CN111676200B

CN111676200B - Salt-tolerant bacterial laccase, recombinant vector, recombinant bacterium, enzyme preparation, and preparation method and application thereof

Info

Publication number: CN111676200B
Application number: CN202010631204.0A
Authority: CN
Inventors: 王喜凤; 屈建航; 周佳; 李海峰; 宋明珠; 秦志磊
Original assignee: Henan University of Technology
Current assignee: Henan University of Technology
Priority date: 2020-07-03
Filing date: 2020-07-03
Publication date: 2022-06-24
Anticipated expiration: 2040-07-03
Also published as: CN111676200A

Abstract

The invention relates to a salt-tolerant bacterial laccase, a recombinant vector, a recombinant bacterium, an enzyme preparation, a preparation method and application thereof. The bacterial laccase has the gene derived from Bacillus thermoglucosidasus thermoglucosoidasius, can be used for dye decolorization, has high salt tolerance, can maintain the enzyme activity under the severe condition of high salinity, and effectively promotes the deep application of the laccase in the industrial aspect.

Description

Salt-tolerant bacterial laccase, recombinant vector, recombinant bacterium, enzyme preparation, and preparation method and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a salt-tolerant bacterial laccase, a recombinant vector, a recombinant bacterium, an enzyme preparation, and a preparation method and application thereof.

Background

Laccase (lacccase) (ec 1.10.3.2) is a copper-containing polyphenol oxidase enzyme widely distributed in fungi, bacteria, insects, and higher plants. Laccase can oxidize various phenolic and non-phenolic compounds by using molecular oxygen as an electron acceptor, and reduce the molecular oxygen into water. Laccase can be widely applied to aspects of dye wastewater treatment, biological paper pulp, biological remediation and the like because the laccase can oxidize phenols and other high-toxicity environmental pollutants, and is a novel bioremediation agent.

Compared with plant and animal laccases, the microbial laccase has rich sources and can be divided into fungal laccase and bacterial laccase, the fungal laccase is generally stable under normal temperature and acidic conditions, but the fungal laccase hardly keeps activity under extreme environments in industry such as high temperature, high salt and alkaline conditions, and the application prospect of the fungal laccase is limited. Bacterial laccases have received attention due to their broad substrate range, pH stability, thermal stability, and tolerance to alkaline environments. In the actual processes of dye wastewater treatment, biological pulp, bioremediation and the like, laccase needs to be in a salt-containing environment, but currently, relatively few researches on the salt tolerance of bacterial laccase are carried out, and the advanced application of laccase in industry is not facilitated.

In order to solve the above problems, people are always seeking an ideal technical solution.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides a salt-tolerant bacterial laccase which has high salt tolerance and promotes the deep application of the laccase in the industrial aspect.

Further, the invention also provides a recombinant vector, which comprises the nucleotide sequence of the salt-tolerant bacterial laccase.

Furthermore, the invention also provides a recombinant bacterium which comprises the recombinant vector.

Further, the invention also provides an enzyme preparation which comprises the salt-tolerant bacterial laccase.

Further, the invention also provides a preparation method of the salt-tolerant bacterial laccase.

Furthermore, the invention also provides the salt-tolerant bacterial laccase and application of the enzyme preparation.

In order to achieve the purpose, the invention adopts the technical scheme that:

a nucleotide sequence of the salt-tolerant bacterial laccase is shown in SEQ ID NO. 1.

Based on the above, the amino acid sequence of the salt-tolerant bacterial laccase is shown in SEQ ID NO. 2.

A recombinant vector comprising the nucleotide sequence of SEQ ID No. 1 of claim 1.

The preparation method of the recombinant vector comprises the following steps: and inserting the gene fragment of the salt-tolerant bacterial laccase into an expression vector, and screening after transformation.

A recombinant bacterium comprises the recombinant vector.

The preparation method of the recombinant bacterium comprises the following steps: and transforming the recombinant vector into a host cell, culturing and screening to obtain the recombinant vector.

The preparation method of the salt-tolerant bacterial laccase comprises the steps of culturing the recombinant bacteria, performing induced expression on the bacterial laccase, and purifying the bacterial laccase.

An enzyme preparation comprises the salt-tolerant bacterial laccase.

The salt-tolerant bacterial laccase and the application of the enzyme preparation in the aspect of dye decoloration.

