KR102233413B1 - Primer set for detecting SFTS virus and kit for diagnosing SFTS using the same - Google Patents

Abstract

The present invention relates to a primer set for detecting SFTS virus, a kit for diagnosing severe febrile thrombocytopenia using the same, and a method of providing information for diagnosis of severe febrile thrombocytopenia syndrome using the same.
When using the primer set for detecting SFTS virus of the present invention and a kit for diagnosing severe febrile thrombocytopenia using the same, severe febrile thrombocytopenia syndrome can be quickly diagnosed with very high sensitivity and accuracy.

Description

Primer set for detecting SFTS virus and kit for diagnosing SFTS using the same}

The present invention relates to a primer set for detecting SFTS virus, a kit for diagnosing severe febrile thrombocytopenia using the same, and a method of providing information for diagnosis of severe febrile thrombocytopenia syndrome using the same.

Severe fever with thrombocytopenia syndrome (SFTS) is a serious disease with symptoms such as high fever, vomiting, diarrhea, thrombocytopenia, reduced white blood cells, and multiple organ failure, with a mortality rate of 6-30%. The virus that causes SFTS is an RNA virus belonging to the genus Phlebovirus of the Bunyaviridae family, and was first reported in China in 2009.

The SFTS virus (SFTSV) is known to be widely spread in Korea as a medium of small small mites (Haemaphysalis longicornis). In addition, seroconversion and viremia of the SFTS virus have been found in breeding animals such as goats, sheep, cattle, pigs and dogs, and these animals are also thought to act as intermediate vectors in the area where the SFTS virus is spread.

Small ticks and wild animals, which are carriers of the SFTS virus, are spreading and inhabiting all over the country, and as outdoor activities such as hiking and walking around the road are increasing, the risk of infection with the SFTS virus is increasing, and the incidence of domestic patients is also increasing. .

Scrub typhus (ST) is caused by the causative agent, Orientia tsutsugamushi (OT), and 1 million cases are reported annually in the Asia-Pacific region. In Korea, 5000-6000 cases have been reported annually since 2005, and the prevalence has increased, resulting in 9513 cases in 2015. These clinical symptoms of tsutsugamushi disease substantially overlap with those of SFTS.

On the other hand, the most common tick-borne diseases in Korea are extreme fever accompanied by tsutsugamushi disease and SFTS. It is essential to distinguish between SFTS and tsutsugamushi disease early in the emergency room, but it is difficult due to overlapping dynamics, common risk factors, and similar clinical symptoms.

Accordingly, there is a need to develop a primer set capable of detecting SFTS virus with high accuracy and a kit for diagnosing severe febrile thrombocytopenia syndrome using the same.

KR 10-2015-0042419 A

Shin Y, et al., Real-time, label-free isothermal solid-phase amplification/detection (ISAD) device for rapid detection of genetic alteration in cancers. Lab Chip 2013;13:2106-14 Koo B, et al., An isothermal, label-ree, and rapid one-step RNA amplification/detection assay for diagnosis of respiratory viral infections. Biosens Bioelectron 2017;90:187-94

An object of the present invention is to provide a primer set for detecting SFTS virus contained in a biological sample with high sensitivity and accuracy.

Another object of the present invention is to provide a composition for detecting SFTS virus with high sensitivity and accuracy.

Another object of the present invention is to provide a kit for diagnosing severe febrile thrombocytopenia syndrome with high sensitivity and accuracy.

Another object of the present invention is to provide information for diagnosis of severe febrile thrombocytopenia syndrome, comprising the step of detecting the SFTS virus in an isolated biological sample of an individual suspected of having severe febrile thrombocytopenia using the primer set. Is to provide a way.

In order to achieve the above object, the present invention includes at least one primer pair selected from the group consisting of a primer pair of SEQ ID NOs: 1 and 2, a primer pair of SEQ ID NOs: 4 and 5, and a primer pair of SEQ ID NOs: 13 and 14. It provides a primer set for detecting SFTS virus.

In an embodiment of the present invention, at least one primer pair selected from the group consisting of the primer pairs of SEQ ID NOs: 1 and 2, and the primer pairs of SEQ ID NOs: 4 and 5 is for real-time polymerase chain reaction. reaction, real-time PCR).

In an embodiment of the present invention, the primer pairs of SEQ ID NOs: 13 and 14 are for isothermal nucleic acid amplification reaction (Isothermal Nucleic acid Amplification), silicon resonator sensor (Silicon Microring Resonator; SMR) or iNAD (Isothermal Nucleic acids Amplification and Detection).

In addition, the present invention provides a composition for detecting an SFTS virus comprising the primer set and the probes of SEQ ID NO: 3 and SEQ ID NO: 6.

In addition, the present invention provides a composition for detecting SFTS virus comprising a primer set consisting of the primer pairs of SEQ ID NOs: 13 and 14.

In addition, the present invention is a severe heat thrombocytopenia comprising at least one primer pair selected from the group consisting of the primer pairs of SEQ ID NOs: 1 and 2, the primer pairs of SEQ ID NOs: 4 and 5, and the primer pairs of SEQ ID NOs: 13 and 14 Provides a syndrome diagnostic kit.

In addition, the present invention provides a diagnostic kit for severe febrile thrombocytopenia syndrome comprising the composition for detecting the SFTS virus.

In one embodiment of the present invention, the severe febrile thrombocytopenia syndrome may be caused by the SFTS virus.

In one embodiment of the present invention, the primer pair may be to detect the SFTS virus in a biological sample.

In one embodiment of the present invention, the biological sample may be blood or a small small mite to be diagnosed.

In addition, the present invention provides a method of providing information for diagnosis of severe febrile thrombocytopenia syndrome, comprising the step of detecting the SFTS virus in an isolated biological sample of an individual suspected of having severe febrile thrombocytopenia using the primer set. to provide.

In addition, the present invention (a) using the primer set, PCR, real-time PCR (real-time PCR; RT-PCR), reverse transcriptase PCR (reverse transcriptase PCR), isothermal nucleic acid amplification using the primer set amplifying using at least one selected from the group consisting of (isothermal nucleic acid amplification), a silicon microring resonator (SMR), and iNAD (Isothermal Nucleic Acids Amplification and Detection); And (b) it provides a method for detecting the SFTS virus comprising the step of detecting the amplification product.

In the case of using the primer set for detecting SFTS virus of the present invention, the composition for detecting SFTS virus, and the diagnostic kit for severe febrile thrombocytopenia syndrome using the same, severe febrile thrombocytopenia syndrome can be quickly diagnosed with very high accuracy.

