RU2803069C1 - Kit of specific oligodeoxyribonucleotide primers and a fluorescently labeled probe for the canine morbillivirus (canine distemper virus, cdv) nucleocapsid protein (n) gene fragment for the detection of canine distemper (carré disease, distemper) in dogs - real-time pcr test system - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: set of specific oligodeoxyribonucleotide primers VT-CDV-F 5`-TCGGAGATGAGAAGGTGGATTA-3` and VT-CDV-R 5`-TCAGCAATTCTAGGCTTGTTCC-3`, and a fluorescently labeled probe VT-CDV-P 5`-(R6G)-CCAAGATGAGTGCTACCATGAACCGCC-(BHQ2)-3` to a gene fragment encoding the Canine Distemper nucleocapsid N protein for the detection of Canine Distemper virus in dogs.

EFFECT: kit allows to carry out real-time identification of RNA, cDNA encoding the Canine Distemper virus nucleocapsid N protein, which has a higher homology to the currently circulating strains of Canine morbillivirus, which increases the reliability and reliability of the analyzes.

1 cl, 3 dwg, 3 tbl

Description

Field of technology to which the invention relates:

The invention relates to the field of biotechnology and concerns a set of highly specific primers and a fluorescently labeled probe for detecting genetic material (RNA, cDNA) of a fragment of the nucleocapsid protein (N) gene Canine morbillivirus (Canine Distemper Virus, CDV) for detection of Canine distemper (Carré disease, distemper) in dogs. The presented set of oligodeoxyribonucleotide primers and a fluorescently labeled DNA probe contains a pair of oligonucleotides that have the activity of forward and reverse primers in the polymerase chain reaction, as well as one fluorescently labeled DNA probe. The presented invention allows for more reliable and reliable detection of genetic material (RNA, cDNA) of the Canine morbillivirus (Canine Distemper Virus, CDV) nucleocapsid protein (N) gene fragment for the detection of Canine distemper (Carré disease, distemper) in dogs and can be used in veterinary medicine . The method makes it possible to detect a fragment of the conserved region of the nucleocapsid protein (N) gene of Canine morbillivirus (Canine Distemper Virus, CDV) – the causative agent of Canine Distemper (Carré disease, distemper) in dogs, which makes it possible to identify animals infected with Canine morbillivirus (Canine Distemper Virus, CDV) ( Canine distemper, Carré's disease, distemper) in dogs at any stage of the disease.

The invention relates to sets of primers for identifying genetic material (RNA, cDNA) of a fragment of the nucleocapsid protein (N) gene Canine morbillivirus (Canine Distemper Virus, CDV) (Canine distemper, Carré disease, distemper), in clinical samples, sectional samples, cultural fluids and other biological products for the purpose of diagnosis, correction of treatment, epidemiological investigation, as well as for solving research problems of the properties of Canine morbillivirus (Canine Distemper Virus, CDV) (Canine distemper, Carré disease, distemper), and can be used in veterinary medicine.

Canine distemper (canine distemper, Carré's disease, distemper) is an acute or subacute contagious viral disease manifested by fever, catarrhal inflammation of the mucous membranes, skin lesions, central nervous system, or a combination of these symptoms.

Plague has been known since the domestication of dogs. Distributed everywhere. In the Russian Empire it appeared in 1762 in Crimea and was called the “Crimean disease”. The viral nature of canine distemper was first proven by the scientist Carré in 1905.

The causative agent of the disease is the Canine Distemper virus, also called Canine Morbillivirus. This virus belongs to the Paramyxovirus family. Plague infection occurs through the respiratory tract and digestive system. Once in the body, the plague virus enters the blood and tissues. Colds, inadequate feeding, lack of vitamins in food, and poor living conditions for dogs contribute and predispose them to the disease. The virus is released into the environment through discharge from the eyes, nose and mouth, feces, urine, and dead skin epithelium. The main source of infection is sick animals, care items, feeders, equipment, premises and bedding where sick animals were kept, as well as mechanical carriers - humans, vehicles.

Domestic dogs and wild canines are susceptible to plague, and among felines - some representatives of felids and viverrids. In East Africa, domestic or feral dogs transmit distemper virus to lions, spotted hyenas and wild dogs, resulting in high mortality rates in these wild species.