Compared with the prior art, the salt-tolerant bacterial laccase has outstanding substantive characteristics and remarkable progress, and particularly, the salt-tolerant bacterial laccase provided by the invention is derived from the salt-tolerant bacterial laccaseparagebacillus thermoglucosidasiusIt belongs to the bacteria, pairparagebacillus thermoglucosidasiusThe laccase gene in the genome is cloned and expressed in the Escherichia coli, and a stable Escherichia coli expression strain is obtained. The laccase protein with high stability is obtained by nickel column affinity chromatography, the bacterial laccase has strong salt tolerance, can still maintain ultrahigh activity in 12% NaCl solution, can maintain enzyme activity under high salinity severe condition, and is convenient forThe bacterial laccase is deeply applied to industry.

Drawings

FIG. 1: in the embodiment, the electrophoresis band of the PCR amplification electrophoresis picture of the salt-tolerant bacteria laccase gene is clear and is 816 bp in size.

FIG. 2: in the examples, SDS-PAGE patterns were purified by affinity chromatography for heterologous expression, wherein 1, 2: the target protein is purified; 3. 4: washing the chromatographic column with a buffer solution; 5: sampling after induction is completed; 6: sampling before adding the inducer; m: marker.

FIG. 3: the temperature-enzyme activity curve (a) and the pH-relative enzyme activity curve (b) of the salt-tolerant bacterial laccase in the examples.

FIG. 4 is a schematic view of: salt-tolerant performance of the salt-tolerant bacterial laccase in the examples.

FIG. 5: the salt tolerant bacterial laccase in the examples has dye decolorizing properties for crystal violet and congo red.

Detailed Description

The technical solution of the present invention is further described in detail by the following embodiments.

This example provides a salt-tolerant bacterial laccase, whose gene is derived from Bacillus thermoglucosidaseparagebacillus thermoglucosidasius(deposited in the German Collection of microorganisms and cell cultures, number DSM 2542, available from the Shanghai Bai-bright-day Biotech centre), genome extraction by the Tiangen Biotech (Beijing) Ltd, search of the reported gene bank by the NCBI Gene BankP. thermoglucosidasiusAnd (3) analyzing a conserved sequence of the mature peptide gene of the laccase, and designing a primer for amplification to obtain a nucleotide sequence of the salt-tolerant bacterial laccase shown as SEQ ID NO. 1 and an amino acid sequence shown as SEQ ID NO. 2.

Specifically, the specific method for extracting the genome is as follows:

1. 1-5 ml of the bacterial culture was centrifuged at 10,000 rpm (11,500 Xg) for 1 min, and the supernatant was aspirated as clean as possible.

2. 200. mu.l of buffer GA was added to the pellet, and the pellet was shaken until the pellet was completely suspended.

3. Add 20. mu.l of protease K solution to the tube and mix well.

4. Add 220. mu.l buffer GB, shake for 15sec, stand at 70 ℃ for 10 min, clear the solution, centrifuge briefly to remove beads on the inner wall of the tube cover.

5. Add 220. mu.l of absolute ethanol, mix well for 15sec with shaking, at which time a flocculent precipitate may appear, and centrifuge briefly to remove water droplets on the inner wall of the tube cover.

6. The solution and flocculent precipitate obtained in the previous step were added to an adsorption column CB3 (adsorption column placed in collection tube), centrifuged at 12,000 rpm (. about.13,400 Xg) for 30 sec, the waste liquid was decanted, and adsorption column CB3 was placed in collection tube.

7. To adsorption column CB3, 500. mu.l of buffer GD 12,000 rpm (. about.13,400 Xg) was added and centrifuged for 30 sec, and the waste liquid was discarded, and adsorption column CB3 was put into the collection tube.

8. 600. mu.l of the rinsing solution PW was added to the adsorption column CB3, and centrifuged at 12,000 rpm (. about.13,400 Xg) for 30 sec to discard the waste liquid, and the adsorption column CB3 was put into the collection tube.

9. Operation 8 is repeated.

10. The adsorption column CB3 was returned to the collection tube, centrifuged at 12,000 rpm (. about.13,400 Xg) for 2min, and the waste liquid was discarded. The adsorption column CB3 was left at room temperature for several minutes to completely dry the residual rinse solution in the adsorption material.

11. Transferring the adsorption column CB3 into a clean centrifuge tube, suspending and dripping 50-200 mu l of elution buffer TE into the middle part of the adsorption membrane, standing for 2-5 min at room temperature, centrifuging for 2min at 12,000 rpm (13,400 Xg), and collecting the solution into the centrifuge tube.