1 is a schematic diagram showing an experiment plan for an embodiment of the present invention.
2 is a schematic diagram showing the principle of iNAD according to an embodiment of the present invention.
3 is an amplification plot curve according to the TaqMan probe-based real-time PCR of the present invention. Specifically, FIG. 3A is an M segment of SFTSV, FIG. 3B is an S segment of SFTSV, and FIG. 3C is an amplification plot curve for Tsutsugamushi.
FIG. 4 is for confirming the detection limit of the Taqman probe-based real-time PCR for SFTSV and O. tsutsugamushi , and the upper side of FIG. 4 shows the standard curve according to the TaqMan probe-based real-time PCR for SFTSV or Tsutsugamushi. It is a graph, and the lower side of FIG. 4 is a distribution diagram showing Cycle threshold (CT) values of all serum samples analyzed by Taqman probe-based real-time PCR. In addition, FIG. 4A is an experiment result for the M segment of SFTSV, FIG. 4B is an experiment result for the S segment of SFTSV, and FIG. 4C is an experiment result for Tsutsugamushi.
FIG. 5 is to confirm the detection limit of iNAD against SFTSV and O. tsutsugamushi , and the upper side of FIG. 5 is a resonance on the copy number of the transcript RNA and control DNA of the synthetic transcript of iNAD against SFTSV or tsutsugamushi. It is a graph showing the wavelength shift (picometer), and the lower side of Fig. 5 is a distribution diagram showing the change in resonance wavelength of all serum samples analyzed by iNAD. In addition, FIG. 5A is an experiment result for the S segment of SFTSV, and FIG. 5B is an experiment result for Tsutsugamushi.
6 is a graph showing a standard curve according to real-time PCR based on SYBR Green for SFTSV or Tsutsugamushi. FIG. 6A is a standard curve for Tsutsugamusi, and FIG. 6B is a standard curve for SFTSV.

Hereinafter, the present invention will be described in detail.

First, the present invention comprises at least one primer pair selected from the group consisting of a primer pair of SEQ ID NOs: 1 and 2, a primer pair of SEQ ID NOs: 4 and 5, and a primer pair of SEQ ID NOs: 13 and 14, SFTS virus detection Provides a set of primers for use. These primer pairs can be used to detect SFTS virus, which is the cause of severe febrile thrombocytopenia syndrome.

At least one primer pair selected from the group consisting of the primer pairs of SEQ ID NOs: 1 and 2, the primer pairs of SEQ ID NOs: 4 and 5, and the primer pairs of SEQ ID NOs: 13 and 14 is SFTS that causes severe fever thrombocytopenia syndrome. It is a DNA having a sequence complementary to the S segment of the virus (SFTS virus, SFTSV) genome. The S segment of the SFTS viral genome is a highly conserved site among viruses belonging to Bunyaviridae. The primer set of the present invention can quickly detect SFTS virus and its various variants with high accuracy. The SFTS virus genome in the present invention means the genome of the SFTS virus or its cDNA sequence.

Among the primer pairs, at least one primer pair selected from the group consisting of the primer pairs of SEQ ID NOs: 1 and 2, and the primer pairs of SEQ ID NOs: 4 and 5 is for real-time polymerase chain reaction (real-time polymerase chain reaction, real-time polymerase chain reaction). -time PCR).

In addition, among the primer pairs, the primer pairs of SEQ ID NOs: 13 and 14 are for isothermal nucleic acid amplification reaction (Isothermal Nucleic acid Amplification), for silicon microring resonator (SMR), or for iNAD (Isothermal Nucleic acids Amplification and Detection) can be used.

The iNAD is an analysis method in the form of combining the silicon microring resonator (SMR) and recombinant polymerase amplification (RPA) (see FIG. 1). The SMR sensor is a refractive index-based optical sensor that changes the resonant properties in response to the binding between the target and the ligand; This enables very sensitive and label-free real-time detection of biomolecules near the sensor. RPA creates a complex of primers and recombinant enzymes, which extends DNA and eliminates the need for nucleic acid polymerases and repeat cycles.

According to an embodiment, for iNAD analysis, it is desirable to covalently bind one primer to the surface of the photosensor, put the other primer in a solution, and maintain the temperature at 38°C (in the case of DNA) or 43°C (in the case of RNA). . In the case of RNA, the RPA-RT reaction mixture contains reverse transcriptase, which converts the RNA template into DNA. Accordingly, cDNA can be obtained from the viral RNA template by the RPA-RT reaction. In addition, the cDNA is hybridized with the immobilized primers on the amine-modified SMR surface, and then the amplification of the target nucleic acid is initiated from the RPA-RT reaction mixture. The obtained amplification product can be detected with a primer grafted onto the sensor surface in an unlabeled real-time manner (FIG. 2).

In addition, the severe fever thrombocytopenia syndrome diagnostic kit of the present invention includes at least one primer selected from the group consisting of a primer pair of SEQ ID NOs: 1 and 2, a primer pair of SEQ ID NOs: 4 and 5, and a primer pair of SEQ ID NOs: 13 and 14. Includes a pair.

The diagnostic kit of the present invention can diagnose severe febrile thrombocytopenia syndrome with very high accuracy.

According to an embodiment of the present invention, in the case of a diagnostic kit including two or more primer pairs, diagnosis using each primer pair may be performed separately, or diagnosis using a combination of a plurality of primer pairs in one reaction This may be done.

The SFTS virus in the present invention may be an RNA virus belonging to the genus Phlebovirus of the Bunyaviridae family. For example, the SFTS virus HB29 strain belonging to Bunyavirus and similar strains may be included.

The primer pair of SEQ ID NO: 1 and 2, the primer pair of SEQ ID NO: 4 and 5, or the primer pair of SEQ ID NO: 13 and 14 can detect the SFTS virus in the biological sample.

The primer pairs of SEQ ID NOs: 1 and 2, and/or the primer pairs of SEQ ID NOs: 4 and 5 can be used in a polymerase chain reaction (PCR) to determine whether a biological sample contains SFTS virus. have. The polymerase chain reaction in the present invention is a general polymerase chain reaction, a reverse transcription polymerase chain reaction (RT-PCR), and a real-time polymerase chain reaction (real-time PCR). And the like.

In addition, the primer pairs of SEQ ID NOs: 13 and 14 are silicon isothermal nucleic acid amplification, a resonator sensor (Silicon Microring Resonator; SMR), and iNAD ( Isothermal Nucleic acids Amplification and Detection).

According to an embodiment, in addition to the above primers, the diagnostic kit of the present invention may further include reaction reagents such as reverse transcriptase, polymerase, cDNA template for polymerase chain reaction, and buffer.

According to an embodiment, the diagnostic kit of the present invention can be used for general polymerase chain reaction or real-time polymerase chain reaction. In this case, reverse transcription through the action of reverse transcriptase from the RNA genome of SFTS virus ) The reaction is performed separately to obtain cDNA, which can be used as a template for polymerase chain reaction. According to another embodiment, the diagnostic kit of the present invention may be used for a one-step reverse transcription polymerase chain reaction (RT-PCR) that continuously performs a reverse transcription reaction and a polymerase chain reaction.

The result of polymerase chain reaction can be separated by methods such as agarose gel electrophoresis or capillary electrophoresis, and DNA having a length corresponding to the polymerized DNA by the primer pair used. Severe fever thrombocytopenia syndrome can be diagnosed by checking the presence of

Phylogenetic analysis may also be performed to detect the result of reverse transcription polymerase chain reaction for RNA of highly conserved S segment of SFTS virus.

