CN106939304B - Salt-adaptability-improved endo-xylanase shuffling mutant and preparation method and application thereof - Google Patents

Abstract

the invention relates to the technical field of genetic engineering and protein modification, in particular to a salt-adaptively improved endo-xylanase mutant and a preparation method and application thereof, wherein the amino acid sequence of the mutant S35H04 is shown as SEQ ID NO.1, the optimum pH is 5.0, the optimum temperature is 65 ℃, the half-life period at 50 ℃ is 30min₂、FeSO₄The activity in NaCl of 20.0-25.0% (w/v) and the activity in KCl of 10.0-30.0% (w/v) were improved. The mutant endo-xylanase S35H04 can be applied to the fields of food industry, marine product processing and high-salt environment biotechnology.

Description

Salt-adaptability-improved endo-xylanase shuffling mutant and preparation method and application thereof

Technical Field

The invention relates to the technical field of genetic engineering and protein modification, in particular to an endoxylanase mutant with improved salt adaptability and application thereof.

Background

The main chain of xylan is polysaccharide polymerized from xylose, and the side chain contains L-arabinose residue. Xylan is the most abundant polysaccharide in hemicellulose, widely exists in crop resources such as corncobs, bagasse, wheat bran, straws and the like, and can account for one third of the dry weight of plant cells at most. The endo-xylanase can degrade a xylan backbone structure to generate xylooligosaccharide and/or xylose, and can be applied to the fields of food, wine brewing, feed, textile, paper making and the like (Collins et al FEMS Microbiol Rev,2005,29: 3-23.).

The haloduric enzyme can be applied to the biotechnology fields of high-salt food and marine product processing and other high-salt environments, such as pickled food processing, high-salt dilute soy sauce fermentation, washing and the like; processing food in a high salt environment also prevents contamination by microorganisms, saves energy consumed by sterilization, etc. (Margesin and Schinner, Extremophiles,2001,5: 73-83.). However, most of the enzymes do not have good catalytic activity at high salt concentration due to salting-out action at high salt concentration.

Disclosure of Invention

The invention aims to provide a salt adaptability-improved endoxylanase mutant S35H04, wherein the amino acid sequence of the mutant S35H04 is shown as SEQ ID NO. 1.

In the invention of the application, the optimum pH of the mutant S35H04 is 5.0, the optimum temperature is 65 ℃, the half-life period at 50 ℃ is 30min, the mutant has 62-69% of activity in 20.0-25.0% (v/v) NaCl and 103-112% of enzyme activity in 10.0-30.0% (w/v) KCl.

The second purpose of the invention is to provide a coding gene S35H04 of the endoxylanase mutant S35H04 with improved salt adaptability, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 2.

The third purpose of the invention is to provide a recombinant vector containing the gene S35H04 coded by the endoxylanase mutant S35H 04.

The fourth purpose of the invention is to provide a recombinant bacterium containing an endoxylanase mutant S35H04 encoding gene S35H 04.

The fifth purpose of the invention is to provide the application of the endo-xylanase mutant S35H04 with improved salt adaptability in the food field.

The invention also provides a preparation method of the endo-xylanase mutant S35H04 with improved salt adaptability, which comprises the following steps:

1) connecting the s35h04 with an expression vector pEasy-E2, and transforming the connection product into escherichia coli BL21-Gold (DE3) to obtain a recombinant strain containing s35h 04;

2) culturing the recombinant strain, and inducing the expression of the recombinant mutant endo-xylanase;

3) recovering and purifying the expressed mutant endo-xylanase S35H 04.

4) And (4) measuring the activity.

the invention has the beneficial technical effects that compared with wild enzymes, the salt adaptability of the mutant endo-xylanase S35H04 is changed, the optimum pH values of the purified mutant enzyme S35H04, the wild enzymes rXynAGN16L and rXynAHJ3 are 5.0, 5.5 and 6.0 respectively, the optimum temperatures are 65 ℃, 50 ℃ and 75 ℃, the endo-xylanase rXynAHJ3 is stable at 50 ℃, the rXynAGN16L is extremely unstable at 50 ℃, the half-life period of S35H04 at 50 ℃ is about 30min, and the half-life period of beta-Mercaptoethanol, CoCl is 10.0mM₂And FeSO₄In the mutant S35H04, the enzyme activity is respectively 24%, 25% and 37% higher than that of the wild enzyme rXynAHJ 3; in 20.0-25.0% (w/v) NaCl, the enzyme activity of the mutant S35H04 is 18-33% higher than that of wild enzymes rXynAHJ3 and rXynAGN 16L; in KCl of 10.0-30.0% (w/v), the enzyme activity of the mutant S35H04 is 15-30% higher than that of the wild enzyme rXynAHJ3, and 25-55% higher than that of the wild enzyme rXynAGN 16L. The mutant endo-xylanase S35H04 can be applied to the fields of food industry, marine product processing and high-salt environment biotechnology.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.