Searching the reported P. thermogluconasius laccase mature peptide gene through an NCBI gene library, analyzing the conserved sequence of the P. thermogluconasius laccase mature peptide gene, and designing the amplification primer of the laccase mature peptide coding gene of the invention as follows:

upstream primer F5 'CCGGCATATGTTAGACATTTTTCAACAAGCG 3'

Downstream primer R5 'CAAACTCGAGTTCCCCCTTCCTGCCGATAAAC 3'

F and R are used for amplifying the base sequence of the bacterial laccase, and restriction enzyme cutting sites NdeI and XhoI and corresponding protection bases are introduced into the 5' ends of the two primers. The amplification template is the genome of the Paragene bacillus thermoglucopyranosiduasius, and the amplification reaction system is shown in the following table 1:

TABLE 1 amplification reaction System

The PCR reaction parameters were set as:

firstly, carrying out thermal start pre-denaturation for 2min at 95 ℃;

② denaturation at 98 ℃ for 10 sec;

annealing at 55 ℃ for 15 sec;

extension at 72 ℃ for 10 sec;

fifthly, the steps of (1), (III) and (IV) are circulated for 31 times;

sixthly, extending for 5min at 72 ℃ to obtain the salt-tolerant bacterial laccase gene (PthLac), wherein the electrophoresis band of the PCR amplification electrophoresis picture is clear and is 816 bp in size, as shown in figure 1.

The present embodiment also provides a recombinant vector, which is prepared by the steps of:

the salt-tolerant bacterial laccase gene (PthLac) which is amplified by the PCR and is recovered after double enzyme digestion by NdeI and XhoI is connected with an escherichia coli expression vector pET30a which is subjected to the same double enzyme digestion by T4 ligase, a connection product is transformed into escherichia coli DH5 alpha competent cells, kanamycin resistance screening is carried out, transformants are selected, colony PCR is carried out by using universal primers T7 and T7-ter, a positive transformant plasmid is extracted, double enzyme digestion verification and sequencing are carried out, and a correctly constructed recombinant vector (heterologous expression plasmid pET30 a-PthLac) is determined.

In other embodiments, other expression vectors known in the art may be used.

The embodiment also provides a recombinant bacterium, which comprises the following preparation steps:

coli BL21(DE3) competent cells were thawed on ice, and 2. mu.l of pET30a-PthLac were added to the competence, gently mixed, and placed on ice for about 30 minutes. The heat shock was applied to a water bath at 42 ℃ for 1 minute, removed and placed on ice for 5 minutes. 900. mu.l of LB liquid medium was added and incubated for 1 h at 37 ℃ in a shaker. Centrifuge at 2500 Xg for 2min and discard the supernatant. And (3) coating the transformed competent cells on an LB solid plate containing kanamycin antibiotics, carrying out overnight culture at 37 ℃, selecting transformants, and carrying out colony PCR verification by using universal primers T7 and T7-ter to obtain the escherichia coli high-stability salt-tolerant bacterial laccase recombinant strain BL 21-PthLac.

The embodiment also provides a preparation method of the bacterial laccase, which comprises the following steps:

1. inducible expression of salt-tolerant bacterial laccase

Inoculating the novel bacterial laccase in an LB liquid culture medium for culturing at the temperature of 37 ℃ and the rpm of 170 to OD600 to about 0.8 in an Escherichia coli recombinant bacterium, and adding 0.5 mM isoproyl-beta-D-thiogalactopyranoside (IPTG) to induce the mass expression of the target protein. After addition of IPTG, the flask was shaken at 16 ℃ and incubated at 100 rpm for about 24 h. The cells were harvested by centrifugation at 8000 Xg for 5min, resuspended in the appropriate amount of binding buffer, and sonicated (4 s sonication, pause for 8 s, power 300W, 99 cycles) to obtain cell lysates and centrifuged at 13500 Xg for 30 min to remove cell debris. The supernatant obtained by centrifugation is a crude protein solution containing a large amount of the target protein.

2. Purification and preparation of salt-tolerant bacterial laccase

The target protein heterologously expressed in Escherichia coli BL21(DE3) contains a histidine (6 XHis) tag, and the purified protein is obtained by affinity chromatography with Ni-NTA resin, and the SDS-PAGE pattern of the chromatographic purification is shown in FIG. 2. The specific purification steps are as follows:

(1) the Ni-NTA resin is generally stored in 20% ethanol, and is balanced for 5-6 column volumes by ultrapure water before use, and then is balanced for 5-6 column volumes by a binding buffer solution for later use.