When the diagnostic kit is used for real-time polymerase chain reaction, a probe including an SFTS virus-specific sequence may be additionally used. It is preferable to prepare each probe to suit the use of each primer pair. For example, each probe preferably includes a sequence corresponding to a portion of a DNA segment amplified by a pair of primers to be used with the probe. Each probe may have a fluorescent material bound to the 5'end and a quencher bound to the 3'end. According to a more specific embodiment, a fluorescent material emitting a specific wavelength such as red, green, blue, etc. may be coupled to the 5'end of each probe, and a black hole quencher (BHQ) may be coupled to the 3'end. have. When the fluorescent substance and the quencher are bound to the probe, the fluorescent signal is not detected because the quencher absorbs the light emitted by the fluorescent substance. On the other hand, when the fluorescent substance bound by the exonuclease activity of the DNA polymerase is separated during the DNA synthesis and extension process, the fluorescent signal can be detected. While the polymerase chain reaction is in progress, such a fluorescence signal can be measured in real time, and the presence or absence of a virus can be determined based on the increased fluorescence signal. The use of such a probe can be usefully used for real-time polymerase chain reaction.

The biological sample in the present invention may be a subject suspected of being infected with the SFTS virus (ie, a subject requiring confirmation of whether or not infected with the SFTS virus), and a body fluid or tissue sample collected from the subject. For example, the biological sample may be an animal including humans, wild animals, livestock, companion animals, and the like, and a body fluid or tissue sample collected therefrom. The body fluid may be blood. In addition, for example, the biological sample may be a mite and an insect, and the mite may be a small small mite. According to a specific embodiment of the present invention, the biological sample may be blood or serum to be diagnosed, and may also be a small mite. Blood in the present invention includes blood and substances derived therefrom (eg, serum, etc.).

The RNA of the SFTS virus may be extracted from blood and serum of patients and their families suspected of severe febrile thrombocytopenia syndrome, or from ticks. RNA extraction may be performed using a variety of methods known to those of ordinary skill in the art (hereinafter referred to as'the person skilled in the art') to which the present invention belongs. The extracted RNA can be stored at -70 °C.

According to an embodiment, when SFTS virus is present in a biological sample, a primer capable of amplifying the S segment portion of the RNA genome of SFTSV and a reverse transcription reaction through the action of a reverse transcriptase are used in the biological sample. CDNA for the existing SFTS viral genome can be synthesized.

According to an embodiment, the reverse transcription reaction of the present invention may be performed at a temperature of 40° C. to 50° C. for 20 minutes to 40 minutes. According to a more specific embodiment, the reverse transcription reaction of the present invention may be performed at a temperature of 45° C. for 30 minutes.

After the reverse transcription reaction is completed, the reaction product of the reverse transcription reaction may be heated at a temperature of 85° C. to 95° C. for 5 to 20 minutes to inactivate the reverse transcriptase. According to a more specific embodiment, the reverse transcriptase may be inactivated by heating the reaction product of the reverse transcription reaction at a temperature of 90° C. for 10 minutes.

Using the synthesized cDNA as a template, the action of the primer pair of the SFTS virus and the DNA polymerase and the primer pair of SEQ ID NOs: 1 and 2, the primer pair of SEQ ID NOs: 4 and 5, or the primer pair of SEQ ID NOs: 13 and 14 As a result, at least a portion of the SFTS virus cDNA can be amplified through a polymerase chain reaction.

According to one embodiment, the polymerase chain reaction of the present invention is denatured by heating at 85°C to 95°C for 5 to 30 seconds and then heating at 40°C to 65°C for 15 to 60 seconds to elongate 35 to 55 cycles. It can be done repeatedly. According to a more specific embodiment, the polymerase chain reaction of the present invention may be performed by heating at 90° C. for 15 seconds to denature and then heating at 48° C. for 30 seconds to elongate 45 cycles.

The severe febrile thrombocytopenia syndrome diagnostic kit of the present invention may be to separately perform a reverse transcription reaction and a polymerase chain reaction by preparing a separate reaction mixture, and also preparing one reaction mixture to perform a one-step reverse transcription polymerase chain reaction. It may be to perform a reaction (one-step RT-PCR). According to an embodiment of the present invention, the reaction mixture (mix) of the one-step reverse transcription polymerase chain reaction includes 8 µl of One-step RT-PCR premix including reverse transcriptase, polymerase, and buffer, and primers. It may consist of 7 µl of a detection solution and 5 µl of an RNA template containing RNA obtained from a biological sample (total volume of 20 µl).

According to an embodiment, the one-step reverse transcription polymerase chain reaction may be carried out under the following conditions: 45° C. for 30 minutes (1 cycle), 90° C. for 10 minutes (1 cycle) and 95° C. for 15 seconds and 48° C. In 30 seconds (45 cycle).

The diagnostic kit of the present invention may further include an internal control. If the SFTS virus does not exist in the biological sample, gene amplification does not occur. In order to distinguish between this case and the case where gene amplification does not occur due to a problem in the polymerase chain reaction itself, a foreign gene that does not exist in the SFTS virus is specified. An internal control including a primer pair to be amplified and the corresponding foreign gene DNA may be used. Through the amplification of the internal control, the effectiveness of the polymerase chain reaction process can be confirmed.

The diagnostic kit of the present invention is not limited to a specific form, and may be implemented in various forms. According to an embodiment, the diagnostic kit may include a lyophilized primer contained in a container (eg, a disposable PCR tube, etc.). When two or more primer pairs are included, a plurality of primer pairs may be mixed and contained in a PCR tube, or each primer pair may be individually contained in each PCR tube. For example, a disposable PCR tube containing at least one primer pair selected from the group consisting of a primer pair of SEQ ID NOs: 1 and 2, a primer pair of SEQ ID NOs: 4 and 5, and a primer pair of SEQ ID NOs: 13 and 14 in a freeze-dried powder form May be included in the diagnostic kit.

In addition, according to an embodiment of the present invention, the diagnostic kit may include reverse transcriptase, polymerase, and buffer. Reverse transcriptase, polymerase, and buffer may be contained in separate containers, and a mixture of reverse transcriptase and polymerase may be contained in one container, and a buffer may be contained in a separate container, or reverse transcriptase, polymerase, and buffer may be contained. They may all be mixed and put in one container.

According to another embodiment, in the diagnostic kit of the present invention, a reaction mixture including the above primers, reverse transcriptase, polymerase, and buffer may be contained in a container (eg, a disposable PCR tube) in a liquid form. It can be stored frozen and used after thawing if necessary. In the case of such a diagnostic kit, since a separate mixing process is not required except for adding a biological sample during diagnosis, convenience and speed of diagnosis may be increased.

In another aspect, the present invention comprises the step of detecting the SFTS virus in an isolated biological sample of an individual suspected of severe febrile thrombocytopenia using the primer set, of information for diagnosis of severe febrile thrombocytopenia syndrome. Provide a method of delivery.