FIG. 1: SDS-PAGE analysis of recombinant endoxylanases rXynAGN16L, rXynAHJ3 and its mutant S35H04 expressed in e.coli, wherein CK: a protein Marker;

FIG. 2: the pH activity of the recombinant endoxylanase rXynAGN16L, rXynAHJ3 and the mutant S35H04 thereof;

FIG. 3: the pH stability of the recombinant endoxylanase rXynAGN16L, rXynAHJ3 and the mutant S35H04 thereof;

FIG. 4: thermal activity of recombinant endoxylanase rXynAGN16L, rXynAHJ3 and mutant S35H04 thereof;

FIG. 5: the thermal stability of the recombinant endoxylanase rXynAGN16L, rXynAHJ3 and the mutant S35H04 thereof;

FIG. 6: the activity of recombinant endoxylanase rXynAGN16L, rXynAHJ3 and mutant S35H04 thereof in NaCl;

FIG. 7: activity of recombinant endoxylanase rXynAGN16L, rXynAHJ3 and mutant S35H04 thereof in KCl.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Test materials and reagents

1. Bacterial strain and carrier: escherichia coli BL21-Gold (DE3) and expression vector pEasy-E2 were purchased from Beijing Quanyujin Biotechnology Ltd; arthrobacter (Arthrobacter sp.) and varelia sericata (Lechevalieria sp.) are offered by university of mazechu in Yunnan.

2. Enzymes and other biochemical reagents: DNA polymerase and dNTP were purchased from Beijing Quanjin Biotechnology Ltd, beech xylan was purchased from Sigma, corncob xylan was purchased from Shanghai leaf Biotechnology Ltd, error-prone PCR kit was purchased from Beijing Tianenzur Gene technology Ltd, bacterial genome extraction kit was purchased from GENE STAR, PopCulture^TMCell lysates were purchased from Merck group, Inc., Germany, and were all made in the home (all available from general Biochemical Co., Ltd.).

3. Culture medium:

LB culture medium: peptone 10g, Yeast extract 5g, NaCl 10g, distilled water to 1000mL, natural pH (about 7). On the basis of the solid medium, 2.0% (w/v) agar was added.

Description of the drawings: the molecular biological experiments, which are not specifically described in the following examples, were performed according to the methods listed in molecular cloning, a laboratory manual (third edition) J. SammBruker, or according to the kit and product instructions.

Example 1: construction of a mutant library

the genome of Arthrobacter (Arthrobacter sp.) and that of Variella denticulata (Lechevalieria sp.) were extracted according to the instruction of the bacterial genome extraction kit of GENE STAR.

② designing primers 5'GTGCAGCCGGAGGAAAAACG 3' and 5'GATGAAGGCAGGATCCGGGGT 3' according to nucleotide sequence JQ863105(SEQ ID No.3) of endoxylanase of Arthrobacter (Arthrobacter sp.) recorded by GenBank, carrying out PCR amplification by taking genome of Arthrobacter (Arthrobacter sp.) as a template to obtain endoxylanase gene xynAGN16L, and designing primers 5'GTCTCGGCCCCGCCGGACGT 3' and 5'GGCTCGCTTCGCCAGCGTGG 3' according to nucleotide sequence JF745868(SEQ ID No.4) of endoxylanase of Lechevalieriasp (Lechevalieriasp.) recorded by GenBank, carrying out PCR amplification by taking genome of Lechevalieriasp (Lechevalieria sp.) as a template to obtain endoxylanase gene xynJ 3.

PCR parameters are 94 ℃ denaturation for 5min, 94 ℃ denaturation for 30sec, 55 ℃ annealing for 30sec, 72 ℃ extension for 1min and 30sec, and 30 cycles of 72 ℃ heat preservation for 10 min.

and fourthly, performing gene mutation by using the PCR product as a template and using an error-prone PCR kit according to the kit instruction.

and fifthly, performing ultrasonic random interruption on the error-prone PCR product by using an ultrasonic interruption instrument Biorupt, and cutting and purifying the interrupted product after 2% agarose gel electrophoresis.