(2) And uniformly mixing the crude protein solution and the affinity medium Ni-NTA resin to ensure that the target protein is fully adsorbed on the affinity medium. The incubation can be performed for 30 minutes with shaking on ice to ensure that the protein of interest is adsorbed onto the affinity medium.

(3) The Ni-NTA resin was washed with 20 column volumes of binding buffer and elution-heteroprotein buffer, respectively, to sufficiently remove the heteroprotein.

(4) Finally, eluting the target protein by using a buffer solution for eluting the target protein, preparing an SDS-PAGE sample, adding 5-10% of glycerol into the rest proteins, and storing at-70 ℃.

(5) And (3) regenerating the Ni-NTA resin of the affinity medium.

This example also provides an enzyme preparation comprising the above-described halotolerant bacterial laccase and other ingredients acceptable in the art, which can be used for dye decolorization.

Determination of enzymatic Properties

1. Optimum reaction temperature and optimum reaction pH.

3 mL of the reaction system contained 2 mL of Na₂HPO₄-KH₂PO₄ Na₂HPO₄-KH₂PO₄Buffer solution, 600 mu L4 mmol.L^-1Guaiacol, 10mM Cu²⁺And 400 mu L of appropriately diluted enzyme solution are reacted for 1 h at corresponding temperature, and the light absorption value of 465 nm is determined.

Detecting the optimum pH of PthLac, and respectively preparing Na with pH of 4.0, pH 5.0, pH6.0, pH 7.0, pH 8.0, and pH 9.0₂HPO₄-KH₂PO₄The buffer solution is used for measuring the enzyme activity, guaiacol is used as a substrate, the highest enzyme activity is 100%, and the detection data is shown in figure 3 (a), and the optimal reaction temperature is about 60 ℃ as can be seen from figure 3 (a).

The optimum temperature of PthLac is detected at the optimum pH, the enzyme reaction temperature is respectively set to 45 ℃,50 ℃, 55 ℃, 60 ℃, 65 ℃ and 75 ℃, guaiacol is used as a substrate, the enzymatic activity of the halotolerant bacterial laccase is measured, and the detection data is shown in figure 3 (b), and the optimum pH =6 can be known from figure 3 (b).

2. Tolerance of PthLac to NaCl

The tolerance of PthLac to NaCl is measured at the optimum pH and the optimum reaction temperature. The crude enzyme solution is respectively subjected to heat preservation for 0 h, 3 h, 6 h, 9 h and 12 h at the temperature of 0 ℃ under the pH value of 6.0, NaCl solutions with final concentrations of 3%, 6%, 9% and 12% (w/v) are respectively added before heat preservation, and then the change of the enzyme activity is measured at the optimal reaction temperature of the enzyme, the test data are shown in figure 4, and the bacterial laccase obtained in the embodiment still keeps higher activity in the solution with the NaCl concentration of 12% according to the figure 4.

3. Dye decolorization

The dye decolouring effect of PthLac is 25 mg.L-1 of crystal violet and Congo red. The reaction system is 400 muL of enzyme diluent, 600 muL of dye and 1 mL of pH6.0 Na₂HPO₄-KH₂PO₄Decolorizing the buffer at 40 deg.C for 3 hr, measuring absorbance of each dye at the maximum absorption wavelength with spectrophotometer, repeating the measurement for 3 times, and decolorizing ratio (%) = (A)₀-A) /A₀X 100%. In the formula, A₀The initial dye light absorption value is A, the light absorption value is measured during sampling, and the test data are shown in FIG. 5. As shown in FIG. 5, the salt-tolerant bacterial laccase prepared in the embodiment has good decoloring performance on the dyes of crystal violet and congo red, so that the salt-tolerant bacterial laccase prepared in the embodiment can be applied to dye decoloring.

Finally, it should be noted that: the above examples are only intended to illustrate the technical solution of the present invention and not to limit it; although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that: modifications of the embodiments of the invention or equivalent substitutions for parts of the technical features are possible; without departing from the spirit of the invention, it is intended to cover all modifications within the scope of the invention as claimed.