The detecting of the SFTS virus in the biological sample may include amplifying a target nucleic acid contained in the sample; And detecting the amplification product.

The step of amplifying the target nucleic acid is not particularly limited as long as it is a method capable of amplifying the target nucleic acid, but PCR, real-time PCR (RT-PCR), reverse transcriptase PCR, isothermal nucleic acid amplification ( Isothermal nucleic acid amplification), a silicon microring resonator (SMR), and iNAD (Isothermal Nucleic Acids Amplification and Detection) can be used to amplify a target nucleic acid. The iNAD is an analysis method in the form of combining the silicon microring resonator (SMR) and recombinant polymerase amplification (RPA) (see FIG. 2).

The nucleic acid is not particularly limited, but may be any DNA or RNA, and may be chromosomal DNA, mitochondrial DNA, mRNA, rRNA, tRNA, miRNA, and the like present in cells.

The amplified product above can be detected by a method known in the art, for example, gel electrophoresis, ELGA (enzyme-linked gel assay), ECL (electrochmiluminescent), fluorescent substance, radiation Isotopes, etc. can be used.

The fluorescent material is a rhodamine system including rhodamine, TAMRA, and the like; Fluorescein, including fluorescein, fluorescein isothiocyanate (FITC), and fluorecein amidite (FAM); Bodipy (boron-dipyrromethene); Alexa fluor; And a fluorescent material such as cyanine including Cy3, Cy5, Cy7, and indocyanine green, but is not limited thereto.

In addition, the radioactive isotopes include H-3, C-14, P-32, S-35, Cl-36, Cr-51, Co-57, Co-58, Cu-64, Fe-59, Y- 90, I-124, I-125, Re-186, I-131, Tc-99m, Mo-99, P-32, CR-51, Ca-45, Ca-68, etc. can be used, but are particularly limited thereto. It doesn't work.

In the present invention, the term "biological sample" may include tissues, cells, whole blood, serum, plasma, etc. isolated from a subject to be diagnosed, but is not limited thereto.

Hereinafter, a primer pair according to the present invention and a diagnostic kit using the same will be described in detail with reference to examples.

Example

Collection and processing of biological samples

From 2015 to 2016, adult patients suspected of tick-borne illness were enrolled prospectively and blood samples were collected at the Asan Medical Center, a tertiary hospital with 2,700 beds in Seoul. .

About 8 mL of blood collected from the patient was put into an EDTA tube, and then centrifuged at 1200 g for 10 minutes to obtain plasma. Each 500 µl of plasma was dispensed into a 1.5 mL microcentrifuge tube, and stored at -80°C until experimentation. DiaStar 2X OneStep RT-PCR Pre-Mix Kit (SolGent) was used to detect viral RNA by RT-PCR to confirm the infection of SFTSV by transferring a bottle of plasma (500 µl) to the Korea Centers for Disease Control and Prevention. Control). The remaining plasma was stored at -80 °C for later use.

A single positive result from the IFA test (immunofluorescent assay) (SD, Bioline Tsutsugamushi Assay; Standard Diagnostics), or if the IFA titer of a series of samples is 1:640 or higher, or a quadruple rise, scrub typhus disease. ; ST). Stored plasma samples from patients identified with SFTS and ST were thawed to compare the diagnostic performance of iNAD with real-time PCR. Based on previous studies, it was predicted that the clinical sensitivity of real-time PCR to ST was not high in patients identified as ST at the beginning of the study, whereas the clinical sensitivity of real-time PCR to SFTSV was expected to be high in SFTS patients. Accordingly, in order to confirm whether iNAD can detect a very low content of SFTSV virus, samples of convalescent plasma from SFTS patients were included. Both DNA and RNA were extracted simultaneously from each plasma sample.

As extracted above, DNA for ST and RNA for SFTS were used for real-time PCR and iNAD for SFTSV and Tsutsugamushi disease, respectively. The positive or negative results of the real-time PCR and iNAD were confirmed by the final diagnosis of SFTS and IFA analysis for ST confirmed by RT-PCR of the Korea Centers for Disease Control and Prevention.

1 is a schematic diagram showing an experiment plan according to an embodiment of the present invention. The Institutional Review Board of Asan Hospital approved the study plan of the present invention, and consent was obtained from all participants.

Primer and probe design

Primers and probes for SFTSV were designed using SFTSV M and S segments. In order to detect O. tsutsugamushi , a 56-kDa type-specific antigen gene encoding a primary immunogen located on the outer membrane, as well as real-time PCR, was used.

The following sequences were aligned using the ClustalW program: M fraction of SFTSV (GenBank accession numbers: NC018138, KR698332, KR017863, AB985654, KF887440, KJ597824, KF358692, KC473541), S fraction of SFTSV (Gen Bank accession numbers: NC018137, KR612087, KR612074, KR612073, KR612072, KR698319, KT254589, KU738910, KR017826), and 56 kDa type-specific antigen genes of O. tsutsugamushi (GenBank accession number: KJ742200368, KJ868214218, KF523362, JQ8983, HQ8983, KF523362, JQ8983 HQ731680, GU446620). The Primer3 program was used to design primers and probes for real-time PCR. The specificity of each primer and probe was verified by BLAST search against the NCBI database. Primers for iNAD were manually designed based on the sequences of primers and probes for real-time PCR. Primers and probes according to the present invention are shown in Table 1 below.

In Table 1 below, ACBT primers are primers for detecting Human beta actin gene. The primer is often used as an internal control, and this is to confirm whether RNA or DNA extraction was successful, PCR was successful, and the like.

Analysis method denomination Sequence number Sequence(5'-3') RT-PCR SFTS-SF SEQ ID NO: 1 CGAGAGAGCTGGCCTATGAA SFTS-SR SEQ ID NO: 2 TTCCCTGATGCCTTGACGAT SFTS-SP SEQ ID NO: 3 TGTCTTTGCCCTGACTCGAGGCA SFTS-MF SEQ ID NO: 4 ATGCTTGTCGTGAAGAAGGC SFTS-MR SEQ ID NO: 5 CTAGACTTCCCACTGCCACA SFTS-MP SEQ ID NO: 6 ACTTTTGATGGATACGTAGGCTGGGGC ACBT-F SEQ ID NO: 7 ACTAACACTGGCTCGTGTGA ACBT-R SEQ ID NO: 8 CTTGGGATGGGGAGTCTGTT ACBT-P SEQ ID NO: 9 AGGCTGGTGTAAAGCGGCCTTGG ST-F SEQ ID NO: 10 GCAGCAGCTGTTAGGCTTTT ST-R SEQ ID NO: 11 TTGCAGTCACCTTCACCTTG ST-P SEQ ID NO: 12 CAGCGTCATGCAGGAATTAGGAAAGCCA iNAD iNAD-SFTS-F SEQ ID NO: 13 GGAGGCCTACTCTCTGTGGCAAGATGCCTTCA iNAD-SFTS-R SEQ ID NO: 14 GGCCTTCAGCCACTTTACCCGAACATCATTGG iNAD-ST-F SEQ ID NO: 15 GCAGCAGCAGCTGTTAGGCTTTTAAATGGCAATG iNAD-ST-R SEQ ID NO: 16 GCTGCTTGCAGTCACCTTCACCTTGATTCTTTG

DNA and RNA extraction and preparation

Viral RNA was extracted from a sample of a patient identified as SFTS using the QIAamp Viral RNA Kit (Qiagen Inc., Chatsworth, CA, USA), and from a sample of a patient identified as ST using a QIAamp DNA mini kit (Qiagen). Genomic DNA was extracted.

