (Ctrl: untreated control group, MXD: minoxidil treated group, PTN: D-panthenol) Treatment group, Example 1: Extract treatment group of Example 1, Example 4: Extract treatment group of Example 4).
8 is a view showing the results confirming that hair follicles were induced in the skin tissue of a mouse animal model by application of a birch extract and birch follicle extract in an embodiment of the present invention (Ctrl: untreated control group, MXD: minoxidil treated group, PTN: D-panthenol treated group, Example 1: Extract treated group of Example 1, Example 4: Extract treated group of Example 4).
9 is a graph showing the results confirming that the expression of FGF7, Wnt7b and VEGF genes in the skin tissue of a mouse animal model is significantly increased by application of a birch extract and birch follicle extract in an embodiment of the present invention (Ctrl: Untreated control group, MXD: minoxidil treated group, PTN: D-panthenol treated group, Example 1: Extract treated group of Example 1, Example 4: Extract treated group of Example 4).

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for preventing or treating hair loss containing as an active ingredient any one or more selected from the group consisting of birch tree ( Betula platyphylla ) extract and birch steam extract.

As used herein, the term "birch ( Betula platyphylla )" is a dicotyledonous plant, an oak tree, a deciduous tree of the Birch family, the bark is gray-white and composed of several layers of thin bark, and the branches are drooping down. It peels off easily and the lining is orange-yellow. Birch contains compounds exhibiting various physiological activities, so it can be used to treat fever, upper limit, jaundice, pulmonary poisoning, pain, rheumatism, skin diseases, boils, and the like.

The birch tree may be any one or more selected from the group consisting of stems and branches of birch trees, and in an embodiment of the present invention, the birch trees may be above-ground parts including stems and branches. The birch may not contain fruits, leaves, flowers and roots. The birch tree may be used as a seedling of a young person with soft stems and branches. Specifically, the birch tree may be less than 10 years old, less than 8 years old, or less than 6 years old.

The birch extract may be prepared by a manufacturing method comprising the following steps:

1) preparing an extract by adding an extraction solvent to birch;

2) filtering the extract of step 1); and

3) drying the filtered filtrate of step 2) after concentration under reduced pressure.

In addition, the extraction solvent may be water, alcohol, or a mixture thereof. The alcohol may be a C ₁ to C ₂ lower alcohol, and specifically, the alcohol may be ethanol, methanol, or alcohol. The extraction solvent may be added in an amount of 5 to 30 times, 5 to 25 times, 5 to 20 times, 8 to 25 times, 8 to 20 times the mass of the birch tree.

The extraction method may be shaking extraction, Soxhlet extraction or reflux extraction. In this case, the extraction time may be 1 to 70 hours, 1 to 50 hours, 10 to 70 hours, or 10 to 50 hours. The extraction may be repeated one or more times, two or more times, or three or more times.

On the other hand, the vacuum concentration in step 3) may use a vacuum vacuum concentrator or a vacuum rotary evaporator. In addition, the drying may be reduced pressure drying, vacuum drying, boiling drying, spray drying or freeze drying, specifically, may be freeze drying.

As used herein, the term "foaming" refers to a step of steaming and drying. At this time, steaming and drying may be performed at an appropriate temperature and time by a person skilled in the art. It can be expressed that steaming and drying are performed once, respectively, and foamed once. As an example, the foaming may be performed one or more times, two or more times, three or more times, four or more times, or five or more times.

The steamed birch extract according to the present invention can be prepared by the above-described manufacturing method after steaming the birch.

The pharmaceutical composition according to the present invention may contain 10 to 95% by weight of any one or more selected from the group consisting of birch extract and birch steam extract, which are active ingredients, based on the total weight of the composition. In addition, the pharmaceutical composition of the present invention may further include at least one active ingredient exhibiting the same or similar function in addition to the active ingredient.

