KR102073201B1 - Biosorbent and a method for continosuly recovering lithum using the same - Google Patents

Abstract

The present invention relates to a microbial adsorbent and a method for continuously recovering lithium using the same, and more particularly, to a microbial adsorbent including a microorganism on which a support and a lithium-binding peptide are expressed on a surface, and a recombinant in which a lithium-binding peptide is expressed on a surface. When the microorganism adsorbent adsorbed on the support is used for lithium recovery, the lithium recovery efficiency can be maintained even when reused several times by significantly suppressing the damage to the surface applied during lithium desorption compared to when using the recombinant microorganism alone. have.

Description

Microbial Adsorbent and Continuous Recovery Method of Lithium Using It {BIOSORBENT AND A METHOD FOR CONTINOSULY RECOVERING LITHUM USING THE SAME}

The present invention relates to a microbial adsorbent and a method for continuously recovering lithium using the same, and more particularly, to a microbial adsorbent including a microorganism expressed on a surface of a support and a lithium binding peptide, and a method for continuously recovering lithium using the same.

Lithium ion battery is a rechargeable battery that can be used as a rechargeable battery. It has the advantage of being lighter and having a higher energy density than other batteries. It has less power loss due to self-discharge and has no memory effect. It is widely used in electronic devices such as mobile phones and laptops, which are necessities of society. In particular, the demand for lithium batteries using the lithium ion battery grows by 25% every year, and international consumption is expected to increase to 300,000 metric tons per year by 2020.

Various methods such as ion exchange adsorption, solvent extraction, and coprecipitation have been studied to recover lithium from a solution in which lithium is dissolved. In these trials, inorganic adsorbents such as manganese oxide-based inorganic adsorption method having ion exchange properties having very high selectivity are studied. Is being developed. However, in such a case, the seawater should be flowed by passing additional pressure from the outside, and there is a limit in the amount of introduction of manganese oxide adsorbent which is directly related to the amount of lithium recovered, and the adsorption characteristic is deteriorated in the part coated by PVC. A problem existed.

On the other hand, it has been known for a long time that heavy metals, etc. present in an aqueous solution can be removed using living or dead microorganisms such as bacteria, fungi, algae, and the like. Accordingly, various studies have been conducted to develop an adsorbent for removing heavy metals using microorganisms. For example, various studies have been conducted on wastewater treatment processes for adsorption and recovery of heavy metals using biosorbents having high mechanical strength through a process of immobilizing microorganisms by using colloidal silica gel as a carrier. However, these biological cells have a characteristic of removing heavy metal ions more effectively than light metals among various metal ions present in an aqueous solution such as wastewater, which makes it difficult to selectively recover lithium ions.

One object of the present invention is to provide a microbial adsorbent.

Another object of the present invention is to provide a method for preparing the microbial adsorbent according to the present invention.

Still another object of the present invention is to provide a lithium recovery method using the microbial adsorbent according to the present invention.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task not mentioned will be clearly understood by those skilled in the art from the following description.

The present inventors have developed a microorganism adsorbent that can maintain the lithium recovery efficiency even if reused several times by effectively inhibiting damage to the cell surface when the lithium-binding peptide is immobilized on the support to immobilize the microorganisms expressed on the surface The present invention was completed.

According to an embodiment of the present invention, the support and the lithium binding peptide include a microorganism expressed on the surface, and the microorganism expressed on the surface of the lithium binding peptide provides a microbial adsorbent immobilized on the support.

In the present invention, the "microbial adsorbent" (Biosorbent) means that the microorganisms having the property of adsorption of molecules of gas or solution to the solid surface is immobilized on the support. For the purposes of the present invention means a microorganism that is recombinant so that the lithium-binding peptide can be expressed on the surface of the microorganism, it can be recovered by adsorption by selecting a specific specific lithium contained in the solution.

Hereinafter, a form of a microbial adsorbent including a microorganism expressed on a surface of a support and a lithium binding peptide according to the present invention will be described with reference to FIG. 1.

As shown in FIG. 1, the microorganism 100 having the lithium-binding peptide expressed on its surface may be immobilized on the support 200 to form a microbial adsorbent.

