KR102369110B1 - Cosmetic composition containing the mixed extract of Kummerowia stipulacea and Tephroseris kirilowii - Google Patents

Abstract

The present invention relates to a skin moisturizing cosmetic composition containing a mixed extract of Kummerowia stipulacea and Tephroseris kirilowii as active ingredients. The mixed extract is highly effective in increasing the gene expression of factors related to moisturizing and skin barrier function and inhibiting the activity of hyaluronic acid-degrading enzymes without affecting the cell viability, and thus can be effectively used as a cosmetic composition for moisturizing the skin and strengthening the skin barrier.

Description

Cosmetic composition containing the mixed extract of Kummerowia stipulacea and Tephroseris kirilowii as an active ingredient

The present invention relates to a cosmetic composition containing a mixed extract of Kummerowia stipulacea and Tephroseris kirilowii as an active ingredient. It relates to a cosmetic composition exhibiting moisturizing and skin barrier strengthening activity.

The skin, located at the outermost part of the human body, acts as a barrier to protect the human body from dry environments, ultraviolet rays, microorganisms, and chemical and mechanical stimuli at the interface between the external environment and the human body. The skin tissue is composed of the epidermis, dermis, and subcutaneous fat, and the epidermis forms the stratum corneum by repeating the process of formation, differentiation and exfoliation in the outermost layer. (Seo Eun-kyung, 2008)

In addition, the stratum corneum has a function to prevent moisture loss and maintains the moisture retention of our skin at about 30%. When the moisture retention falls below about 10%, it is classified as dry skin. When dry skin symptoms are induced, the skin barrier is damaged and the barrier function is affected, which can lead to senile dry skin or atopic dermatitis and irritant contact dermatitis (Jia Kim, 2015).

The stratum corneum plays an important role in protecting the moisture content of the skin from a dry environment, and the expression of the TG-1 gene increases as the keratinocytes, which serve as structures, differentiate themselves. The TG-1 gene acts as a bridge between the structural proteins involucrin, loricrin, and cornifin and catalyzes a stable isotope peptide bond when the keratinocyte is formed, thereby strengthening the skin barrier by conferring resistance and insolubility.

In addition, hyaluronic acid produced by hyaluronan shynthase-3 (HAS-3) expressed in the epidermis is a natural moisturizing factor of the skin and is used as a representative index to evaluate the moisturizing ability of the skin. It is an important substrate that retains moisture by maintaining the function of retaining moisture. (Seyeon Ahn, 2017)

The present inventors conducted research to discover Korean native materials that enhance skin moisture and strengthen skin barrier, and finally selected round knot grass and cotton bats through screening. When they are mixed and extracted, the gene expression of factors related to skin moisturizing and skin barrier function is increased, and the effect of inhibiting the activity of hyaluronic acid degrading enzyme is greatly enhanced, thereby completing the present invention.

(0001) Republic of Korea Patent No. 10-1248101 (2013.03.21) (0002) Republic of Korea Patent Registration No. 10-2059008 (2019.12.18)

It is an object of the present invention to provide a cosmetic composition containing a mixed extract of round knotweed and cotton bat as an active ingredient to exhibit excellent skin moisturizing enhancement and skin barrier strengthening activity.

According to the present invention in order to achieve the above object, there is provided a cosmetic composition containing 0.1 to 10% by weight based on the total weight of the cosmetic composition as an active ingredient, a mixed extract of round knotweed and cotton bat.

The round knot grass and cotton bat mixed extract is prepared by mixing round knot grass and cotton bat in a weight ratio of 1 to 3:1 to 3, respectively, and preferably 2 to 3:1 to 3 by weight. , More preferably, it is prepared by mixing in a weight ratio of 2 to 3:1.

The mixed extract is water, anhydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol, butylene glycol, caprylic / capric triglyceride, dimethicone, mineral oil, cyclomethicone, It is prepared by extraction with at least one solvent selected from the group consisting of octyldodecanol, cetylethylhexanoate, trirethylhexanoin, isopropylmyristate, and vegetable oil.

The cosmetic composition is a cosmetic composition for improving skin dryness, skin moisturizing, or skin barrier strengthening, characterized in that it increases the gene expression of factors related to moisturizing and skin barrier function, and reduces the activity of moisturizing factor degrading enzymes.