The pharmaceutical composition of the present invention may include a carrier, diluent, excipient or a mixture thereof commonly used in biological agents. Any pharmaceutically acceptable carrier may be used as long as it is suitable for delivering the composition in vivo. Specifically, the carrier is Merck Index, 13th ed., Merck & Co. Inc., saline, sterile water, Ringer's solution, dextrose solution, maltodextrin solution, glycerol, ethanol, or mixtures thereof. In addition, conventional additives such as antioxidants, buffers, and bacteriostats may be added as needed.

When formulating the composition, commonly used fillers, extenders, binders, wetting agents, disintegrants, diluents or excipients such as surfactants may be added.

The composition of the present invention may be formulated as an oral preparation or a parenteral preparation. Oral formulations may include solid formulations and liquid formulations. The solid preparation may be a tablet, pill, powder, granule, capsule, or troche, and the solid preparation may be prepared by adding at least one excipient to the composition. The excipient may be starch, calcium carbonate, sucrose, lactose, gelatin, or a mixture thereof. In addition, the solid formulation may contain a lubricant, examples of which include magnesium stearate, talc, and the like. Meanwhile, the liquid formulation may be a suspension, an internal solution, an emulsion, or a syrup. In this case, the liquid formulation may include excipients such as wetting agents, sweetening agents, fragrances, and preservatives.

The parenteral formulation may include injections, suppositories, powders for respiratory inhalation, aerosols for sprays, powders and creams, and the like. The injection may include a sterile aqueous solution, a non-aqueous solution, a suspension solution, an emulsion, and the like. In this case, as the non-aqueous solvent or suspension solution, vegetable oils such as propylene glycol, polyethylene glycol, and olive oil, or injectable esters such as ethyl oleate may be used.

The pharmaceutical composition of the present invention may be administered orally or parenterally according to a desired method. Parenteral administration may include intraperitoneal, rectal, subcutaneous, intravenous, intramuscular or intrathoracic injection.

The composition may be administered in a pharmaceutically effective amount. This may vary depending on the type of disease, severity, drug activity, patient's sensitivity to the drug, administration time, administration route, treatment period, drugs used at the same time, and the like. However, for a desirable effect, the amount of the active ingredient included in the pharmaceutical composition according to the present invention may be 0.0001 to 1,000 mg/kg, specifically 0.001 to 500 mg/kg. The administration may be once or several times a day.

The composition of the present invention may be administered alone or in combination with other therapeutic agents. When administered in combination, the administration may be sequential or simultaneous.

In addition, the present invention provides a health functional food for preventing or improving hair loss containing as an active ingredient any one or more selected from the group consisting of birch extract and birch steam extract.

The birch extract or birch steam extract may have the characteristics as described above. For example, the birch tree may be any one or more selected from the group consisting of stems and branches. In addition, the extract may be one extracted with water, a C ₁ to C ₂ lower alcohol or a mixture thereof, and in this case, the C ₁ to C ₂ lower alcohol may be ethanol, methanol or alcohol.

In addition, the foaming may be performed at an appropriate temperature and time by a person skilled in the art, and specifically, the foaming may be performed one or more times, two or more times, three or more times, four or more times, or five or more times.

Any one or more selected from the group consisting of birch extract and birch extract of the present invention may be added to food as it is, or used together with other foods or food ingredients. In this case, the content of the added active ingredient may be determined according to the purpose, and may generally be 0.01 to 90 parts by weight based on the total weight of the food.

The form and type of health functional food is not particularly limited. Specifically, the health functional food may be in the form of tablets, capsules, powders, granules, liquids and pills. The health functional food may include various flavoring agents, sweetening agents, or natural carbohydrates as additional ingredients. The sweetener may be a natural or synthetic sweetener, and examples of the natural sweetener include thaumatin, stevia extract, and the like. Meanwhile, examples of synthetic sweeteners include saccharin, aspartame, and the like. In addition, the natural carbohydrates may be monosaccharides, disaccharides, polysaccharides, oligosaccharides and sugar alcohols.