sixthly, carrying out DNA family shuffling (DNAfamilyshuffling) PCR by using the purified small fragment DNA as a primer and a template, wherein the PCR reaction parameters comprise denaturation at 96 ℃ for 1min and 30sec, then denaturation at 94 ℃ for 30sec, annealing at 65 ℃ for 90sec, annealing at 62 ℃ for 90sec, annealing at 59 ℃ for 90sec, annealing at 56 ℃ for 90sec, annealing at 53 ℃ for 90sec, annealing at 50 ℃ for 90sec, annealing at 47 ℃ for 90sec, annealing at 44 ℃ for 90sec, annealing at 41 ℃ for 90sec, extension at 72 ℃ for 1min and 30sec, and heat preservation at 72 ℃ for 7min after 35 cycles.

using purified DNA family reorganization PCR product as a template, and carrying out sequence full-length amplification by using amplification primers of endoxylanase genes xynAHJ3 and xynAGN16L and reaction conditions, wherein the amplification product contains a mutation sequence and an unmutation sequence.

ninthly, connecting the full-length amplification product of the sequence with an expression vector pEasy-E2, transforming the connection product into escherichia coli BL21-Gold (DE3), culturing overnight, and picking a single colony from a transformation plate to a liquid LB culture solution (containing 100 mu g mL) containing 150 mu L of liquid LB culture solution^-1Amp) was cultured in a 96-well cell culture plate at 37 ℃ for about 16 hours with rapid shaking, and then 50. mu.L of 40% (w/w) glycerol was added to each well, and the mixture was mixed well and stored at-70 ℃.

Example 2: screening of mutants

1) mu.L of the bacterial suspension was collected from a 96-well cell culture plate for storing the mutant library, and inoculated into LB medium containing 200. mu.L/well (containing 100. mu.g mL)^-1Amp) in a 96 deep well plate, cultured at 37 ℃ and 200rpm with shaking to OD₆₀₀>1.0 (about 20h), add 2mM IPTG and 100. mu.g mL^-1Amp 200 u L liquid LB culture medium, at 20 degrees C, 160rpm overnight induction.

2) After induction, 40. mu.L/well of PopCulture was added^TMCell lysate was used to lyse cells at 25 ℃ for 30min with shaking.

3) 50 μ L of McIlvaine buffer (pH 7.0) containing 1.0% (w/v) beech xylan and 50 μ L of cell lysate were reacted in a 96-well plate at 70 ℃ for 2 h. Adding 150 microliter DNS reagent to terminate the reaction after the reaction is finished, preserving the heat in a thermostat at 140 ℃ for more than 20min, cooling to room temperature, and reading OD by using a microplate reader_540nmThe control was E.coli BL21-Gold (DE3) strain lysate reaction group containing only empty vector pEASY-E2.

4) mu.L of the mutant cell lysate having endoxylanase activity was taken, and 90. mu.L of McIlvaine buffer (pH 7.0) containing 0.5% (w/v) beech xylan was added with 10% (w/v) and 25% (w/v) NaCl and reacted in a 96-well plate at 70 ℃ for 10 min.

5) Adding 150 microliter DNS reagent to terminate the reaction after the reaction is finished, preserving the heat in a thermostat at 140 ℃ for more than 20min, cooling to room temperature, and reading OD by using a microplate reader_540nmThe corresponding mutant lysate reaction group without NaCl was used as a control.

6) Comparing the enzyme activity of the mutant with that of wild recombinant enzymes rXynAGN16L and rXynAHJ3 to obtain 1 mutant with the serial number of S35H04, wherein the 1 mutant has the enzyme activity improved in 10% (w/v) and 25% (w/v) NaCl, the amino acid sequence of the mutant is shown as SEQ ID NO.1 and is a shuffling heterozygote of two wild enzymes, and the nucleotide sequence of the mutant is shown as SEQ ID NO. 2.

Example 3: preparation of mutant S35H04 and wild enzymes rXynAGN16L and rXynAHJ3

The recombinant strains containing the mutant S35H04, the wild enzymes rXynAGN16L and rXynAHJ3 were inoculated to LB (containing 100. mu.g mL of plasmid) at an inoculum size of 0.1% respectively^-1Amp) in the culture medium, the mixture was rapidly shaken at 37 ℃ for 16 hours.