The cosmetic composition containing the mixed extract of round knotweed and cotton bat according to the present invention as an active ingredient contains a natural plant extract and is safe, and exhibits excellent skin moisturizing and skin barrier function strengthening effects by its synergistic action.

Hereinafter, the present invention will be described in more detail.

Round knotweed ( Kummerowia stipulacea ) is a plant of the legume family (Fabaceae) and is an annual herb that grows wild along roadsides and clearings throughout Korea. Stems grow obliquely, and branches are often branched from the bottom. The stem is 10-30 cm high, with curved hairs pointing upwards. The leaves are alternate phyllotaxis and are compound leaves with three small leaves. Small leaves are broadly obovate. Flowers bloom 1-2 each in the leaf axil in July-September, and are shaped like a red-purple butterfly. There are 4 sepals at the bottom of the calyx, and one is particularly small, ovate, and has 1-3 lines. The calyx is bell-shaped and is shallowly divided into 5 parts. The fruit is a conifer, oval in shape, and contains one seed (National Institute of Biological Resources, 2016). Prior to the present invention, the whitening and antioxidant effects of the round knotweed were known through Republic of Korea Patent No. 10-1248101, 'cosmetic composition for whitening and antioxidant comprising extracts of round knotweed and rhododendron extract'.

Tephroseris kirilowii is a perennial plant of the Asteraceae family and commonly grows in sunny mountainous areas and grasslands throughout Korea. There are a lot of cobweb-like fluff all over. The stem is upright, and the height is 20-70cm. Root leaves are gathered in several sheets and remain when flowers bloom, and are oval, 5-10 cm long, and 1.5-2.5 cm wide. Stem leaves get smaller as they go up, and the lower part wraps around the stem a little. The flowers are yellow in April-May with 3 to 9 head-shaped flowers forming co-corystals. The peduncle is 2-5 cm long. Head-shaped flowers are 3-4cm in diameter and have tongue-shaped flowers on the edge. The collected flower wrappers are in the shape of a barrel and are about 8mm long. Fruits are aquatic and ripen in July-August, cylindrical, with many hairs. It is similar to the water bat, which is mainly grown in high-altitude mountainous areas, in that the flowers are yellow and the clusters are green. The young leaves are edible, and the flowers are medicinal (National Institute of Biological Resources, 2016).

According to an embodiment of the present invention, the round knotweed and cotton bat mixed extract is prepared as follows. First, the dried round knot glue and cotton bat are mixed in a weight ratio of 1-3:1-3, respectively. In this case, at least one selected from the group consisting of outposts, roots, flowers, leaves and stems of round knotweed and cotton bats is used.

Then, in the mixture, water, anhydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol, butylene glycol, caprylic/capric triglyceride, dimethicone, mineral oil, cyclomethicone, It is prepared by adding at least one solvent selected from the group consisting of octyldodecanol, cetylethylhexanoate, trirecylhexanoin, isopropyl myristate and vegetable oil, followed by extraction and filtration according to a conventional method.

It may be extracted by mixing the round knot grass and cotton bat, which are the extracts, or may be mixed after preparing each extract. At this time, the round knot grass and the cotton bat can be extracted by mixing in a weight ratio of 1 to 3:1 to 3, respectively, preferably in a weight ratio of 2 to 3:1 to 3, more preferably 2 to It is extracted by mixing in a weight ratio of 3:1.

In the case of preparing the extract by mixing the cotton ball with the round knot grass, the skin moisturizing and skin barrier strengthening effects were more excellent at the same dose compared to the case of the round knot grass or the cotton ball extract alone. Therefore, it was confirmed that when they were mixed, they showed a synergistic effect in improving skin function.

The extract of the present invention, the mixed extract of Knotweed and cotton bat, increased the gene expression of factors related to skin moisturizing and skin barrier function by synergistic action without affecting the survival rate of skin-derived cell lines (Test Example 1) ( Test Example 2), the activity of hyaluronic acid degrading enzyme was inhibited (Test Example 3). In addition, this mixed extract showed formulation stability at room temperature, refrigeration, and constant temperature conditions when applied to serum and cream formulations (Test Example 4). Therefore, the cosmetic composition can be usefully used as a cosmetic for moisturizing the skin or strengthening the skin barrier.