The health functional food of the present invention, in addition to the above-described additional ingredients, nutrients, vitamins, electrolytes, flavoring agents, colorants, pextan and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives , glycerin, alcohol, and the like may be further included. These components may be used independently or in combination. The proportion of the additive may be selected from 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

In addition, the present invention provides a cosmetic composition for preventing or improving hair loss containing as an active ingredient any one or more selected from the group consisting of birch extract and birch steam extract.

The birch extract or birch steam extract may have the characteristics as described above. For example, the birch tree may be any one or more selected from the group consisting of stems and branches. In addition, the extract may be one extracted with water, a C ₁ to C ₂ lower alcohol or a mixture thereof, and in this case, the C ₁ to C ₂ lower alcohol may be ethanol, methanol or alcohol.

In addition, the foaming may be performed at an appropriate temperature and time by a person skilled in the art, and specifically, the foaming may be performed one or more times, two or more times, three or more times, four or more times, or five or more times.

The cosmetic composition of the present invention may contain any one or more selected from the group consisting of the birch extract and birch steam extract in an amount of 0.1 to 50% by weight, specifically 1 to 10% by weight. The cosmetic composition may be directly applied to the skin for the purpose of preventing or improving hair loss.

The cosmetic composition may be formulated in a conventionally prepared cosmetic formulation. The cosmetic composition may be formulated as a solution, suspension, emulsion, paste, gel, lotion, cream, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation and spray. Specifically, it may be a flexible lotion, a nourishing lotion, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, or a powder.

When the formulation of the cosmetic composition of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide or mixtures thereof. In addition, when the formulation of the cosmetic composition is powder or spray, it may include lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder, or a mixture thereof. In particular, in the case of a spray, chlorofluorohydrocarbon, propane/butane or dimethyl ether may be further included.

When the formulation of the cosmetic composition of the present invention is a solution or emulsion, it may include a solvent, a solvating agent, an emulsifying agent, or a mixture thereof as a carrier. Examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol, sorbitan fatty acid ester, and the like.

When the formulation of the cosmetic composition of the present invention is a suspension, as a carrier, a liquid diluent such as water, ethanol or propylene glycol, ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester; microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, tragacanth or mixtures thereof. In addition, when the formulation of the cosmetic composition is surfactant-containing cleansing, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid as a carrier amide ether sulfates, alkalamidobetaines, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives, ethoxylated glycerol fatty acid esters, or mixtures thereof.

In addition to the carrier component, the cosmetic composition of the present invention may include an antioxidant, a stabilizer, a solubilizer, a moisturizing agent, a pigment, a fragrance, a sunscreen, a color developer, a surfactant, or a mixture thereof as an adjuvant. The adjuvant may be used as long as it is a material commonly used in the preparation of a cosmetic composition.

In addition, the present invention provides a skin external preparation for preventing or improving hair loss containing as an active ingredient any one or more selected from the group consisting of birch extract and birch steam extract.

The birch extract or birch steam extract may have the characteristics as described above. For example, the birch tree may be any one or more selected from the group consisting of stems and branches. In addition, the extract may be one extracted with water, a C ₁ to C ₂ lower alcohol or a mixture thereof, and in this case, the C ₁ to C ₂ lower alcohol may be ethanol, methanol or alcohol.

In addition, the foaming may be performed at an appropriate temperature and time by a person skilled in the art, and specifically, the foaming may be performed one or more times, two or more times, three or more times, four or more times, or five or more times.

The external preparation for skin of the present invention may include a pharmaceutically acceptable carrier and excipient. The carrier and excipient may include preservatives, stabilizers, wetting agents, emulsification accelerators and buffers, and the like. Specifically, the excipient may be lactose, dextrin, starch, mannitol, sorbitol, glucose, saccharose, microcrystalline cellulose, gelatin, polyvinylpyrrolidone, or a mixture thereof. The external preparation for skin may be appropriately prepared according to a method well known in the art. The external preparation for skin may be prepared in the form of powder, gel, ointment, cream, liquid and aerosol.