The activated bacterial suspension was then inoculated into fresh LB (containing 100. mu.g mL) at an inoculum size of 1%^-1Amp) culture solution, rapidly shaking for about 2-3 h (OD)₆₀₀0.6-1.0) was reached, induction was carried out by adding IPTG at a final concentration of 0.1mM, and shaking culture was continued at 20 ℃ for about 20 hours. Centrifugation was carried out at 12000rpm for 5min to collect the cells. After suspending the cells in an appropriate amount of Tris-HCl buffer (pH 7.0), the cells were sonicated in a low temperature water bath. After the crude enzyme solution concentrated in the above cells was centrifuged at 13,000rpm for 10min, the supernatant was aspirated and the objective protein was respectively subjected to affinity purification using Nickel-NTAAgarose and 0-500 mM imidazole.

The SDS-PAGE results (FIG. 1) show that the mutant enzyme S35H04, the wild enzyme rXynAGN16L and rXynAHJ3 are all purified, and the product is a single band.

Example 4: determination of Properties of purified enzymes of mutant S35H04 and wild enzymes rXynAGN16L and rXynAHJ3

1) Activity analysis of the mutant S35H04 and the purified enzymes of the wild enzymes rXynAGN16L and rXynAHJ3

The activity determination method adopts a 3, 5-dinitrosalicylic acid (DNS) method: dissolving the substrate in a buffer solution to a final concentration of 0.5% (w/v); the reaction system contains 100 mu L of proper enzyme solution and 900 mu L of substrate; preheating a substrate at a reaction temperature for 5min, adding an enzyme solution, reacting for 10min, adding 1.5mL of DNS (Domain name System) to terminate the reaction, boiling in boiling water for 5min, cooling to room temperature, and measuring an OD (optical Density) value at a wavelength of 540 nm; 1 enzyme activity unit (U) is defined as the amount of enzyme required to break down the substrate to produce 1. mu. mol reducing sugars (calculated as xylose) per minute under the given conditions.

2) Determination of pH activity and pH stability of purified enzymes of mutant S35H04 and wild enzymes rXynAGN16L and rXynAHJ 3:

determination of the optimum pH of the enzyme: the enzyme solution was placed in a buffer solution of pH 4.0-12.0 at 37 ℃ to carry out an enzymatic reaction. Determination of the pH stability of the enzyme: the enzyme solution was treated at 37 ℃ for 1 hour in a buffer solution having a pH of 3.0 to 12.0, and then an enzymatic reaction was carried out at 37 ℃ and a pH of 7.0, with the untreated enzyme solution being used as a control. The buffer solution is as follows: McIlvaine buffer (pH 3.0-8.0) and 0.1M glycine-NaOH (pH 9.0-12.0). And (3) taking beech xylan or corncob xylan as a substrate, reacting for 10min, and determining the enzymatic properties of the purified endo-xylanase. The results show that: the optimum pH of the mutant enzyme S35H04, the wild purified enzymes rXynAGN16L and rXynAHJ3 were 5.0, 5.5 and 6.0, respectively (fig. 2); S35H04 and rXynAHJ3 were stable and rXynAGN16L were unstable at pH 5.0, but S35H04 was unstable and rXynAGN16L and rXynAHJ3 were stable at pH 11.0 (fig. 3).

3) Determination of the thermal activity and thermal stability of the purified enzymes of mutant S35H04 and the wild enzymes rXynAGN16L and rXynAHJ 3:

determination of the thermal activity of the enzyme: the enzymatic reaction was carried out at 0-90 ℃ in a buffer at pH 7.0. Determination of the thermostability of the enzyme: after treating the enzyme solution with the same amount of enzyme at 37 ℃ for 0-60 min, the enzyme reaction was carried out at pH7.0 and 37 ℃ with untreated enzyme solution as a control. And (3) taking beech xylan or corncob xylan as a substrate, reacting for 10min, and determining the enzymatic properties of the purified endo-xylanase. The results show that: the optimal temperatures of S35H04, rXynAGN16L and rXynAHJ3 are 65 ℃, 50 ℃ and 75 ℃ respectively, and the enzyme activities of 81.1%, 17.7% and 97.7% are respectively at 70 ℃ (figure 4); rXynAHJ3 was stable at 50 ℃, rXynAGN16L was very unstable at 50 ℃ and the half-life of S35H04 at 50 ℃ was approximately 30min (fig. 5).

4) Influence of different metal ions and chemical reagents on the activity of purified enzymes of mutant S35H04 and wild enzymes rXynAGN16L and rXynAHJ 3:

10.0mM of metal ions and chemical reagents were added to the enzymatic reaction system to examine the effect on the enzymatic activity. The enzyme activity was determined at 37 ℃ and pH7.0 using beech xylan or corncob xylan as substrate. The results (table 1) show that: 10.0mM HgCl₂can completely inhibit S35H04, rXynAGN16L and rXynAHJ3, beta-Mercaptoethanol and CoCl at 10.0mM₂And FeSO₄In the mutant S35H04, the enzyme activity is respectively 24%, 25% and 37% higher than that of the wild enzyme rXynAHJ 3.