As an active ingredient, the mixed extract is contained in an amount of 0.1 to 10% by weight based on the total weight of the cosmetic composition.

The cosmetic composition of the present invention may be prepared in any conventionally prepared formulation, for example, lotion, cream, essence, cleansing foam, cleansing water, pack, body lotion, body oil, body gel, shampoo, conditioner, hair conditioners, hair gels, foundations, lipsticks, mascaras, makeup bases, and the like.

[Example]

Hereinafter, to help the understanding of the present invention, examples will be described in detail. However, the following examples are only illustrative of the contents of the present invention, and the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those of ordinary skill in the art.

Preparation Examples 1 to 2: Preparation of round knotweed or cotton bat extract

Add 5 times the weight of 70% hydrous ethanol as an extraction solvent to the dried round knotweed or a cotton bat, and heat it in an extractor equipped with a cooling condenser (Cosmos-660, Kyungseo Machinery) at 80℃~100℃ to extract a total of 3 times for 2 hours each. did

After extraction by the above method, the mixture was left at room temperature for 3 days, and the precipitate was filtered with 300 mesh filter paper, and the precipitate was filtered twice with Edventec No. 5 filter paper and Whatman GFC 150 mm filter paper to prepare an extract.

Examples 1 to 7: Preparation of a mixed extract of round knotweed and cotton bat

Add 5 times the weight of 70% hydrous ethanol as an extraction solvent to 100 g of a mixture of dried round knotweed and a cotton bat in the weight ratio shown in Table 1 below, and heat in an extractor equipped with a cooling condenser (Cosmos-660, Kyungseo Machinery) at 80-100 ° C. It was heated with a furnace and extracted a total of 3 times for 2 hours each.

After extraction by the above method, the mixture was left at room temperature for 3 days, and the precipitate was filtered with 300 mesh filter paper, and the precipitate was filtered twice with Edventec No. 5 filter paper and Whatman GFC 150 mm filter paper to prepare a mixed extract.

weight ratio round knot cotton bat Example 1 One One Example 2 One 2 Example 3 One 3 Example 4 2 One Example 5 2 3 Example 6 3 One Example 7 3 2

Test Example 1: Confirmation of cytotoxicity

To check for cytotoxicity, HaCaT, a human keratinocyte, was cultured in DMDM medium supplemented with 10% FBS (fetal bovne serum), and inoculated at a cell concentration of 1×10 ⁵ in a 96 well plate at 37°C, 5% CO ₂ Incubated for 24 hours in an incubator. After culturing, the medium was removed and the extracts prepared in Preparation Examples and Examples were treated with a diluted solution prepared by diluting the extracts in dimethyl sulfoxide to have a sample concentration of 0.01, 0.1, and 1%, followed by incubation for 24 hours, followed by MTT (3- [4,5-dimethylthiazol-2yl] - 2,5-diphenyltetrazoliumboramide, Sigma, USA) solution was added to each well by 100 ml (3 mg/ml) and incubated for 4 hours more. Thereafter, the supernatant was removed, 150 μl of dimethyl sulfoxide was added, and the resulting formazan was dissolved by shaking for 30 minutes, and absorbance was measured at 540 nm using a multimicroplate reader (Molecular device Spectra max190). Cell viability was calculated according to the following formula, and the results are shown in Table 2 below.

Cell viability (%) = absorbance of the sample added group / absorbance of the control group × 100

division Cell viability (%) 0.01% 0.1% One % Preparation Example 1 98 100 99 Preparation 2 101 103 97 Example 1 100 98 96 Example 2 101 101 99 Example 3 103 102 100 Example 4 100 100 98 Example 5 102 101 100 Example 6 103 102 97 Example 7 102 100 100

As shown in the results of Table 2 above, it was confirmed that the cytotoxicity was not affected, and there was no problem with safety as the cell viability of more than 95% in the HaCaT cell line was confirmed for all of the round knotweed extracts or cotton bat extracts and their mixed extracts. did

Test Example 2: Confirmation of skin moisturizing and skin barrier-related gene expression increase effect

HaCaT was cultured in DMDM medium supplemented with 10% FBS, and inoculated at a cell concentration of 5×10 ⁵ in a 12 well plate, and cultured at 37° C., 5% CO ₂ in an incubator for 24 hours. After processing Preparation Examples and Examples, the cells were further cultured for 24 hours, then RNA was isolated from the cells, and cDNA synthesis and RT-PCR were performed. In order to check the difference in expression of hyaluronan synthase-3 (HAS-3), involucrin (IVN) and transglutaminase-1 (TG-1) genes, house keeping GAPDH was used as a gene.