Furthermore, the present invention provides a composition for promoting hair growth containing, as an active ingredient, any one or more selected from the group consisting of birch extract and birch steam extract.

The birch extract or birch steam extract may have the characteristics as described above. For example, the birch tree may be any one or more selected from the group consisting of stems and branches. In addition, the extract may be one extracted with water, a C ₁ to C ₂ lower alcohol or a mixture thereof, and in this case, the C ₁ to C ₂ lower alcohol may be ethanol, methanol or alcohol.

In addition, the foaming may be performed at an appropriate temperature and time by a person skilled in the art, and specifically, the foaming may be performed one or more times, two or more times, three or more times, four or more times, or five or more times.

Hereinafter, the present invention will be described in detail by the following examples, provided that the following examples are only for illustrating the present invention, and the present invention is not limited thereto. Anything that has substantially the same configuration as the technical idea described in the claims of the present invention and achieves the same operation and effect is included in the technical scope of the present invention.

Example 1. Birch ( Betula platyphylla ) preparation of extracts

A birch extract was prepared using the above-ground part of the birch tree in the following way.

First, the above-ground parts of birch trees aged 5 years or older were collected, leaves and fruits were removed, cut into pieces, washed under running water, and dried. 65% of alcohol was added to the above-ground part of the dried birch tree in 10 times and left at room temperature for 24 hours. The above process was repeated three times to obtain a birch extract, which was filtered, concentrated and freeze-dried to finally prepare an alcohol extract of birch tree in a yield of 4.5%.

Example 2. Preparation of birch single steam extract

The same method as in Example 1, except that the dried above-ground part of the birch was steamed at 95° C. for 3 hours and 30 minutes, dried at 50° C. for 24 hours, evaporated once, and extracted by adding 65% alcohol. to prepare a one-time steam extract of birch with a yield of 2.8%.

Example 3. Preparation of birch steamed extract twice

Except that the dried birch above-ground part was vaporized twice, an extract obtained by vaporizing birch twice in a yield of 3.8% was prepared in the same manner as in Example 2.

Example 4. Preparation of birch three-fold steam extract

Except that the dried birch above-ground part was vaporized three times, an extract obtained by foaming three times of birch in a yield of 3.6% was prepared in the same manner as in Example 2.

Example 5. Preparation of 4 times birch steam extract

Except that the dried birch above-ground part was vaporized four times, an extract obtained by vaporizing birch four times in a yield of 2.7% was prepared in the same manner as in Example 2.

Example 6. Preparation of 5 times birch steam extract

Except that the dried birch above-ground part was vaporized five times, an extract obtained by foaming five times of birch in a yield of 3.5% was prepared in the same manner as in Example 2.

Experimental Example 1. Confirmation of total phenolic compound content of birch extract

The content of total phenolic compounds included in the birch extract and birch steam extract prepared in the above Example was confirmed by the folin-ciocalteu method.

First, 10 μl of the extract (10 mg/ml) prepared in Examples 1 to 6 was dispensed into a 0.2 mL tube, and 160 μl of distilled water was added. Here, 10 μl of Pauline-Siocaltu phenol reagent (Sigma-Aldrich) was added and reacted in the dark for 5 minutes. After the reaction, 20 μl of 20% (w/v) Na ₂ CO ₃ was added and reacted again in the dark for 20 minutes. The reaction was aliquoted in a 96-well plate and absorbance was measured under a wavelength of 765 nm. At this time, as a control, the content of total phenolic compounds contained in the birch extract prepared in the above Example through a calibration curve prepared using gallic acid at a concentration of 62.5 to 500 μg/ml is shown in Table 1 below in mg GAE ( It was expressed as GA equivalent)/g (dry extract wt.).

Total polyphenol content (mg GAE/g) Example 1 51.77±2.73 Example 2 54.59±0.23 Example 3 55.29±0.12 Example 4 58.14±0.94 Example 5 54.51±1.29 Example 6 48.03±0.84

As shown in Table 1 above, the birch extract or birch extract of Examples 1 to 6 contained total polyphenols in a high content. Specifically, the total polyphenol content was higher in the steamed birch extract than in the birch extract, and was highest in the case of steaming three times, and then showed a tendency to decrease slightly thereafter.