In one embodiment of the present invention, the lithium-binding peptide is immobilized on the support of the microorganism expressed on the surface may be made through the formation of silica crosslinking. In order to form the silica crosslinking for the purposes of the present invention, the microorganisms adsorbed on the support may be immersed in tetramethoxysilane and then evaporated in the tetramethoxysilane. As such, when the microorganisms are immobilized through silica crosslinking rather than simply adsorbed to the support, even when the microorganism adsorbent is reused several times, the loss of the microorganisms may be reduced, thereby maintaining lithium recovery efficiency.

In the present invention, the recombinant microorganism expressed on the surface of the lithium-binding peptide specifically prepares a recombinant vector for surface expression of a microorganism containing a nucleotide sequence encoding a lithium-binding peptide, and transforms it to the microorganism. It can then be prepared by expressing a lithium binding peptide on the surface. For the purposes of the present invention, the lithium binding peptide is a peptide capable of specifically binding to lithium, and preferably, the amino acid sequence GPGDP having SEQ ID NO: 1, but is not limited thereto.

In the present invention, the "transformation" refers to a process in which extracellular DNA enters a host cell in the presence or absence of an accompanying material. Transformed cell refers to a cell having extracellular DNA introduced into the cell and having extracellular DNA. DNA can be introduced into cells so that nucleic acids can be inserted into chromosomes or replicated to extrachromosomal material.

In the present invention, the recombinant vector for surface expression of the microorganism is specifically, a primer sequence complementary to a gene encoding an outer membrane protein C (OmpC) consisting of a nucleotide sequence represented by any one of SEQ ID NO: 2 and SEQ ID NO: 3, and sequence It may be a recombinant vector for surface expression comprising a nucleotide sequence fused with a primer sequence complementary to a gene encoding a lithium binding peptide consisting of a nucleotide sequence represented by SEQ ID NO: 4 to SEQ ID NO: 5.

In addition, in the present invention, the surface expression method of the lithium binding peptide may comprise the step of culturing the transformed microorganism to express the lithium binding peptide on the surface of the microorganism. Preferably, the step of expressing the lithium-binding peptide on the surface of the cell may be carried out by treating IPTG (isopropyl β-D-1-thiogalactopyranoside) to the microorganism.

In the present invention, the "vector" refers to a nucleic acid molecule, preferably a self-replicating nucleic acid molecule, which delivers an inserted nucleic acid molecule into or between host cells. It includes both vectors that function for insertion of DNA or RNA into cells, replicas of vectors that primarily function for replication of DNA or RNA, and expression vectors that function for transcription and translation of DNA or RNA.

In the present invention, the microorganism is Escherichia coli, Salmonella typhi, Salmonella typhimurium, Vibrio cholera, Mycobacterium bovis, Shigella, Bacillus, Lactobacillus, Staphylococcus, Coryne bacteria, Listeria monocytogenes and Strap cacus It may be one or more selected from the group consisting of, if the microorganism capable of recombination so that the lithium-binding peptide can be expressed on the surface of the microorganism may be included without being limited thereto.

In the present invention, the "support" means a part in which the microorganism can be immobilized in the microorganism adsorbent. The present invention may be, for example, one or more selected from the group consisting of carbon fibers, ceramic fibers, metal fibers, polymer fibers, and mats woven or woven through the fibers. Preferably, the carbon cloth may be a carbon cloth woven or woven through the carbon fiber, but is not limited thereto.

According to another embodiment of the present invention, a method for preparing a microbial adsorbent is provided. Specifically, a) culturing the microorganism in which the lithium binding peptide is expressed on the cell surface; b) recovering the cultured microorganism of step a) and diluting in phosphate buffered saline; c) adsorbing the diluted microorganism and the support of step b); And d) immobilizing the adsorbed microorganism of step c) on a support.

In the method for preparing a microbial adsorbent of the present invention, the contents of the microorganism, the lithium-binding peptide, and the support on which the lithium-binding peptide is expressed on the surface overlap with those described in the microbial adsorbent, and thus, detailed descriptions thereof will be omitted.