TABLE 1 Effect of Metal ions and chemical reagents on the viability of mutant S35H04 and wild enzymes rXynAGN16L and rXynAHJ3

5) Activity of mutant S35H04 and purified enzymes of the wild enzymes rXynAGN16L and rXynAHJ3 in NaCl and KCl:

determination of the enzyme activity in NaCl: 3.0-30.0% (w/v) NaCl was added to the enzymatic reaction system, and the enzymatic reaction was carried out at pH7.0 and 37 ℃. And (3) taking beech xylan or corncob xylan as a substrate, reacting for 10min, and determining the enzymatic properties of the purified endo-xylanase. The results show that: in 20.0-25.0% (w/v) NaCl, the mutant S35H04 has 18-33% higher enzyme activity than the wild enzymes rXynAHJ3 and rXynAGN16L (FIG. 6).

Enzyme activity assay in KCl: 3.0-30.0% (w/v) KCl was added to the enzymatic reaction system, and the enzymatic reaction was carried out at pH7.0 and 37 ℃. And (3) taking beech xylan or corncob xylan as a substrate, reacting for 10min, and determining the enzymatic properties of the purified endo-xylanase. The results show that: in KCl of 10.0-30.0% (w/v), the enzyme activity of the mutant S35H04 is 15-30% higher than that of the wild enzyme rXynAHJ3, and 25-55% higher than that of the wild enzyme rXynAGN16L (figure 7).

6) Protease resistance assay:

protease resistance of the enzyme: the recombinant enzyme was treated with trypsin (pH 7.5) and proteinase K (pH 7.5) corresponding to 10 times (w/w) of the recombinant enzyme at 37 ℃ for 1h, and then subjected to an enzymatic reaction at pH7.0 and 37 ℃ to prepare an enzyme solution containing the protease in a pH buffer corresponding to the protease but without the protease added as a control. The results show that: after 1H of treatment with trypsin and proteinase K at 37 ℃, the enzyme activities of S35H04, rXynAGN16L and rXynAHJ3 are almost not lost.

It will be understood by those skilled in the art that, unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the prior art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

Finally, it should be noted that: although the present invention has been described in detail with reference to the above embodiments, it should be understood by those skilled in the art that: modifications and equivalents may be made thereto without departing from the spirit and scope of the invention and it is intended to cover in the claims the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of Yunnan Master

<120> salt adaptability-improved endoxylanase shuffling mutant and preparation method and application thereof