Experimental Example 2. Confirmation of antioxidant activity of birch extract

2-1. Confirmation of DPPH radical scavenging ability

The antioxidant activity of the birch steam extract prepared in the above example was confirmed through DPPH (1,1-diphenyl-2-picrylhydrazyl) radical scavenging ability.

First, a methanol solution containing 0.3 mM DPPH was prepared and prepared. The extract prepared in Example 4 was added thereto to a concentration of 1, 10, 25, 50 or 100 μg/ml, and reacted at room temperature for 10 minutes. After the reaction was completed, absorbance was measured under a wavelength of 517 nm, and the results are shown in FIG. 2A.

As shown in FIG. 2A , the extract of Example 4 increased the DPPH radical scavenging ability depending on the treatment concentration, and the IC ₅₀ value was confirmed to be 8.32±0.62 μg.

2-2. Confirmation of the effect of inhibiting proteolysis

Whether the birch steam extract prepared in the above example exhibits an effect of inhibiting proteolysis by hydroxyl radicals was confirmed using a metal ion-catalyzed oxidation inhibition assay.

First, 100 μM Cu ²⁺ and 2.5 mM H ₂ O ₂ were added to 0.5 μg/ml bovine serum albumin (Sigma-Aldrich) protein to generate hydroxyl radicals. Here, the extract prepared in Example 4 was added and reacted so as to be 0.5, 1, 2.5, 5 or 10 μg/ml. At this time, 50 μM ascorbic acid was used as a positive control. After the reaction was completed, the reaction product was electrophoresed on a 10% SDS polyacrylamide gel, and the result of confirming the content of BSA protein is shown in FIG. 2B.

As shown in FIG. 2B , the degradation of BSA protein was inhibited by the extract of Example 4 at 2.5 μg/ml or more.

From this, it was found that the birch extract and birch steam extract according to the present invention effectively removed hydroxy radicals to exhibit antioxidant activity.

Experimental Example 3. Confirmation of cell activity promoting effect of birch extract

It was confirmed as follows whether the birch follicle extract prepared in the above example promotes cell activity in human dermal papilla cells involved in the hair growth process and a macrophage cell line (Raw264.7) related to hair loss, such as skin inflammation.

First, dermal papilla cells and macrophage cell lines were aliquoted to 1×10 ⁵ cells/ml in a 96-well plate and cultured overnight. The cultured cells were treated with 0.1, 1, or 10 μg/ml birch effervescence extract, and cultured in a 5% CO ₂ incubator for 24 hours. Thereafter, cell activity was confirmed using Cell Counting Kit-8 (Cell Counting Kit-8, Dojindo, Japan). Specifically, 10 μl of CCK solution was added to the cultured cells, incubated at 37° C. for 2 hours, and absorbance was measured using an ELISA device (Spectramax Plus 384 Spectrophotometer, Molecular Devices, USA) under a wavelength of 450 nm. measured, and the results are shown in FIG. 3 .

As shown in FIG. 3 , the birch cyst extract promoted the cellular activity of dermal papilla cells and macrophages.

Experimental Example 4. Confirmation of hair growth-related gene expression change by birch extract

Whether the birch extract and birch follicle extract prepared in the above Example change the expression of keratinocyte growth factor (FGF7) and Wnt7b genes, which are genes related to hair growth, was confirmed as follows.