To prepare the SFTS viral RNA transcript control, the fragment containing the target region was amplified with a primer containing the T7 promoter sequence on the antisense strand. Thereafter, the amplification product was transcribed in vitro using the MEGAscriptT7 transcription kit (AmbionLife Technologies). Synthetic RNA transcripts were purified using aMEGAclear kit (Ambion), and quantified by Nanodrop spectrophotometer (Thermo Scientific).

A plasmid containing each of the amplification regions of the M and S segments of the SFTSV and the 56-kDa type-specific antigen gene of O. tsutsugamushi was prepared by ligating in pGEM-T Easy Vector (Promega). It was transferred to E. coli JM109. The E. coli strain was stored in glycerol at -80 °C.

Real-time PCR based on Taqman Probe

Multiple real-time RT-PCR analysis using Taqman probe for detecting SFTSV includes 4 µl of 5X master mix, 0.1 µl of 200X enzyme mix, 4 µl of primer and probe mix, and 5 µl of the extracted RNA or synthetic RNA. It was carried out using a LightCycler Multiplex RNA Virus Master (Roche) containing 20 µl of the reaction mixture. The primer and probe mix consisted of 250 nmol/L of S segment, M segment and β-actin primer, 250 nmol/L of S segment probe and 125 nmol/L of M segment and β-actin probe.

RT-PCR amplification was performed using the Light-Cycler 96 system (Roche) under the following conditions: reverse transcription at 50° C. for 10 minutes, pre-incubation at 95° C. for 10 minutes, followed by 2-step amplification (5 seconds at 95° C., 56 30 sec) 45 cycles at °C. In order to generate a calibration curve, ^{serial dilutions of 10 7} to 10 ¹ copies/µl of synthetic RNA were analyzed in 5 independent reaction sets.

To detect O. tsutsugamushi , Taqman probe-based real-time PCR was performed using 10 μl of 2X master mix, 250 nmol/L of ST primer, 100 nmol/L of ST probe, and 5 μl of extracted DNA or control DNA. It was carried out with FastStart Essential DNA Probes Master (Roche) containing 20 µl of the containing reaction mixture.

PCR amplification was performed under the following conditions using the Light-Cycler 96 system (Roche): After pre-incubation at 95°C for 10 minutes, 2-step amplification (10 seconds at 95°C, 30 seconds at 60°C) 45 cycles. A calibration curve for quantification of O. tsutsugamushi ^{was generated by serial dilution of 10 6} to 10 ¹ copies/L of control DNA. All experiments were conducted in duplicate, and positive and negative controls were included in each assay.

Real-time RT-PCR analysis based on SYBR Green

Real-time RT-PCR analysis based on SYBR Green for detecting SFTSV was performed as follows by modifying the AriaMx (Aligent) Instrument protocol. Target RNA (5 µl) extracted from the clinical sample was amplified in a total of 20 µl of a reaction product [2x brilliant SYBR green RT-qPCR master mix and 25 pmol of each primer]. The initial cDNA synthesis step was 50°C for 20 minutes, then 95°C for 15 minutes, followed by 50 cycles of 15 seconds at 95°C, 20 seconds at 55°C and 20 seconds at 72°C, and 30 seconds at 40°C. During the cooling step. The SYBR Green signal of the amplified product was obtained using the AriaMx Real-Time PCR System (Agilent).

Real-time PCR analysis based on SYBR green for detection of Tsutsugamus was performed at 95° C. for 15 minutes, followed by 45 cycles of 30 seconds at 95° C., 30 seconds at 55° C. and 30 seconds at 72° C., and 72° C. This was done with a final stretching step of 10 minutes. Target DNA (5 μL) was amplified in a total of 20 μl of the reaction [2x brilliant SYBR green RT-qPCR master mix and 25 pmol of each primer]. The SYBR Green signal of the amplified product was obtained using the AriaMx Real-Time PCR System (Agilent).

iNAD (one-step isothermal nucleic acid amplification with bio-optical sensor detection)

Preparation of SMR biosensor

The SMR biosensor for the iNAD detection system was constructed and operated using the protocol described in previous work for SMR and Recombinase polymerase amplification (RPA) (Shin Y, et al., Real-time, label-free isothermal solid-phase amplification/detection (ISAD) device for rapid detection of genetic alteration in cancers.Lab Chip 2013;13:2106-14, Koo B, et al., An isothermal, label-ree, and rapid one -step RNA amplification/detection assay for diagnosis of respiratory viral infections.Biosens Bioelectron 2017;90:187-94). Simply put, the iNAD chip [2.5 cm x 1 cm x 0.3 cm] consists of microring structures, waveguides and gratings, and is a commercially available 200 mm SOI (Silicon-On- Insulator), and a 2 μm thick buried oxide layer by 210 nm deep ultraviolet (UV) lithography. In particular, the microring array is designed to consist of four rings connected to a common input waveguide and a dedicated output waveguide. Insertion loss (IL) spectra were measured using an EXFO IQS-2600B DWDM passive component test system.

The SMR biosensor was prepared according to the following steps to be used for detection of viral DNA or RNA.

First, the SMR biosensor chip was subjected to oxygen plasma cleaning (power: 100W, O2: 80 sccm) for 1 minute and 2% 3-aminopropyltriethoxysilane dissolved in 95% ethanol at room temperature for 2 hours. (APTES) solution. Then, the chip was cured at 120° C. for 15 minutes. In addition, the chip was reacted with 2.5% glutaraldehyde (GAD) dissolved in deionized water (DI) containing 10 mM sodium cyanoborohydride for 1 minute at room temperature, rinsed with deionized water, and then high-purity nitrogen gas. Dried under. Next, in order to immobilize the target primer on the SMR biosensor, the biosensor was reacted with a target primer dissolved in a MES solution (50 mM) containing 20 mM sodium cyanoborohydride solution at room temperature for 16 hours. After that, it was washed with MES to remove unbound target primers. Primers for ST and SFTS were designed using the SFTS-V fragment and the ST-56-kDa type specific gene, respectively (Table 1). In order to avoid formation of a primer-dimer, the target primer was used by introducing an amine group at the 5'position. The SMR allows the target molecule to selectively bind to a fixed receptor in the attenuation region of the resonator waveguide, and as a result, can be used as a natural refractive index sensor that increases the ratio of each wavelength during the reaction.

Operation of the SMR biosensor

2 is a schematic diagram showing an iNAD analysis system designed to clinically detect bacterial DNA and viral RNA extracted from plasma of a patient with SFTS or tsutsugamushi disease.