The primer sequences of each gene are shown in Table 3. Oligo the extracted RNA as a template, use dT-adaptor primer (Oligo dT-adaptor primer) and DEPC water to make a total amount of 15 μl. After denaturing at 70° C. for 10 minutes, reverse transcription of M-MLV (Moloney murine leukemia virus) RNA is performed. cDNA was synthesized at 42°C for 60 minutes and at 70°C for 15 minutes. The synthesized cDNA was amplified through PCR reaction, and the total reaction solution was 25 μl. The final concentrations of each reaction were 100 pmol of primer, 1.0 μM, 0.2 mM of dNTP mixture, 1×1.5 mM of 5× green or colorless GoTaq Reaction buffer, 1×1.5 mM of MgCl ₂ (PCR buffer) and 1.25 units of GoTaq DNA polymerase. The PCR reaction conditions for denaturation, annealing and extension are as follows, 95 ℃ 2 min, 95 ℃ 30 sec, 60 ℃ 30 sec, 72 ℃ 1 min, 72 ℃ 5 min, 30-40 cycles were performed. After the PCR reaction, 10 μl of the product was electrophoresed on a 2% agarose gel. The expression level was confirmed using the Gel Documentation system (Korea Labtech, Cat. No DGS-200D), and the HAS-3 expression increase rate was calculated according to the following formula, and the results are shown in Tables 4 to 6 below.

Gene expression increase rate (%) = (gene expression amount of sample addition group / gene expression amount of control group) × 100

Primer name base sequence GAPDH Forward: GGCATTGCTCTCAATGACAA Reverse: TGTGAGGGAGATGCTCAGTG HAS-3 Forward: CCCAGCCAGATTTGTTGATG Reverse: AGTGGTCACGGGTTTCTTCC Involucrin Forward: ACCTAGCGGACCCGAAATAA Reverse: TGGAACAGCAGGAAAAGCAC TG-1 Forward: TGATCGCATCACCCTTGAGT Reverse: GTAGATCTCATTGCGGGGGT

division HAS-3 expression increase rate (%) 0.1% One % Preparation Example 1 7 11 Preparation 2 6 13 Example 1 19 25 Example 2 17 26 Example 3 19 26 Example 4 31 48 Example 5 26 37 Example 6 38 53 Example 7 24 38

division IVN expression increase rate (%) 0.1% One % Preparation Example 1 10 15 Preparation 2 8 14 Example 1 21 30 Example 2 19 28 Example 3 23 33 Example 4 42 59 Example 5 35 47 Example 6 51 67 Example 7 36 47

division TG-1 expression increase rate (%) 0.1% One % Preparation Example 1 7 13 Preparation 2 9 14 Example 1 15 24 Example 2 18 26 Example 3 17 26 Example 4 46 59 Example 5 29 39 Example 6 58 67 Example 7 31 40

As can be seen in Tables 4 to 6 above, it was possible to confirm the excellent effect of increasing HAS-3, IVN and TG-1 expression in the examples of the mixed extracts rather than the preparation examples, which are individual extracts of round knotweed or cotton bat, and in particular, More excellent efficacy was confirmed in Examples 4-7. Among them, Example 6 was the most effective.

Test Example 3: Confirmation of the activity inhibitory effect of hyaluronidase

The inhibitory effect of hyaluronidase activity was confirmed as follows by applying the Morgan-Elson method. The final enzymatic activity of hyaluronidase was 400 NF unit/ml, and the final concentration of HA was 0.4 mg/ml, and Compound 48/80 buffer solution (0.1 mg/ml) was used as an activator as an inactive hyaluronan. The hyaluronidase activity was measured with a focus on the inhibitory action of the activation step of the nidase. The sample was dissolved in a buffer solution as a sample solution, and a buffer solution was used for the control group instead of the sample solution. As a control, hyaluronic acid was used. The activity inhibition rate (%) of hyaluronidase was calculated by the following equation, and the results are shown in Table 7.