First, human dermal papilla cells were dispensed to 1×10 ⁶ cells/ml and cultured overnight. The prepared cells were treated with the extracts prepared in Examples 1 to 6 at a concentration of 10 μg/ml, and cultured in a 5% CO ₂ incubator for 24 hours. At this time, minoxidil at a concentration of 10 μM was used as a positive control. The cultured cells were treated with Trizol reagent (Invitrogen, USA) to extract total RNA in a conventional manner. cDNA was synthesized using 1 μg of extracted RNA, oligo dT primer and TOPscript™ reverse transcriptase (Enzynomics, Korea), and a total volume of 20 μl using the synthesized cDNA and SYBR Green PCR Master Mix (Qiagen, USA) Real-time polymerase chain reaction (quantitative real-time PCR) was performed under the conditions of At this time, the real-time polymerase chain reaction was performed under the conditions described in Table 3, using the primers as shown in Table 2 below. As a result, the expression level of the amplified gene was normalized to the expression level of the control GAPDH gene and is shown in FIG. 4 .

primer Sequence (5'→3') SEQ ID NO: hFGF7_forward ATACTGACATGGATCCTGCC SEQ ID NO: 1 hFGF7_reverse TCTGGAGTCATGTCATTGCA SEQ ID NO: 2 hWnt7b_forward AGCCAACATCATCTGCAACA SEQ ID NO: 3 hWnt7b_reverse GGTTGTAGTAGCCCTGCTTC SEQ ID NO: 4 hVEGF_forward TGAACTTTCTGCTGTCTTGG SEQ ID NO: 5 hVEGF_reverse AACTTCACCACTTCGTGATG SEQ ID NO: 6 GAPDH__forward GGAGCCAAAAGGGTCATCAT SEQ ID NO: 7 GAPDH_reverse GTGATGGCATGGACTGTGGT SEQ ID NO: 8 miNOS_forward GATGACCCTAAGAGTCACCA SEQ ID NO: 9 miNOS_reverse TTTGCCTCTTTAAAGGAGCC SEQ ID NO: 10 mIL-6_forward TTCCATCCAGTTGCCTTCTT SEQ ID NO: 11 mIL-6_reverse GTTGGGAGTGGTATCCTCTG SEQ ID NO: 12 mCOX2_forward GTCTGGTGCCTGGTCTGATG SEQ ID NO: 13 mCOX2_reverse GGTTGAAAAGGAGCTCTGGG SEQ ID NO: 14 mVEGF_forward CAGATGTGAATGCAGACCAA SEQ ID NO: 15 mVEGF_reverse TCTGTGTTTTTGCAGGAACA SEQ ID NO: 16 mWnt7b_forward GAAGCAAGGCTACTACAACC SEQ ID NO: 17 mWnt7b_reverse CACACCGTGACACTTACATT SEQ ID NO: 18 β-actin_forward TACAGCTTCACCACCACAGC SEQ ID NO: 19 β-actin_reverse AAGGAAGGCTGGAAAAGAGC SEQ ID NO: 20

step Temperature (℃) hour cycle metamorphism 95 10 minutes 45 denaturalization 95 15 seconds Annealing 57 15 seconds kidney 72 10 seconds posterior kidney 72 10 minutes One

As shown in FIG. 4 , the extracts of Examples 1 to 6 significantly increased the expression of FGF7 and Wnt7b genes to a degree similar to that of minoxidil, a commercially available hair growth agent. In particular, the three times birch extract increased the expression of FGF7 and Wnt7b genes the most, thereby showing the best hair growth effect.

Experimental Example 5. Confirmation of inflammatory cytokine-related gene expression change by birch extract

The birch follicle extract prepared in the above Example is an inflammatory cytokine that inhibits hair regeneration, iNOS gene, or COX-2 (cyclooxygenase 2), an inflammatory cytokine that inhibits hair growth by delaying hair follicle density reduction and hair follicle formation. And it was confirmed whether the expression of IL-6 (interleukin-6) gene was changed.

The experiment was performed by preparing the RAW264.7 cell line as described in Experimental Example 4, and then treating the extract of 1 μg/ml LPS (lipopolysaccharide), and 1, 5 or 10 μg/ml Example 4 in a conventional manner. Except for the above, the same procedure as in Experimental Example 4 was carried out. As a result, the expression level of the amplified gene was normalized to the expression level of the control β-actin gene and is shown in FIG. 5 .