Referring to FIG. 2, the iNAD chip is composed of a sensor microring and a reference microring. Each microring has a dedicated output waveguide (grating coupler). To operate iNAD, a forward primer is immobilized on the iNAD chip (#1). Thereafter, a mixture of RPA and a reverse primer is added to the chip to detect DNA (left in Fig. 2) or RNA (right in Fig. 2). For RNA amplification and detection (right), cDNA is synthesized from RNA during the reaction (#2-1). The cDNA recognizes the immobilized forward primer on the chip surface, and the wavelength shift (# 4-1) due to the formation of a dimer between the cDNA and the primer (# 3-1) is measured in an unlabeled real-time method. For DNA amplification and detection (left), the target DNA recognizes the forward primer immobilized on the chip surface. A double strand is formed between the cDNA and the primer (# 2) and the resulting wavelength shift (# 3) is measured in a label-free real-time manner.

Specifically, in order to amplify and detect target DNA or RNA using the SMR biosensor, RPA and RT (transcription)-RPA solutions for DNA and RNA were prepared, respectively. To prepare RPA and RT-RPA solutions, 29.5 μL of rehydration buffer, 15 μL of RNase inhibitor and water, and 2.5 μL of each primer of 10 μM were mixed. Thereafter, the reaction mixture was added to the lyophilized enzyme, and 2.5 μL of a 280 mM magnesium acetate (MgAc) solution was added to the cap of each tube. Unidirectional shaking mixing was performed for homogeneous distribution. After mixing, 50 µl of the reaction buffer was divided into 10 µl droplets 5 times. To initiate the reaction for detection, 5 μL of nucleic acid extracted from the patient's serum was added to each 10 μL reaction droplet. The biosensor was placed on a thermoelectric cooler (TEC) equipped with a controller (Alpha Omega Instruments), a constant DC voltage was applied, and a constant temperature (38° C. for DNA, 43° C. for RNA) was maintained. The resonance spectrum of the biosensor was immediately measured, and a reference was used to obtain a baseline. Wavelength shift was measured every 5 minutes for up to 30 minutes to monitor the amplification of the target nucleic acid in real time and without labeling. The relative resonance wavelength shift was calculated by the following equation.

Δpm = (target wavelength value, pm)-(non-target wavelength value, pm)

In the case of the iNAD analysis, the resonance wavelength shift was measured to detect RNA-based SFTS and DNA-based O. tsutsugamushi within 20 minutes.

Statistical analysis

Student t- test and the χ ² test were used to compare the basic clinical characteristics of patients with SFTS and Tsutsugamushi disease. The effects of real-time PCR and iNAD were compared using the ^{χ 2 test.} IBM SPSS Statistics Version 22.0 for Windows (IBM Corp.) was used for statistical analysis. All data were considered as 95% confidence intervals ( P ≤ 0.05).

Experiment result

Clinical characteristics of the patient

Detailed demographic data and clinical characteristics are shown in Table 2 below.

division SFTS (n=15) Tsutsugamushi (n=21) P value age 61 ± 7 67 ± 14 0.13 male 10 10 0.26 Season (Mon) Spring-Summer (March-August) 6 One 0.01 Autumn (September-November) 9 20 Eschar (scab) 4 16 0.005 Clinical characteristics (symptoms) Heat 15 21 >0.99 Skin rash One 14 <0.001 headache 7 6 0.27 Change in mental state 8 2 0.007 Underlying disease Existing healthy 4 12 0.07 diabetes 3 5 >0.99 Solid rock 0 2 0.50 Chronic liver disease 0 2 0.50 Chronic kidney disease 0 One >0.99 Immunosuppression status ^a 0 5 0.06 Leukocytosis (leukocytes> 10000/mm ³ ) 0 6 0.03 Leukopenia (leukocytes <4000/mm ³ ) 14 4 <0.001 Thrombocytopenia
(Platelet <150 × 10 ³ /mm ³ ) 15 15 0.03 Clinical course ICU admission 6 2 0.04 In-hospital mortality One 0 0.42 Treatment Doxycycline 11 21 0.06 Ribavirin 10 One <0.001 a Patients with diseases such as malignant tumors, cirrhosis, and chronic kidney failure, and patients receiving immunosuppressive treatment

Looking at Table 2, among 158 patients with fever from May 2015 to November 2016, 15 patients (9%) confirmed SFTS by real-time RT-PCR, and the IFA antibody titer was 1:640. There were 21 patients (13%) who were diagnosed with ST due to abnormal or quadruple rise. In addition, SFTS was found over the warm season between spring and autumn, while ST was mainly found in autumn (95%, Table 2). Eschars was more common in ST (16/21) patients than in SFTS patients (4/15, P = 0.005). Leukopenia (leukocytes <4000/mm ³ ) was more common in SFTS (14/15) patients than in ST patients (4/21, P = 0.001), and thrombocytopenia (platelets <150×10 ³ /mm ³ ) was associated with ST. It was more common in SFTS patients (15/15) than in patients (15/21, P = 0.03).

Real-time PCR and INAD based on TAQMAN PROBE for SFTS and Tsutsugamushi disease

In TaqMan real-time PCR, the amount of PCR amplification product can be detected by a fluorescent signal, and the amount of polynucleotide increases as real-time PCR proceeds. As a result, the intensity of the fluorescence signal increases, and the user can obtain an amplification plot curve indicating the intensity of the fluorescence signal according to the number of amplification cycles. In the present invention, the amplification plot according to the TaqMan real-time polymerase chain reaction plot) curve is shown in FIG. 3.

Figure 3 is a graph showing a curve graph obtained by amplifying the M segment of SFTSV, the S segment of SFTSV, and Tsutsugamushi by TaqMan real-time PCR. Since the amount of the product has not yet reached the detectable amount, almost no fluorescence signal appears, and an amplification plot curve indicating the intensity of fluorescence according to the increase in the amount of the product can be confirmed from a certain cycle or more. Based on this amplification plot curve, a standard curve can be drawn and the relative amount of virus can be measured using a threshold cycle (Ct) value. 4 is a distribution diagram showing a standard curve and a threshold cycle value according to the TaqMan probe-based real-time PCR of the present invention.

FIG. 4 is for confirming the detection limit of the Taqman probe-based real-time PCR for SFTSV and O. tsutsugamushi.

The upper side of FIG. 4 is a graph showing a standard curve according to a TaqMan probe-based real-time PCR for SFTSV or Tsutsugamushi. It can be seen that each of the standard curve graphs has excellent linearity (SFTS M segment, R ² =0.9954; SFTS S segment, R ² =0.9942; ST, R ² =0.9995; upper side of FIG. 4). Through the graphs, the detection limit for SFTSV was 10 copies per PCR reaction, and the detection limit for Tsutsugamushi was found to be 10 copies per PCR reaction. The lower side of FIG. 4 is a distribution diagram showing Cycle threshold (CT) values of all serum samples analyzed by Taqman probe-based real-time PCR. In FIG. 4, FIG. 4A is an experiment result for the M segment of SFTSV, FIG. 4B is an experiment result for the S segment of SFTSV, and FIG. 4C is an experiment result for Tsutsugamushi.