In the present invention, the step of immobilizing the adsorbed microorganisms in the step d) is to put the microorganisms adsorbed on the support in a tetramethoxysilane solution, and then evaporate the tetramethoxysilane to form silica crosslinks It may be a step, but is not limited thereto.

In addition, in the present invention, the concentration of the microorganisms diluted in the step of recovering the microorganisms of step b) in dilute phosphate buffered saline may be an OD ₆₀₀ value of 10 to 30. When the concentration of the microorganism is less than OD ₆₀₀ 10, the number of microorganisms immobilized on the support is small, and when the concentration of the microorganism is higher than the OD ₆₀₀ 30, the microorganism is excessively immobilized on the support to maintain the desired lithium recovery efficiency.

Another embodiment of the present invention provides a method for recovering lithium ions from wastewater or seawater using a microbial adsorbent comprising a microorganism expressed on a surface of a lithium-binding peptide immobilized on a support.

In the method for recovering the lithium ions of the present invention, the contents related to the microorganism, the lithium-binding peptide, the immobilization, and the support on which the lithium-binding peptide is expressed on the surface overlap with those described in the microorganism adsorbent, and thus detailed descriptions thereof will be omitted.

In the present invention, the "recovery" may mean obtaining lithium ions by attaching to a lithium binding peptide present in a microbial adsorbent contained in waste water or seawater and then desorbing.

In the present invention, the method for recovering the lithium ions through the process of desorbing the lithium ions attached to the microorganism expressed on the surface of the lithium-binding peptide using a chelate compound such as ethylenediaminetetraacetic acid (EDTA) It may be done. For the purpose of the present invention, the recovery may be a desorption and attachment process can be reused at least once to 10 times. This is because the microorganisms expressed on the surface of the lithium-binding peptide are immobilized on the support, thereby inhibiting damage to the surface of the microorganisms generated in the process of desorbing the lithium ions attached to the microorganisms expressed on the surface, thereby increasing the number of times of use. Can be.

When using a microorganism adsorbent in which a recombinant microorganism having a lithium-binding peptide expressed on its surface is adsorbed on a support, the microorganism adsorbent significantly reduces the damage to the surface of the microorganisms caused by lithium desorption as compared to when the recombinant microorganism is used alone. Recycling efficiency can be maintained even when reused.

On the other hand, the effects described above are merely exemplary, and from the viewpoint of those skilled in the art, the effects predicted or expected from the detailed configuration of the present invention may also be added to the effects unique to the present invention.

1 shows a schematic diagram of a microbial adsorbent according to an embodiment of the present invention.
Figure 2 shows the results of measuring the surface of the microbial adsorbent according to an embodiment of the present invention using SEM.
Figure 3 shows before (left) and after immobilization (right) of the microorganism is immobilized on the support according to an embodiment of the present invention.
Figure 4 shows the reuse efficiency of the microbial adsorbent according to an embodiment of the present invention.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

Preparation Example Bacteria Strains and Media

Bacterial strains used to prepare the recombinant microorganism so that the lithium binding peptide is expressed on the surface are shown in Table 1 below. The bacterial strains were incubated at 37 ° C with 250 rpm shaking in LB medium (10 g / L bacto-typrone, 5 g / L bacto-yeast extract and 5 g / L NaCl) to which 100 mg / L ampicillin was added. It was.

Preparation Example 1 Production of Microorganisms in which Lithium Binding Peptides Expressed on the Surface

The MJ mini personal thermal cycler binds the gene of the lithium binding peptide to the C-terminus of the ompC gene cleaved in loop 8 (993 bp) and uses an Expand High Fidelity PCR system (Poche Molecular Biochemicals, Mannheim, Germany). Gene amplification was performed by PCR with Bio-Rad Laboratories, Hercules, CA, USA). As the lithium binding peptide, a lithium binding peptide GPGDP (hereinafter, referred to as a 'lithium binding peptide') corresponding to SEQ ID NO: 1 was used in consideration of codon usage. Primers used therein are as described in Table 2, respectively. Specifically, SEQ ID NOs: 2 and 3 correspond to primer sequences complementary to the gene encoding OmpC, and SEQ ID NOs 4 and 5 correspond to primer sequences complementary to the gene encoding the sequence in which SEQ ID NO: 1 is bound to OmpC. Corresponding.