5, the extract of Example 4 inhibited the expression of iNOS, COX-2 and IL-6 genes, which are inflammatory cytokines that delay hair regeneration or growth, in a concentration-dependent manner.

Therefore, from the above, it was found that the birch extract and birch japonica extract according to the present invention promote hair regeneration and growth.

Experimental Example 6. Confirmation of hair growth effect in animal model of birch extract

6-1. Check hair growth area

It was confirmed by analyzing the hair growth area whether the birch tree extract and the birch follicle extract prepared in the above Example showed a significant hair growth effect in a mouse animal model.

First, after purchasing a 5-week-old male C57BL/6 mouse (Coatec, Korea), a temperature of 23±3℃, a humidity of 50±10%, and 12 hours from 9:00 am to 9:00 pm for 1 week By observing while acclimatizing under a light-dark cycle and an illuminance of 150 to 200 lux, only healthy individuals were selected. The selected mice were classified into 6 groups with 3 mice in each group, and the back of the mice was completely removed using an electric epilator and a hair removal agent one day before the application of the drug. The next day, the extract of Example 1 or Example 4 at a concentration of 10 mg/kg was prepared in a volume of 0.2 ml, and this was applied evenly to the back of the prepared mouse with a brush. At this time, as a control group, the untreated group (Ctrl), the solvent treatment group (Veh), the 5% minoxidil treatment group (MTD), and the 5% D-panthenol treatment group (PTN) were also applied with the same drug. The extract was applied once daily at 2 pm for a total of 12 days, and on days 0, 3, 6, 9 and 12 of application, mice were anesthetized with pentobarbital (Sigma-Aldrich, USA) to visually observe the hair growth effect. observed. As a result, the photograph is shown in FIG. 6, and the hair growth rate confirmed with the naked eye is shown in Table 4. On the other hand, the weight of the mouse was also measured to confirm whether the weight was changed by the extract treatment, and the result is shown in a graph in FIG. 7 .

application period Ctrl MXD PTN Veh Example 1 Example 4 0 days - - - - - - 3 days - - - - - - 6 days - + + - + + 9 days + ++ ++ + ++ ++ 12 days ++ +++++ +++++ ++ +++++ ++++

Based on hair growth rate: 0 to 10% (-), 11 to 30% (+), 31 to 50% (++), 51 to 70% (+++), 71 to 90% ( ++++), and 91 to 100% (++++)

As shown in FIG. 6 , growth of short hair was observed in mice coated with the extract of Example 1 or 4, similar to the positive control group minoxidil or D-panthenol treatment group from 6 days after application. After 9 days of application, hair grew and hair growth with a high density was progressed, and after 12 days of application, it showed a level of hair growth similar to that of minoxidil at high density.

On the other hand, as shown in Figure 7, during the period of application of the extract of Example 1 or 4, the mouse was not observed abrupt increase or decrease in body weight. In addition, there were no special abnormalities or sensitive skin changes during the application period, and fatal toxicity was not observed, confirming that the extract according to the present invention was safe for animals.

6-2. Confirm histological changes

In Experimental Example 6-1, after the extract of Example 1 or 4 was applied for 12 days, the skin of the region where hair growth was the most active and the region where hair growth was delayed the most was extracted and histological changes in the skin were confirmed.

First, the excised skin was fixed with 10% formalin for 7 days, and the fixed tissue was dehydrated using alcohol and xylene in a conventional manner. After the dehydrated tissue was embedded in paraffin, sections were obtained with a microtome to a thickness of 5 μm, and then hematoxylin-eosin staining was performed. The results obtained by observing the stained tissue under an optical microscope are shown in FIG. 8 .

As shown in FIG. 8 , hair follicles were induced in the skin tissue of mice treated with the extract of Example 1 or 4, similar to the minoxidil and D-pantheol-treated groups, which are positive controls. In particular, it was confirmed that the extract of Example 4, which is an extract from birch three times, had the best number and thickness of the formed hair follicles, showing an effect equal to or greater than that of the positive control.