From the moment of infection to the appearance of the first signs, a latent period of illness occurs, which lasts from three to 21 days. During this period of illness, the dog appears healthy, but can infect other dogs. The onset of the disease is difficult to determine. The first signs: slight depression, lethargy, easy fatigue, tousled hair, decreased appetite, sometimes vomiting, partial refusal to work, redness of the mucous membranes of the eyes, nose, mouth, slight transparent discharge from the nose and eyes, the appearance of slight diarrhea. These signs are more pronounced in some dogs, less so in others. At the very beginning of the disease, the temperature is elevated (39.5 - 40), lasts 2-3 days, and then drops to normal. In the strongest dogs, this ends the course of the disease and recovery begins. In the weak, the temperature rises and their health worsens. At the height of the disease or when improvement begins, lesions of the nervous system appear. Symptoms also include intermittent seizures in dogs.

Carnivore plague can occur at lightning speed, hyperacute, acute, subacute, abortive, typical and atypical. According to clinical signs, catarrhal, pulmonary, intestinal, skin, nervous and mixed (generalized) forms of the disease are distinguished. The development of one form or another of plague is determined by the reactivity of the animal’s body. The same pathogen strain can cause different types of clinical signs in dogs.

More often, the disease occurs with pathology in various tissues, since the canine distemper virus is a pantropic virus, that is, it affects cells of all body systems. Therefore, the division into various forms of the disease is very arbitrary.

Mortality among puppies up to 3 months of age is 30-100%.

The plague virus, having penetrated the body, first enters the bloodstream, causing the appearance of fever and a depressed state. The virus spreads through the blood to the internal organs and central nervous system, causing inflammatory and degenerative changes in the latter. Subsequently, catarrhal inflammation of the mucous membranes develops, as a result of which various microflora can penetrate into the body and cause serious complications.

For laboratory diagnosis of canine distemper, in particular for detection (indication) of the pathogen and its identification (determination of species), the following methods are used:

direct fluorescent antibody (DFA) method - to establish an early intravital diagnosis, the material is fingerprint smears; It is based on fluorescent microscopy of antigen compounds with a labeled antibody. When studying recently vaccinated people, false positive results are possible.

enzyme-linked immunosorbent assay (ELISA) - to establish an early lifetime diagnosis; industrial diagnostic kits on polystyrene plates have been developed to detect the specific antigen of the virus; material - blood samples, swabs from the eyes and throat. When studying recently vaccinated people, false positive results are possible.

neutralization reaction (RN) - to identify the virus in cell culture;

diffuse precipitation reaction (DPR) - allows you to detect the pathogen on the 3-4th day of illness;

complement fixation reaction (FFR) - for detecting antigen in organs and tissues of sick animals and in cell culture;

indirect hemagglutination reaction (IRHA) - to identify specific antibodies to the pathogen;

passive hemagglutination reaction (RPHA);

biological test for animal susceptibility.

cytological studies to detect inclusion bodies in smears from mucous membranes and autopsy tissues.

rapid antigen detection tests. When studying recently vaccinated people, false positive results are possible.

polymerase chain reaction (PCR) to isolate the RNA of the virus. High specificity and sensitivity. When studying recently vaccinated people, false positive results are possible.

State of the art

When developing a set of oligodeoxyribonucleotide primers and a fluorescently labeled probe for detection of RNA, cDNA fragment of the nucleocapsid protein (N) gene Canine morbillivirus (Canine Distemper Virus, CDV) - the causative agent of Canine distemper (Carré disease, distemper) in dogs, a comparative analysis of the structure of nucleotide sequences of the nucleocapsid protein (N) gene of Canine morbillivirus (Canine Distemper Virus, CDV), posted on the NCBI web resource https://www.ncbi.nlm.nih.gov/nucleotide/, and then primers and a fluorescent-labeled probe were designed by computer modeling using computer programs Beacon Designer v. 8.14 PREMIER Biosoft International (San Francisco, CA 94131-2175, USA) and Vector NTI 11 (Invitrogen, USA). Alignment of genomic sequences was carried out using the Clustal W method, phylogenetic analysis was performed using the unweighted pairwise average method - UPGMA. Quality control and thermodynamic analysis of the selected primers and fluorescently labeled probe were performed using OLIGO DNA/RNA primer analysis software, v.5.0 and BLAST https://blast.ncbi.nlm.nih.gov/Blast.cgi (USA).