name Sequence (5 '-> 3') SEQ ID NO: 2 CATATGATGAAAGTTAAAGT SEQ ID NO: 3 GGATCCTTATTACGGGTTGCCCGGGCCCATGTTTTTGTTGAAGTACTA SEQ ID NO: 4 CATATGATGAAAGTTAAAGT SEQ ID NO: 5 GGATCCTTATTACGGGTTGCCCGGGCCCGCTTTCGCCGCCGCTTCCGCCGGGTTGCCCGGGCC

The nucleotide PCR product prepared above was cloned into pET21a plasmid using Nde I and BamHI restriction enzymes to prepare recombinant vectors pET21a: OmpC and pET21a: GPGDP. Plasmids with dimeric repeats of lithium binding peptides were also prepared in the same manner as mentioned above. In order to induce the expression of OmpC-GPGDP, IPTG (isopropyl β-D-1-thiogalactopyranoside) controlled by the T7 promoter was added.

Recombinant plasmid prepared by the above process was transformed to E. coli BL21 (DE3) microorganisms, respectively, and then Preparation Example 1 through the process of inducing the expression of the desired peptide on the surface of the microorganism by treating with IPTG It was prepared and used for the following analysis.

Preparation Example 2 Preparation of Microbial Adsorbent

Using Preparation Example 1, which is a microorganism having a lithium-binding peptide expressed on its surface, a process of immobilization on a support was performed to prepare a microbial adsorbent.

The support is not limited as long as the microorganism can be immobilized, but the following microorganism adsorbent was prepared using a carbon cloth corresponding to a mat woven or woven through carbon fiber.

First, after culturing Preparation Example 1, the cultured Preparation Example 1 culture was concentrated through a centrifugal separator, to obtain only Preparation Example 1. Thereafter, the concentrated Preparation Example 1 was diluted to a concentration of OD ₆₀₀ = 20 in 10 mM Phosphate-Buffered Saline. Diluted Preparation Example 1 was adsorbed onto the carbon cloth by 0.5 mg-dcw / cm ² -surface concentration. Subsequently, immersion in a glass container containing tetramethoxysilane (TMOS), the tetramethoxysilane was evaporated to form silica crosslinking to immobilize Preparation Example 1 on the surface of the carbon cloth (CC) It was. Finally, Preparation Example 2, which is a microbial adsorbent, was prepared by sufficiently drying the carbon cloth to which Preparation Example 1 was immobilized. SEM and external shape photographs were taken to measure the immobilization and the results are shown in FIGS. 2 and 3.

As shown in Fig. 2 and 3, Preparation Example 1 is fixed to the surface of the carbon cloth (CC), and after the carbon cloth was washed, Preparation Example 1 was sufficiently fixed without change.

Example 1 Continuous Lithium Ion Recovery Using a Microbial Adsorbent

Preparation Example 2, which is a microbial adsorbent, confirmed the effect of being able to be reused by increasing the stability due to less damage to the surface of the microorganisms during lithium ion adsorption.

In the adsorption and desorption cycle of lithium ions, lithium ions were adsorbed by mixing Preparation Example 2 in a 20 mM LiCl solution and incubating for 30 minutes, and then desorbed and prepared in a 5 mM EDTA solution. Example 2 was washed with distilled water to remove the residue. The adsorption and desorption cycles were repeated from 1 to 10 times, respectively, and the concentration of lithium ions contained in the initial LiCl ion solution was analyzed using ICP-OES. The analysis results are shown in Table 3 and FIG. 4.

Sample
number Repeat count One 2 3 4 5 6 7 8 9 10 One 96.2 34.9 29.0 36.0 44.0 81.6 19.3 70.3 30.8 21.0 2 121.6 97.2 40.7 64.3 36.0 26.7 21.2 38.6 30.2 17.3 3 82.2 48.5 30.6 50.1 31.0 29.4 21.2 33.9 27.3 16.6 Average 100.0 60.2 33.4 50.1 37.0 45.9 20.5 47.6 29.5 18.3 SD 20.0 32.7 6.3 14.2 6.5 1.1 1.1 19.8 1.9 2.3

As shown in Table 3 and FIG. 4, when the adsorption and desorption cycles of lithium ions were performed once in preparation example 2, the average was 60.2% of reuse efficiency. Maintained very high levels. In addition, the reuse efficiency of about 37% was maintained when three to nine adsorption and desorption cycles were performed. Even with 10 adsorption and desorption cycles, a 20% reuse efficiency was maintained.