FIG. 5 is to confirm the detection limit of iNAD against SFTSV and O. tsutsugamushi , and the upper side of FIG. 5 is a resonance on the copy number of the transcript RNA and control DNA of the synthetic transcript of iNAD against SFTSV or tsutsugamushi. It is a calibration curve showing the wavelength shift (picometer), and the lower side of Fig. 5 is a distribution diagram showing the change in resonance wavelength of all serum samples analyzed by iNAD. In addition, FIG. 5A is an experiment result for the S segment of SFTSV, and FIG. 5B is an experiment result for Tsutsugamushi.

In Figure 5, the assay curve of iNAD for SFTSV was obtained by plotting the resonance wavelength shift (picometer) value for the copy number of synthetic transcript RNA or control DNA. In FIG. 5, the R ² correlation coefficient was 0.9717 for SFTSV and 0.9786 for Tsutsugamushi. The detection limit for SFTSV by the calibration curve was 22 copies per reaction; In the case of Tsutsugamushi bacteria, it was 15 copies per reaction. The limit of iNAD detection for SFTSV and Tsutsugamus was comparable to that of the Taqman probe-based real-time PCR.

In order to compare the detection limit of iNAD with other types of real-time PCR analysis, a real-time PCR analysis based on SYBR Green using a single primer pair was performed. 6 is a graph showing a standard curve according to real-time PCR based on SYBR Green for SFTSV or Tsutsugamushi. FIG. 6A is a standard curve for Tsutsugamusi, and FIG. 6B is a standard curve for SFTSV. The detection limit of SFTSV according to the standard curve was 220 copies per reaction, and the detection limit of Tsutsugamushi was 150 copies per reaction.

TAQMAN PROBE-based real-time PCR for SFTS and ST and diagnostic performance of iNAD

In the acute phase of SFTS, the clinical sensitivity of both Taqman probe-based real-time PCR and iNAD was 100% (95% CI, 75-100). However, when samples from 5 patients during the recovery phase of SFTS were included in the final analysis, the clinical sensitivity of iNAD (100%) to SFTSV was significantly higher than that of Taqman probe-based real-time PCR (75% P ≤ 0.047, Table 2). . However, the clinical specificity of iNAD for SFTSV (86%) was not different from that of Taqman probe-based real-time PCR (95%, P = 0.61).

The clinical sensitivity of iNAD (100%) to Tsutsugamus was significantly higher than that of Taqman probe-based real-time PCR (67%, P 0.009, Table 3), and the clinical specificity of iNAD (90%) for ST was Taqman probe-based real-time PCR. (95%, P>0.99, Table 3).

division SFTSV-specific primer Tsutsugamushi-specific primer SFTS(n=20) ST(n=21) ST(n=21) SFTS(n=20) Real-time PCR Positive (n) 15 One 14 One Negative(n) 5 20 7 19 Sensitivity (%) 75(51-91) 67(43-85) Specificity (%) 95(77-99) 95(73-100) iNAD Positive (n) 20 3 21 2 Negative(n) 0 18 0 18 Sensitivity (%) 100(83-100) 100(81-100) Specificity (%) 86(65-97) 90(67-98)

Meanwhile, Table 4 below shows detailed results of Taqman probe-based real-time PCR and iNAD for SFTSV and Tsutsugamushi specific primers targeting 15 SFTS patients.

Patient number Number of days since onset Real-time PCR iNAD SFTS ST SFTS ST One 12 + - + - 1-1a 19 - - + - 2 8 + - + - 2-1a 28 - - + - 3 11 + - + - 4 6 + + + - 5 8 + - + - 6 5 + - + - 7 10 + - + + 8 5 + - + - 8-1a 10 - - + - 9 5 + - + - 10 6 + - + - 11 7 + - + - 11-1a 21 - - + - 12 5 + - + - 13 9 + - + + 13-1a 13 - - + - 14 4 + - + - 15 5 + - + -

In Table 4, the patient number'a' refers to a plasma sample collected on the day when the first negative result ('-') of real-time PCR for SFTS appeared.

In addition, Table 5 below shows the results of Taqman probe-based real-time PCR and iNAD for SFTSV and Tsutsugamushi specific primers for 21 ST patients.

Patient number Duration of disease after doxycycline treatment IFA results for ST Real-time PCR iNAD ST SFTS ST SFTS One 8 1:320, 1:1280 - - + - 2 3 1:5120, 1:5120 + - + - 3 7 1:1280 + - + - 4 8 1:1280 + - + - 5 7 1:160, 1:2560 + - + - 6 4 1:80, 1:5120 + + + - 7 10 1:640 - - + + 8 11 1:80, 1:2560 + - + - 9 10 1:2560 - - + - 10 6 1:1280, 1:5120 + - + + 11 8 1:50, 1:5120 + - + - 12 5 '-', 1:5120 + - + - 13 17 '-', 1:1280 - - + - 14 21 1:320, 1:5120 + - + + 15 13 '-', 1:640 - - + - 16 9 1:160, 1:5120 - - + - 17 8 '-', 1:2560 + - + - 18 7 1:640 + - + - 19 5 1:40, 1:2560 - - + - 20 4 1:5120 + - + - 21 7 1:640, 1:2560 + - + -

In Table 5, the'IFA result for ST' means the IFA titer of Tsutsugamushi bacteria in the acute and/or recovery phase.

ST is prevalent in the fall between September and November, when humans hatch in the fall and become infected by bites by larvae of hairy mites that suck up body fluids (Table 2). SFTS is prevalent mainly in the hot season, but in this study, 60% of SFTS occurred in September to November (Table 2). In other words, the onset timing of SFTS overlaps with Tsutsugamushi disease.

In addition, the geographic distribution of outdoor activities at risk of exposure to ticks, as well as the resulting clinical symptoms, substantially overlap between SFTS and ST. Therefore, early discrimination between SFTS and ST, which is transmitted by ticks and can be fatal, remains a difficult task. Accordingly, the present inventors have developed a method called iNAD for detecting SFTSV and Tsutsugamushi from serum, and the clinical sensitivity for diagnosing SFTS and ST is higher than that of Taqman-based real-time PCR, but has significant diagnostic specificity. There is no loss (Table 3).

In this study, the detection limit of the Taqman probe-based real-time PCR analysis was higher than that of iNAD. The detection limit of real-time PCR analysis for SFTS viral RNA and Tsutsugamusi DNA was 10 copies/μl for viral RNA and 10 copies/reaction for SFTS. Meanwhile, the real-time PCR analysis developed in the previous study used multiplex primers and probes to improve the assay sensitivity and specificity of the Taqman probe assay. The iNAD of the present invention almost achieved the limit of detection of the Taqman probe-based assay using only a single primer pair without the use of multiplex probes or primers. In addition, methodological differences between SYBR Green and Taqman probes for real-time PCR should be considered. When real-time PCR based on SYBR Green was performed with a single primer pair, the detection limit of SFTS was 220 copies per reaction, and the detection limit of tsutsugamushi disease was 150 copies per reaction (see FIG. 6). This means that when iNAD uses the same single primer pair, it is analytically more sensitive than real-time PCR based on SYBR Green, and its analysis sensitivity is similar to that of real-time PCR based on Taqman probe. In addition, since the iNAD of the present invention only uses a single primer set and does not use a probe, cost can be reduced.