<160>4

<170>PatentIn version 3.5

<210>1

<211>344

<212>PRT

<213> hybrid sequence

<400>1

Val Ser Ala Pro Pro Asp Val Ser Gly His Lys Gln Thr Leu Arg Ser

1 5 10 15

Ala Ala Pro Lys Gly Phe His Ile Gly Thr Ala Val Ala Gly Gly Gly

20 25 30

His His Glu Asn Gln Pro Tyr Pro Asp Pro Phe Thr Ser Asp Ser Glu

35 40 45

Tyr Arg Lys Val Leu Ala Ala Glu Phe Asn Ser Val Ser Pro Glu Asn

50 55 60

Gln Met Lys Trp Glu Tyr Ile His Pro Glu Arg Gly Arg Tyr Asn Phe

65 70 75 80

Gly Met Ala Asp Ala Ile Val Arg Phe Ala Lys Gln Asn Arg Gln Val

85 90 95

Val Arg Gly His Thr Leu Met Trp His Ser Gln Asn Pro Gln Trp Leu

100 105 110

Glu Gln Gly Asn Phe Ser Lys Glu Glu Leu Arg Gly Ile Leu Lys Asp

115 120 125

His Val Gln Thr Val Val Gly Arg Tyr Ala Gly Lys Ile Gln Gln Trp

130 135 140

Asp Val Ala Asn Glu Ile Phe Asn Asp Asp Gly Thr Leu Arg Ala Thr

145 150 155 160

Glu Asn Ile Trp Leu Arg Glu Leu Gly Pro Asp Ile Ile Ala Asp Val

165 170 175

Phe Arg Trp Ala His Glu Ala Asp Pro Lys Ala Lys Leu Phe Phe Asn

180 185 190

Asp Phe Gly Val Glu Asp Ile Asn Ala Lys Ser Asp Ala Tyr Leu Glu

195 200 205

Leu Ile Pro Arg Leu Gln Ala Gln Gly Val Gln Val Asp Gly Phe Ala

210 215 220

Ile Gln Gly His Leu Ser Thr Arg Tyr Gly Phe Pro Ser Gly Leu Gln

225 230 235 240

Ala Asn Leu Gln Arg PheAsp Asp Leu Gly Leu Glu Thr Ala Ile Thr

245 250 255

Glu Ile Asp Val Arg Met Asp Ile Ala Ala Gly Thr Glu Pro Thr Ala

260 265 270

Glu Gln Leu Glu Gln Gln Ala Asp Tyr Tyr Gln Arg Ala Leu Glu Ala

275 280 285

Cys Leu Ser Val Ala Asp Cys Asn Ser Phe Thr Ile Trp Gly Phe Thr

290 295 300

Asp Lys Tyr Ser Trp Val Pro Val Phe Phe Gln Gly Gln Gly Ala Ala

305 310 315 320

Thr Val Met Trp Asn Asp Phe Gly Arg Lys Gln Ala Tyr Tyr Thr Leu

325 330 335

Arg Ser Thr Leu Ala Lys Arg Ala

340

<210>2

<211>1032

<212>DNA

<213> hybrid sequence

<400>2

gtctcggccc cgccggacgt gagcggccac aaacagacgt tgcgctcggc agcgcccaag 60

ggtttccaca tcggcacggc cgtcgcgggc ggcggccacc acgagaacca gccgtacccg 120

gaccccttca cctcggacag cgagtaccgg aaggtgctgg ccgcggagtt caactcggtc 180

tcgcccgaga accagatgaa gtgggagtac atccacccgg agcgcggccg gtacaacttc 240

ggcatggccg acgccatcgt ccggttcgcc aagcagaacc ggcaggtggt ccgcgggcac 300

accctgatgt ggcacagcca gaatcctcag tggctggagc agggaaactt ctccaaagaa 360

gaactgcgcg gaatcctcaa agaccacgtc cagactgtag tgggcaggta cgccggcaaa 420

atccagcagt gggacgtcgc caacgaaatc ttcaatgatg acggaaccct gcgcgccacc 480

gagaacattt ggcttcgtga actgggcccg gacatcattg ccgacgtttt ccgctgggcg 540

cacgaggccg accccaaggc caagctgttc ttcaatgatt tcggcgttga ggacattaat 600

gccaagagtg atgcctacct cgaactcatc ccccggcttc aggcacaggg cgtgcaggtt 660

gacgggtttg ccatccaggg ccatctgagc acccgctacg gtttcccttc agggctgcag 720

gccaacctgc agcgctttga cgacctgggg ctggaaaccg ccattacgga aatagacgtc 780

cgcatggata ttgcagccgg cacggagccg acggccgagc agcttgagca gcaggcggac 840

tactaccagc gcgcccttga ggcctgcctg tccgttgcag actgcaattc gttcaccatt 900

tggggcttca ccgacaagta ctcgtgggtg ccggtcttct tccaggggca gggtgcggcc 960

acggtgatgt ggaacgactt cggtcgcaag caggcgtact acacgctgcg gtccacgctg 1020

gcgaagcgag cc 1032

<210>3

<211>3639

<212>DNA

<213> Arthrobacter sp

<400>3

atgaaggttc cgcgtttatt aaccgctctg gctgtaacct cggcgctgct gctgccggcg 60

gttccggcgc ttgccgtgca gccggaggaa aaacgtcctc cgggccagtc caaacaggac 120

acgctgcgcc gtgcagcccc caaagacttc aagattggtt ccgccgttgc gggcggaggc 180