6-3. Confirmation of hair growth-related gene expression changes

Expression changes of FGF7, Wnt7b, and vascular endothelial growth factor (VEGF) genes, which are hair growth-related genes, in the mouse skin tissue obtained in Experimental Example 6-2 were confirmed as follows. The experiment was performed in the same manner as in the conditions and methods described in Experimental Example 3, except that total RNA was extracted from the skin tissue of the mouse and used in a conventional manner. As a result, the expression level of the amplified gene was normalized to the expression level of the control β-actin gene and is shown in FIG. 9 .

As shown in Figure 9, the extract of Example 1 or 4 significantly increased the expression of FGF7, Wnt7b and VEGF genes. In particular, the extract of Example 4, which is an extract from birch three times, increased the expression of the gene more significantly than the positive control group minoxidil or D-pantheol treatment group. In addition, the expression rate of the VEGF gene was significantly increased, and it was confirmed that the extract of Examples 1 or 4 acted as a factor to promote angiogenesis in cells in resting phase to induce cells in the growth phase.

Therefore, it can be seen from the above that the birch extract or birch steam extract according to the present invention can be usefully used as a composition for promoting hair growth.

<110> JOO, Seong Soo <120> PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING ALOPECIA COMPRISING BETULA PLATYPHYLLA EXTRACT AS AN ACTIVE INGREDIENT <130> DP-2020-0173-KR <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> hFGF7_forward <400> 1 atactgacat ggatcctgcc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> hFGF7_reverse <400> 2 tctggagtca tgtcattgca 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> hWnt7b_forward <400> 3 agccaacatc atctgcaaca 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> hWnt7b_reverse <400> 4 ggttgtagta gccctgcttc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> hVEGF_forward <400> 5 tgaactttct gctgtcttgg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> hVEGF_reverse <400> 6 aacttcacca cttcgtgatg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH__forward <400> 7 ggagccaaaa gggtcatcat 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_reverse <400> 8 gtgatggcat ggactgtggt 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> miNOS_forward <400> 9 gatgacccta agagtcacca 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> miNOS_reverse <400> 10 tttgcctctt taaaggagcc 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mIL-6_forward <400> 11 ttccatccag ttgccttctt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mIL-6_reverse <400> 12 gttgggagtg gtatcctctg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mCOX2_forward <400> 13 gtctggtgcc tggtctgatg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mCOX2_reverse <400> 14 ggttgaaaag gagctctggg 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mVEGF_forward <400> 15 cagatgtgaa tgcagaccaa 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mVEGF_reverse <400> 16 tctgtgtttt tgcaggaaca 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mWnt7b_forward <400> 17 gaagcaaggc tactacaacc 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mWnt7b_reverse <400> 18 cacaccgtga cacttacatt 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_forward <400> 19 tacagcttca ccaccacagc 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_reverse <400> 20 aaggaaggct ggaaaagagc 20

Claims (9)

Birch tree ( Betula platyphylla ) A pharmaceutical composition for preventing or treating hair loss containing an extract of three times the foaming as an active ingredient.
The pharmaceutical composition for preventing or treating hair loss according to claim 1, wherein the birch tree is at least one selected from the group consisting of stems and branches.
The pharmaceutical composition for preventing or treating hair loss according to claim 1, wherein the extract is extracted with water, C ₁ to C ₂ lower alcohol or a mixture thereof.
The pharmaceutical composition for preventing or treating hair loss according to claim 3, wherein the C ₁ to C ₂ lower alcohol is ethanol, methanol or alcohol.
delete A health functional food for preventing or improving hair loss containing birch 3 times steamed extract as an active ingredient.
A cosmetic composition for preventing or improving hair loss comprising an extract of birch three times steaming as an active ingredient.
A skin external preparation for preventing or improving hair loss, containing the extract of three times birch as an active ingredient.
A composition for promoting hair growth containing an extract of birch three times steaming as an active ingredient.

Images