The amplified cDNA region, being a marker, makes it possible to identify the viral agent in the test sample. Effective real-time PCR requires a fluorescently labeled DNA probe and DNA primers (synthetic oligonucleotides) that are strictly specific to the cDNA of the viral genome. The complexity of choosing primers and probes is due to the requirement of their strict species specificity. Primers must be complementary to the DNA nucleotide sequences, limiting the amplified region on the right and left so that DNA synthesis by DNA polymerase occurs strictly in the selected region. The fluorescently labeled DNA probe, in turn, must lie within the DNA region delimited by the primers. The correct choice of primers allows for an exponential increase in the number of copies of the target DNA region. The correct choice of a combination of a pair of primers and a DNA probe allows detection of the accumulation of amplification products in real time. In general, the specificity of the RT-PCR, and therefore the reliability of the study, depends on the correct choice of oligodeoxyribonucleotide primers and probes.

In the computer design of primers and fluorescently labeled DNA probe, the main criteria were: the absolute degree of homology (complementarity) with the selected gene region; the absence of self-complementary regions in the structure of the primers and their complementarity to each other, in order to prevent the formation of stable secondary structures (dimers); maximum proximity of primer annealing temperatures.

Disclosure of the invention

The technical result of the claimed invention is the creation of a set of oligodeoxyribonucleotide primers and a fluorescently labeled probe that makes it possible to identify in real time the DNA fragment of the nucleocapsid protein (N) gene of Canine morbillivirus (Canine Distemper Virus, CDV) and has higher homology to currently circulating strains of Canine morbillivirus (Canine Distemper Virus, CDV), which increases the reliability and reliability of the analyses.

This technical result is achieved by developing a set of highly specific oligodeoxyribonucleotide primers for DNA detection of a fragment of the Canine morbillivirus (Canine Distemper Virus, CDV) gene, containing a pair of oligonucleotides with the activity of forward and reverse primers in the polymerase chain reaction, as well as a fluorescently labeled DNA probe. These oligonucleotides have the following structure:

Sequences of oligodeoxyribonucleotide primers and a fluorescently labeled probe for the Canine morbillivirus (Canine Distemper Virus, CDV) gene fragment.

Forward primer 5'→3'

VT-CDV-F 5'- TCGGAGATGAGAAGGTGGATTA -3'

Reverse primer 5'→3'

VT-CDV-R 5'- TCAGCAATTCTAGGCTTGTTCC -3'

Fluorescently labeled DNA probe (Probe) 5'→3'

VT-CDV-P 5'- (R6G) - CCAAGATGAGTGCTACCATGAACCGCC -(BHQ2) -3'

Table 1. Characteristics of the developed primers and fluorescently labeled DNA probe Index VT-CDV-F VT-CDV-R Fluorescently labeled DNA probe VT-CDV-P Structure from 5' to 3' TCGGAGATGAGAAGGTGGATTA TCAGCAATTCTAGGCTTGTTCC (R6G)- CCAAGATGAGTGCTACCATGAACCGCC -(BHQ2) Length, nucleotides 22 22 23 Annealing temperature taking into account melting temperature, °C 60 60 71 GC composition, % 45 45 56 Enzyme work temperature, °C 67.1 67.4 76.2

The design of the primers and probe proposed for patenting includes all data from the international GenBank database on the nucleocapsid protein (N) gene sequences of Canine morbillivirus (Canine Distemper Virus, CDV) as of May 2022. The primers and probe used in the work have greater homology to currently circulating strains of Canine morbillivirus (Canine Distemper Virus, CDV), which in turn increases the sensitivity of the proposed set of diagnostic primers and probe. The target for the primers and probe used in this work is a highly conserved region of the Canine morbillivirus (Canine Distemper Virus, CDV) nucleocapsid protein (N) gene.

The oligodeoxyribonucleotide primers and fluorescently labeled DNA probe being submitted for patenting make it possible to detect in a sample an RNA fragment, cDNA of the Canine morbillivirus (Canine Distemper Virus, CDV) nucleocapsid protein (N) gene in real time, as well as to amplify a DNA fragment, which makes it possible to sequence the resulting amplicon, with which it is possible to carry out molecular biological work, and therefore a more in-depth study of the properties of Canine morbillivirus (Canine Distemper Virus, CDV) - the causative agent of Canine Distemper (Carré disease, distemper) in dogs. In addition, the use of a plasmid construct carrying a specific insert as a positive control (as described below) allows the development of quantitative PCR, which in turn makes it possible to assess the viral load in the test sample.