catcatgagg cccaggacta ccccgatcct tttacgttcg ataaggaata ccgccggcaa 240

ctggccgccg agttcaattc ggtgtcaccg gagaaccagt cgaagtggga attcatccac 300

ccggaaaagg atgtctaccg cttcacggaa atggacgcca ttgtccgctc cgcccaaaaa 360

aacaagcagg tggtgcgcgg ccacaccctc ttttggcaca gccagaatcc tcagtggctg 420

gagcagggaa acttctccaa agaagaactg cgcggaatcc tcaaagacca cgtccagact 480

gtagtgggca ggtacgccgg caaaatccag cagtgggacg tcgccaacga aatcttcaat 540

gatgacggaa ccctgcgcgc caccgagaac atttggcttc gtgaactggg cccggacatc 600

attgccgacg ttttccgctg ggcgcacgag gccgacccca aggccaagct gttcttcaat 660

gatttcggcg ttgaggacat taatgccaag agtgatgcct acctcgaact catcccccgg 720

cttcaggcac agggcgtgca ggttgacggg tttgccatcc agggccatct gagcacccgc 780

tacggtttcc cttcagggct gcaggccaac ctgcagcgct ttgacgacct ggggctggaa 840

actgccatta cggaaataga cgtccgcatg gatattgcag ccggcacgga gccgacggcc 900

gagcagcttg agcagcaggc ggactactac cagcgcgccc ttgaggcctg cctgtccgtt 960

gcagactgca attcgttcac catttggggc ttcacggaca agtactcgtg ggttccggtc 1020

ttctttgccg gcgagggcga ggcgacagtc atggaggaag acttcacgcg caagcctgcc 1080

tactttgccc tgcgggaaac actgaagcgt ccggtgccga agcccgacga cggcggcccg 1140

tcccagccaa ccccggatcc tgccttcatc cccggcggcg ccgccaaccc gacagcgacg 1200

ccgatcgcag catcccgcgg caccggcaac tccgtggcgc tcaccttcga tgacgggccc 1260

gagcccggcg aaaccacagc tgtcctcgat ttcctcaagg acaagggcat cactgccacc 1320

ttctgcgtca tcggagcgaa catccaggcc cccggcggag ccgagctggt gaagcgcatg 1380

gtcgaggagg gccacacgct gtgcaaccac ggcaccacgt atgcggacat gggttcgtgg 1440

acccaggaac agattaaggc cgacctggtg gaaaacctcc gcatcatccg tgaagccgcc 1500

ggcacgcctg atctgcaggt cccctatttc cgggcaccga acggaagctg gggagtcacg 1560

ggcgaagtag ccgcagcgct tggtatgcag ccgctgggcc tgggcaatgt catctttgac 1620

tgggacggca atgacctcag cgaagccacc ctcacggcaa acctccgtgc cgcgttcacc 1680

cccggcgcgg tggtgctggc gcacgtcggc ggcggtgacc ggaccaacac agtgaaggca 1740

gttacgacgg tcgtgaccga aaagctcgcc caggggtgga cgttcgccct tccgcagggc 1800

ggtgccccgg aggaaccttc cggcggtgtg ccctcggact tcgagaccgg aaccgacggc 1860

tggaccgcgc gcggggactc agtggcggtc aacctcagct ccgacgcccg caccggatcc 1920

ggaagcctgc tggtcacgaa ccggacccag gactggcacg gtgccgcact cgacgtcacg 1980

ggcgccctac cggtcggctc ggccgtaaag atgtccgtct gggccaagct cgcccccggg 2040

cagcagccgg cggcactgaa aatgtccgtt cagcgggaca acggcggcgg gagtgcctat 2100

gaaggcgttg ccggagccgg ggcttcggtc accgccgacg gctggaccga acttgccggg 2160

acttacaccc tcggcgcagc agcggacaaa gcccaggtgt acatcgaagg tgctgtcggc 2220

gtggggttcc tgctcgatga cttcagcctc gccgcatatg ttgagcctcc ccttcaggag 2280

gacatacccg ggttgaaaga cgtccttggc ctgcagggca tcgagcacgt gggagcagca 2340

atcgacgcac gcgagacagc gggcaccgca gcgaacctcc tgcggaaaca cttcaatgcc 2400

ttcactcccg agaacgccgg caggcccgag agcgtgcagc cggtggaggg tcagttcacc 2460

cttacccagc tggaccagct gctggacttc gcagccgcca acaatgtcaa ggtgtacgga 2520

catgtgctgg tctggcattc ccagacccct gagtggttct tcaaggacgg gacccgggac 2580

ctgaccggca accggtccga ccgggcgctg ctgagggcac gcatggaggc acatatcaag 2640

ggcatcgcag atcacatcaa tgcccgctac ccggaggggg acagccccat ttgggcctgg 2700

gacgttgtca acgagaccat tgcggacggt gacacggcca acccgcacga catgcgggac 2760

agccgctggt tccaggtcct cggtgaacgt tttgtcgatg atgccttccg tctcgcggac 2820

aagtacttcc cggaggcaaa gctcttcatc aacgactaca acaccgagat gccccagaaa 2880

cgggccgact atctcgagct gattcgtgcc ctggaagccc ggggcgtacc catcgacggc 2940

gtgggccacc aggcgcacgt cgacgtggca cgtccggtgc agtggctcga ggactcgatc 3000