Real-time RT-PCR and iNAD both showed 100% clinical sensitivity in 15 SFTS serum samples collected over 1 to 3 days of hospitalization, but real-time RT-PCR for 5 plasma samples collected from patients with end-stage disease. In the case of, the result was negative, and in the case of iNAD, the result was positive. In previous studies, the clinical diagnosis of SFTS showed a clinical sensitivity of 94-100%, but serum samples in the terminal stage of recovery were not included in the diagnostic trials. Considering that conventional PCR and real-time PCR are considered the standard for diagnosis of SFTS even though the clinical sensitivity is not 100%, iNAD is used to diagnose SFTS patients with mild symptoms with recent or very low levels of viral infection. Can be useful.

In addition, looking at Tables 2 and 3, the clinical sensitivity to patients with Tsutsugamushi disease exceeding 3 to 21 days of onset was 100% in the case of iNAD, and was higher than that of real-time PCR indicating 67%.

In addition, in the case of iNAD (20 minutes), there is no thermal cycling, and because it simultaneously amplifies and detects the target gene in a label-free real-time method, it is 5 times faster than real-time PCR (100 minutes). Therefore, iNAD can be used to detect very small amounts of DNA from plasma of patients with Tsutsugamushi disease and to quickly diagnose it.

That is, as shown in the above results, when the iNAD biosensor according to the present invention is used, pathogenic nucleic acids such as ST (tsutsugamushi) and SFTS can be detected very quickly and more sensitively than the real-time PCR method.

From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in other specific forms without changing the technical spirit or essential features thereof. In this regard, the embodiments described above are illustrative in all respects and should be understood as non-limiting. The scope of the present invention should be construed that all changes or modifications derived from the meaning and scope of the claims to be described later rather than the above detailed description and equivalent concepts are included in the scope of the present invention.

<110> UNIVERSITY OF ULSAN FOUNDATION FOR INDUSTRY COOPERATION THE ASAN FOUNDATION <120> Primer set for detecting SFTS virus and kit for diagnosing SFTS using the same <130> HP8105, PA-20180212 <160> 16 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SFTS-SF <400> 1 cgagagagct ggcctatgaa 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SFTS-SR <400> 2 ttccctgatg ccttgacgat 20 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SFTS-SP <400> 3 tgtctttgcc ctgactcgag gca 23 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SFTS-MF <400> 4 atgcttgtcg tgaagaaggc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SFTS-MR <400> 5 ctagacttcc cactgccaca 20 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SFTS-MP <400> 6 acttttgatg gatacgtagg ctggggc 27 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ACBT-F <400> 7 actaacactg gctcgtgtga 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ACBT-R <400> 8 cttgggatgg ggagtctgtt 20 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ACBT-P <400> 9 aggctggtgt aaagcggcct tgg 23 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ST-F <400> 10 gcagcagctg ttaggctttt 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ST-R <400> 11 ttgcagtcac cttcaccttg 20 <210> 12 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> ST-P <400> 12 cagcgtcatg caggaattag gaaagcca 28 <210> 13 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> iNAD-SFTS-F <400> 13 ggaggcctac tctctgtggc aagatgcctt ca 32 <210> 14 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> iNAD-SFTS-R <400> 14 ggccttcagc cactttaccc gaacatcatt gg 32 <210> 15 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> iNAD-ST-F <400> 15 gcagcagcag ctgttaggct tttaaatggc aatg 34 <210> 16 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> iNAD-ST-R <400> 16 gctgcttgca gtcaccttca ccttgattct ttg 33

Claims (14)

To specifically detect SFTS virus, comprising at least one primer pair selected from the group consisting of a primer pair of SEQ ID NOs: 1 and 2, a primer pair of SEQ ID NOs: 4 and 5, and a primer pair of SEQ ID NOs: 13 and 14 Primer set for. The method of claim 1,
At least one primer pair selected from the group consisting of a primer pair of SEQ ID NOs: 1 and 2, and a primer pair of SEQ ID NOs: 4 and 5 is for real-time polymerase chain reaction (real-time PCR) A primer set for specifically detecting an SFTS virus, characterized in that. The method of claim 1,
The primer pairs of SEQ ID NOs: 13 and 14 are for isothermal nucleic acid amplification reaction (Isothermal Nucleic acid Amplification), for silicon resonator sensor (Silicon Microring Resonator; SMR) or for iNAD (Isothermal Nucleic acids Amplification and Detection) SFTS. A set of primers for specifically detecting a virus. A primer set for specifically detecting an SFTS virus comprising the primer set of claim 2 and the probes of SEQ ID NO: 3 and SEQ ID NO: 6. SFTS virus detection composition comprising the primer set of claim 3. A kit for diagnosing severe fever thrombocytopenia syndrome comprising at least one primer pair selected from the group consisting of a primer pair of SEQ ID NOs: 1 and 2, a primer pair of SEQ ID NOs: 4 and 5, and a primer pair of SEQ ID NOs: 13 and 14. The method of claim 6,
The diagnostic kit further comprises a primer pair that specifically amplifies a foreign gene not present in the SFTS virus and an internal control including DNA of the foreign gene. The method of claim 6,
The diagnostic kit contains at least one primer pair selected from the group consisting of a primer pair of SEQ ID NOs: 1 and 2, a primer pair of SEQ ID NOs: 4 and 5, and a primer pair of SEQ ID NOs: 13 and 14 in a freeze-dried powder or liquid form. A diagnostic kit comprising a single-use PCR tube. A kit for diagnosing severe febrile thrombocytopenia syndrome comprising the primer set of claim 4 or the composition of claim 5. The method of claim 6,
The severe febrile thrombocytopenia syndrome is caused by the SFTS virus, a diagnostic kit. The method of claim 6,
The primer pair is to detect the SFTS virus in the biological sample, diagnostic kit. The method of claim 11,
The biological sample is the blood of a diagnosis target or a small small mite, a diagnostic kit. For the diagnosis of severe febrile thrombocytopenia syndrome, comprising the step of detecting the SFTS virus in a biological sample isolated from an individual suspected of severe febrile thrombocytopenia using the primer set of any one of claims 1 to 3 How to provide information. (a) Using the primer set according to any one of claims 1 to 3, the target nucleic acid contained in the sample is PCR, real-time PCR (RT-PCR), reverse transcriptase PCR. PCR), isothermal nucleic acid amplification, amplification using at least one selected from the group consisting of a silicon microring resonator (SMR) and iNAD (Isothermal Nucleic Acids Amplification and Detection); And
(b) a method for detecting an SFTS virus comprising the step of detecting the amplification product.

Images