Testing of the primers was carried out using a biotechnological design, which is based on a plasmid with the insertion of a specific DNA fragment. It was experimentally shown that the selected primers and DNA probe ensure reliable synthesis of target DNA fragments. The specificity of the amplification was further confirmed by sequencing.

Positive control samples were obtained by the TOPO-T/A method of cloning virus-specific DNA duplexes into the PC DNA 3.1 plasmid (Invitrogen, USA). After that, competent E. coli cells of the TOP 10 line (Invitrogen, USA) were transformed with the resulting plasmid carrying a type-specific fragment of the Canine morbillivirus (Canine Distemper Virus, CDV) nucleocapsid protein (N) gene.

It is important to note that the optimization of PCR conditions was carried out using sets of commercially available reagents, instruments and enzymes intended for mass use in laboratory practice, which allows the rapid and reliable use of this invention in medical and research laboratories.

Analysis of the efficiency of the transformation was carried out by real-time PCR in accordance with the protocol described below, where a 1×TE buffer containing recombinant plasmids with the insertion of a virus-specific synthesized DNA duplex was added to the reaction mixture as a positive sample. As a negative control, 1×TE buffer was added to the reaction mixture.

Amplification conditions were optimized for the concentration of magnesium ions, the concentration of primers and probes in the reaction mixture, and the primer annealing temperature.

The composition of the reaction mixture was modeled in such a way that the concentration of MgCl ₂ ions ensured the optimal speed and accuracy of the Mut-3 Taq polymerase enzyme, the concentration of dNTPs did not exceed 0.4 mM, the concentration of primers was 10 pmol/μl, fluorescently labeled DNA probe 5 pmol/µl, and the sample volume was 5 µl (to increase the specificity of the reaction).

Table 2. PCR mixture for the reaction (per tube): Component Volume per reaction (20 µl), µl PCR buffer ×10 2.5 dNTP (25 mM) 0.2 MgCl ₂ (50 mM) 1 Polymerase Taq-pol Mut-3 (5 units/µl) 0.5 Forward primer - VT-CDV -F (10 pmol/µl) 1 Reverse primer - VT-CDV-R (10 pmol/µl) 1 Fluorescently labeled DNA probe VT-CDV-P (5 pmol/µl) 1 Sample (DNA sample) 5 diH ₂ O (bidistylated) 6 Table 3. Temperature-time regime for PCR Stage T, °C Time, sec. Number of repetitions Tablet type amplifier Rotary amplifier Initial denaturation 95 300 300 1 Denaturation 95 10 10 45 cycles with fluorescence detection Annealing 58 25 dimension 25 dimension Elongation 72 25 40 Storage 4 ∞ ∞

Testing of PCR conditions using developed primers and a fluorescently labeled DNA probe was carried out on tablet-type amplifiers “DT-96”, “DT-Prime”, “DT-Light” (“DNA-Technology”, Russia) and rotary type “Rotor” Gene Q" (QIAGEN, Germany).

To determine the sensitivity of the method, isolated DNA samples (smears and washes) were subjected to tenfold dilutions from 10 ^-1 to 10 ^-5 . The resulting dilutions were studied by PCR using developed specific oligonucleotide primers and a fluorescently labeled DNA probe.

The specificity of the developed method was tested on samples of Canine morbillivirus (Canine Distemper Virus, CDV), as well as on samples of biological material obtained from intact and seronegative animals for Canine morbillivirus (Canine Distemper Virus, CDV). and also using the Sanger sequencing method on an automatic sequencer ABI PRISM 3500 (USA) Fig.1, Fig.2, Fig.3 in the “Scheme” appendix.

Claims (1)

A set of specific oligodeoxyribonucleotide primers VT-CDV-F 5'- TCGGAGATGAGAAGGTGGATTA -3', VT-CDV-R 5'-TCAGCAATTCTAGGCTTGTTCC -3', and fluorescently labeled probe VT-CDV-P 5'- (R6G) - CCAAGATGAGTGCTACCATGAACCGCC -( BHQ2) -3', to a fragment of the gene encoding the N nucleocapsid protein of the Canine Distemper virus for the detection of Canine Distemper virus in dogs.