Through the above results, it can be seen that Preparation Example 2 according to the present invention can increase the reuse efficiency by inhibiting the process of damage to the outside of the microorganism by the chelating solution such as EDTA through the process of immobilization on the support.

Although the present invention has been described in detail above, the scope of the present invention is not limited thereto, and various modifications and variations can be made without departing from the technical spirit of the present invention described in the claims. It will be self-evident to those who have knowledge of.

100: microorganism with a lithium binding peptide expressed on the surface
200: support

<110> Korea institute of energy research <120> BIOSORBENT AND A METHOD FOR CONTINOSULY RECOVERING LITHUM USING          THE SAM <130> IPPAA2017-00411 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> lithium binding peptide <400> 1 Gly Pro Gly Asp Pro   1 5 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OmpC <400> 2 catatgatga aagttaaagt 20 <210> 3 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> OmpC <400> 3 ggatccttat tacgggttgc ccgggcccat gtttttgttg aagtacta 48 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OmpC-lithium binding peptide <400> 4 catatgatga aagttaaagt 20 <210> 5 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> OmpC-lithium binding peptide <400> 5 ggatccttat tacgggttgc ccgggcccgc tttcgccgcc gcttccgccg ggttgcccgg 60 gcc 63

Claims (14)

The support and the lithium binding peptide comprise microorganisms expressed on the surface,
The microorganism expressed on the surface of the lithium binding peptide is immobilized on the support,
The immobilization is formed by forming a silica crosslink, microbial adsorbent. The method of claim 1,
And the support is at least one member selected from the group consisting of carbon fibers, ceramic fibers, metal fibers, polymer fibers and mats woven or woven through the fibers. The method of claim 1,
The lithium binding peptide is SEQ ID NO: 1, microbial adsorbent. The method of claim 1,
The microorganism is from the group consisting of E. coli, Salmonella typhi, Salmonella typhimurium, Vibrio cholera, Mycobacterium bovis, Shigella, Bacillus, Lactic acid bacteria, Stephylococcus, Coryne bacteria, Listeria monocytogenes and Strap caucus It is one or more selected. delete a) culturing the microorganism in which the lithium binding peptide is expressed on the surface;
b) recovering the cultured microorganism of step a) and diluting in phosphate buffered saline;
c) adsorbing the diluted microorganism of step b) to a support; And
d) fixing the adsorbed microorganism of step c) to a support. The method of claim 6,
The step d) is a step of putting a microorganism adsorbed on a support into a tetramethoxysilane solution, the step of evaporating tetramethoxysilane to form a silica crosslink, microbial adsorbent manufacturing method. The method of claim 6,
The concentration of the diluted microorganism of step b) is the OD ₆₀₀ value of 10 to 30, microbial adsorbent manufacturing method. The method of claim 6,
The lithium binding peptide is SEQ ID NO: 1, microbial adsorbent manufacturing method. Claim 10 has been abandoned upon payment of a setup registration fee. The method of claim 6,
The support is at least one member selected from the group consisting of carbon fibers, ceramic fibers, metal fibers, polymer fibers and mats woven or woven through the fibers, microbial adsorbent manufacturing method. The support and the lithium binding peptide comprise microorganisms expressed on the surface,
The microorganism expressed on the surface of the lithium-binding peptide is a method for recovering lithium ions from wastewater or seawater using a microbial adsorbent immobilized on the support via silica crosslinking. The method of claim 11,
Wherein said lithium ion recovery is reusable at least once to 10 times. The method of claim 11,
And the support is at least one selected from the group consisting of carbon fibers, ceramic fibers, metal fibers, polymer fibers and mats woven or woven through the fibers. delete

Images