Hyaluronidase activity inhibition rate (%) = [(Enzyme activity of control group - Enzyme activity of sample addition group) / Enzyme activity of control group] × 100

division Hyaluronidase activity inhibition rate (%) 0.1% One % Preparation Example 1 14 23 Preparation 2 18 24 Example 1 27 40 Example 2 29 38 Example 3 27 37 Example 4 46 60 Example 5 38 45 Example 6 52 71 Example 7 36 48 Hyaluronic acid 63 74

As can be seen in Table 7 above, it was possible to confirm the excellent efficacy of inhibiting hyaluronidase enzyme activity in the examples of the mixed extracts rather than the preparation examples, which are individual extracts of round knotweed or cotton bats, especially in Examples 4 to 7 Better efficacy could be confirmed.

Example 8: Preparation of a serum containing a mixed extract of round knotweed and cotton bat

A serum containing the mixed extract of Example 6 was prepared according to a conventional method with the composition and content of Table 8 below.

Raw material content (wt%) Round knotweed and cotton bat mixed extract (Example 6) 1.0 beeswax 1.0 Polysorbate 60 1.5 Sorbitan Sesquiolate 0.5 mineral oil 10.0 Sorbitan Stearate 0.5 lipophilic monostearate glycerin 1.0 stearic acid 1.5 Glyceryl Stearate/PEG-400 Stearate 1.0 propylene glycol 3.0 carboxy polymer 0.1 triethanolamine 0.1 Phenoxyethanol appropriate amount Purified water To 100

Example 9: Preparation of cream containing a mixture of round knotweed and cotton bat extract

A cream containing the mixed extract of Example 6 was prepared according to a conventional method with the composition and content of Table 9 below.

Raw material content (wt%) Round knotweed and cotton bat mixed extract (Example 6) 1.0 shea butter 2.0 Polysorbate 60 1.5 Sorbitan Sesquiolate 0.8 mineral oil 10.0 dimethicone 3.0 Sorbitan Stearate 0.5 lipophilic monostearate glycerin 1.0 cetearyl alcohol 2.0 Glyceryl Stearate/PEG-400 Stearate 1.0 propylene glycol 3.0 carboxy polymer 0.25 triethanolamine 0.25 Phenoxyethanol appropriate amount Purified water To 100

Test Example 4: Formulation stability confirmation

For the formulations prepared in Examples 8 and 9, in an opaque glass container in a room, refrigerator and incubator maintained at room temperature (25 ° C), refrigeration (4 ° C) and constant temperature (50 ° C) at constant temperature for 12 and 24 weeks Storage and observation (discoloration, discoloration and separation), and stability was confirmed. The results are shown in Table 10.

temperature condition Stability check (discoloration, discoloration and separation) Example 8 Example 9 Room temperature (25°C) 0 0 Refrigeration (4℃) 0 0 constant temperature (50℃) 0 0

< Formulation stability grade >

0: No change 1: Minor change 2: Change 3: Extreme change

As shown in Table 10, it was confirmed that all formulations of Examples 8 and 9 did not show discoloration, discoloration and separation under the temperature conditions of 25°C, 4°C and 0°C, and were stable.

Claims (5)

A cosmetic composition for skin moisturizing or skin barrier strengthening, containing 0.1 to 10% by weight of the round knotweed and cotton bat mixed extract as an active ingredient based on the total weight of the cosmetic composition. [Claim 2] The for skin moisturizing or skin barrier strengthening according to claim 1, wherein the round knotweed and cotton bat mixed extract is prepared by mixing round knotweed and cotton bat in a weight ratio of 1 to 3:1 to 3, respectively. cosmetic composition. According to claim 1, wherein the mixed extract is water, anhydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol, butylene glycol, caprylic / capric triglyceride, dimethicone, minerals Skin, characterized in that it is prepared by extraction with at least one solvent selected from the group consisting of oil, cyclomethicone, octyldodecanol, cetylethylhexanoate, trirethylhexanoin, isopropyl myristate, and vegetable oil A cosmetic composition for moisturizing or strengthening the skin barrier. delete delete