SEQUENCE LISTING

<110> industrial university of Henan

<120> salt-tolerant bacterial laccase, recombinant vector, recombinant bacterium, enzyme preparation, preparation method and application thereof

<130> 2020

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 816

<212> DNA

<213> Bacillus thermoglucosidases (Paragebacillus thermoglucosidasius)

<400> 1

atgttagaca tttttcaaca agcgggagaa gagatgctgt tgttgcacgg ccgctgttcg 60

tttcctaatc ttgtcgccgg atttacgacg aaacacggag gcgtcagcaa aggagcgttt 120

gcgacgttca atttagggct gcatgttggc gatgaggttt cttctgtttg ccgcaatcgg 180

cagcggctgg cggatctgct ccaatttccg ctggaacaat gggtatgttg cgaacaaata 240

cacgatgccc gcatcgaaaa ggtgacaagc agccaaagcg ggaaaggagc ggcggattac 300

aagtcagcca ttgctgggac ggacggcttg tatacaaaag aagctggatt gctgcttgcc 360

ttatgtttcg ctgattgcgt accgctttat tttatggcgc cgaaacatgg catgatcggt 420

cttgctcatg ccggctggcg gggaacggta aaaaacattg cgggagaaat gattcacctt 480

tggcatgagc gtgaacatat tcctttggat gacatatatg tggcgatcgg tccggcgatt 540

ggcgcttgct gctatatcgt cgatgaccgc gtcatcacgt acgttgattg cattttggat 600

ggtgaacagg ctccctataa gcaagtgagc ataggacaat atgcccttga tttaaaagag 660

ctgaataaag tattactgat acaggcagga gttcgtgaag aacatattga tatttccggg 720

tattgtacga gttgcgctga ttatttgttt ttttcccatc gtcgcgatca aggaaaaaca 780

ggaagaatga tggcgtttat cggcaggaag ggggaa 816

<210> 2

<211> 272

<212> PRT

<213> Bacillus thermoglucosidases (Paragebacillus thermoglucosidasius)

<400> 2

Met Leu Asp Ile Phe Gln Gln Ala Gly Glu Glu Met Leu Leu Leu His

1 5 10 15

Gly Arg Cys Ser Phe Pro Asn Leu Val Ala Gly Phe Thr Thr Lys His

20 25 30

Gly Gly Val Ser Lys Gly Ala Phe Ala Thr Phe Asn Leu Gly Leu His

35 40 45

Val Gly Asp Glu Val Ser Ser Val Cys Arg Asn Arg Gln Arg Leu Ala

50 55 60

Asp Leu Leu Gln Phe Pro Leu Glu Gln Trp Val Cys Cys Glu Gln Ile

65 70 75 80

His Asp Ala Arg Ile Glu Lys Val Thr Ser Ser Gln Ser Gly Lys Gly

85 90 95

Ala Ala Asp Tyr Lys Ser Ala Ile Ala Gly Thr Asp Gly Leu Tyr Thr

100 105 110

Lys Glu Ala Gly Leu Leu Leu Ala Leu Cys Phe Ala Asp Cys Val Pro

115 120 125

Leu Tyr Phe Met Ala Pro Lys His Gly Met Ile Gly Leu Ala His Ala

130 135 140

Gly Trp Arg Gly Thr Val Lys Asn Ile Ala Gly Glu Met Ile His Leu

145 150 155 160

Trp His Glu Arg Glu His Ile Pro Leu Asp Asp Ile Tyr Val Ala Ile

165 170 175

Gly Pro Ala Ile Gly Ala Cys Cys Tyr Ile Val Asp Asp Arg Val Ile

180 185 190

Thr Tyr Val Asp Cys Ile Leu Asp Gly Glu Gln Ala Pro Tyr Lys Gln

195 200 205

Val Ser Ile Gly Gln Tyr Ala Leu Asp Leu Lys Glu Leu Asn Lys Val

210 215 220

Leu Leu Ile Gln Ala Gly Val Arg Glu Glu His Ile Asp Ile Ser Gly

225 230 235 240

Tyr Cys Thr Ser Cys Ala Asp Tyr Leu Phe Phe Ser His Arg Arg Asp

245 250 255

Gln Gly Lys Thr Gly Arg Met Met Ala Phe Ile Gly Arg Lys Gly Glu

260 265 270

Claims

1. The application of bacterial laccase with nucleotide sequence shown as SEQ ID NO. 1 and amino acid sequence shown as SEQ ID NO. 2 in high salinity severe environment; the concentration of sodium chloride in the high salinity harsh environment is up to 12%.

2. Use according to claim 1, characterized in that: the bacterial laccase is applied to the aspect of dye decolorization.

3. The use of claim 1, wherein the bacterial laccase is prepared by a method comprising: inserting the gene fragment of the bacterial laccase into an expression vector, and screening after transformation to obtain a recombinant vector; transforming the recombinant vector into a host cell, culturing and screening to obtain a recombinant bacterium; inducing to express bacterial laccase, and purifying the bacterial laccase to obtain the bacterial laccase.