aaggccgttg agaaggtcaa tcctgacctg atgcaggcga tcactgagct cgacgtgaac 3060

gcgtccaccg agaatcaggg cgcggacgtg gacggtgccc cggtggatcc gtaccagccg 3120

gcattcggga acgacgggga cgccgccgcg gaagtcggat actactaccg cgacttgttc 3180

gccatgctgc gcaagcacag ttcggctatt gattcggtga ccgtctgggg catcagcaac 3240

gcccgcagct ggctgcggac ctggccgatg gcccggccct gggagcagcc gcttccattc 3300

gacgatgatc tgcaggctgc accggcctac tggggaatcg tggatcccgc gaaactgccg 3360

gcccggcctg ccgacgtgct ggcaccccgc atcgccgatc agccggacgt ggtggccttt 3420

tcaaagcgcg ccggacgggt gaaggtggct tacccgttgc cctcggcgat cgacaccctc 3480

gacggcaaag tgccggtgga ctgttctccg cgccgcggca gcacctttgc cgtggggacc 3540

actgcggtca cctgcacggc cacggatgcc gccggcaaca cgaggaccag cagcttcgac 3600

gtggtggtga agaagcaccg gcaccacgga aggcactga 3639

<210>4

<211>1104

<212>DNA

<213> Kloeriella variabilis (Lechevalieria sp.)

<400>4

atgaggtcgg ctcgtctggt catcgctttg ttcgctgccg tggcgttgtc ggcgccaccg 60

gcttcggcgg tctcggcccc gccggacgtg agcggccaca aacagacgtt gcgctcggca 120

gcgcccaagg gtttccacat cggcacggcc gtcgcgggcg gcggccacca cgagaaccag 180

ccgtacccgg accccttcac ctcggacagc gagtaccgga aggtgctggc cgcggagttc 240

aactcggtct cgcccgagaa ccagatgaag tgggagtaca tccacccgga gcgcggccgg 300

tacaacttcg gcatggccga cgccatcgtc cggttcgcca agcagaaccg gcaggtggtc 360

cgcgggcaca ccctgatgtg gcacagccag aacccggagt ggctggagca gggcgacttc 420

accgcggccg aactgcgcga gatcctgcgc gagcacatca tgaccgtggt cggccggtac 480

aagggcaagg tccagcagtg ggacgtggcc aacgagatct tcaccgacgc cggcgctctg 540

cggaccacgg agaacatctg gatccgtgaa ctcggtccgg gcatcgtggc ggacgcgttc 600

cgctgggcgc accaggccga ccccaaggcg aagctgttct tcaacgacta caacgtcgaa 660

agcgtcaacg cgaagagcga cgcgtactac gcgctgatca aggagctgcg cgccgcgggt 720

gtgcccgtgc acggcttctc cgcccaggcg cacctcagcc tggactacgg cttcccggac 780

gacctggagc gcaacctgaa gcggttcgcc gacctccggc tggagaccgc gatcaccgag 840

ctcgacgtgc ggatgaccct gcccgcgagc ggcgtgccga cggcggccca gctgcagcag 900

caggccgact actaccagcg cacgctcgcg gcctgcctga aggtcaggac ctgcaagtcg 960

ttcaccatct ggggcttcac cgacaagtac tcgtgggtgc cggtcttctt ccaggggcag 1020

ggtgcggcca cggtgatgtg gaacgacttc ggtcgcaagc aggcgtacta cgcgctgcgg 1080

tccacgctgg cgaagcgagc ctga 1104

Claims (6)

1. An endoxylanase mutant S35H04 with improved salt adaptability, wherein the amino acid sequence of the mutant S35H04 is shown as SEQ ID NO. 1.

2. A coding gene S35H04 of the endoxylanase mutant S35H04 with the modified salt adaptability of the claim 1, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 2.

3. A recombinant vector comprising the endoxylanase mutant S35H04 encoding gene S35H04 of claim 2.

4. A recombinant bacterium comprising the endoxylanase mutant S35H04 encoding gene S35H04 of claim 2.

5. A method for preparing the salt-adapted improved endoxylanase mutant S35H04 of claim 1, which is characterized by comprising the following steps:

1) connecting the s35h04 with an expression vector pEasy-E2, and transforming the connection product into escherichia coli BL21-Gold (DE3) to obtain a recombinant strain containing s35h 04;

2) culturing the recombinant strain, and inducing the expression of the recombinant mutant endo-xylanase;

3) recovering and purifying the expressed mutant endo-xylanase S35H 04;

4) and (4) measuring the activity.

6. The use of the salt-adapted modified endoxylanase mutant S35H04 according to any one of claims 1-5 in the field of food.

Images