CN111607575A

CN111607575A - Transaminase PHTA, preparation method and application

Info

Publication number: CN111607575A
Application number: CN202010263854.4A
Authority: CN
Inventors: 李中媛; 张同存; 刘天会
Original assignee: Tianjin University of Science and Technology
Current assignee: Tianjin University of Science and Technology
Priority date: 2020-04-07
Filing date: 2020-04-07
Publication date: 2020-09-01
Anticipated expiration: 2040-04-07
Also published as: CN111607575B

Abstract

The invention relates to transaminase PHTA, and the amino acid sequence of the transaminase PHTA is SEQ ID NO. 1. The optimum temperature of the transaminase PHTA is 35 ℃, the optimum pH is 8.0, and the transaminase PHTA still keeps more than 50 percent of activity within the pH range of 6-8. Under the optimal temperature and the optimal pH, the degradation rate of the transaminase PHTA of the invention on HFB1 is 100 percent; the transaminase PHTA of the invention has excellent property, can be applied to agriculture, feed, food and other industries, and reduces the harm of fumonisins FB1 to the health of animals and human beings.

Description

Transaminase PHTA, preparation method and application

Technical Field

The invention belongs to the technical field of agricultural biology, and particularly relates to transaminase PHTA, a preparation method and application thereof.

Background

Fumonisins are a class of structurally related metabolites produced primarily by fusarium and proliferating fusarium. Currently, 28 fumonisin analogues have been identified, which are divided into A, B, C and P four series. Among them, fumonisin B1(FB1) is the most prevalent and most toxic fumonisin. It causes leukomalacia in horses and pulmonary edema in pigs, and also affects the liver and immune system of poultry. In addition, FB1 is hepatorenal toxic to most mammals.

Mitigation strategies for eliminating fumonisins contamination in food and feed fall into physical, chemical and biological principles. Physical methods, including dry and wet milling, soaking, heating and the use of adsorbents. However, these strategies have limitations either because they are expensive to use instruments or because they cause loss of certain nutritional components in the feed. Ammoniation and basification are the most common chemical detoxification methods, but their use is limited due to their potential toxicity and negative impact on the taste and nutritional quality of the raw material. The biological detoxification technology can reduce the toxicity of mycotoxin on the premise of not influencing the quality of food and feed, and is considered as a promising detoxification strategy. Compared with microbial preparations, the enzyme preparation has higher stability in storage, so that the development of the enzyme preparation for degrading mycotoxin can well inhibit the generation of toxin in polluted food crops and recover economic loss.

Through searching, no patent publication related to the present patent application has been found.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a transaminase PHTA, a preparation method and application thereof.

The technical scheme adopted by the invention for solving the technical problems is as follows:

a transaminase PHTA, the amino acid sequence of which is SEQ ID No. 1.

The preparation method of the transaminase PHTA comprises the following steps:

transforming a host cell with a recombinant vector containing a gene encoding the transaminase PHTA to obtain a recombinant strain;

culturing a recombinant strain, and inducing the expression of transaminase PHTA;

and (5) separating and purifying the obtained transaminase PHTA.

In the first step, the host cell is a large intestine cell, a beer yeast cell or a polytypic yeast cell.

Use of the transaminase PHTA described above for degrading fumonisins.

A transaminase PHTA gene encoding a transaminase PHTA as described above.

Moreover, the nucleotide sequence of the gene is SEQ ID NO. 2.

A recombinant vector comprising the transaminase PHTA gene described above.

The recombinant vector pET28a (+) -PHTA comprising the transaminase PHTA gene as described above.

A recombinant strain comprising the transaminase PHTA gene as described above.

Moreover, the recombinant strain is Escherichia coli.

The invention has the advantages and positive effects that:

1. the optimum temperature of the transaminase PHTA of the invention is 35 ℃, the optimum pH is 8.0, and the transaminase PHTA still keeps 50 percent in the pH range of 6-8

The above activities. Under the optimal temperature and the optimal pH, the degradation rate of the transaminase PHTA of the invention on HFB1 is 100 percent;

the transaminase PHTA of the invention has excellent property, can be applied to agriculture, feed, food and other industries, and reduces the harm of fumonisins FB1 to the health of animals and human beings.

2. The transaminase PHTA of the invention can degrade and catalyze the amino group of the fumonisin FB1(HFB1) to eliminate the activity of the fumonisin. Since amino group is one of the key functional groups that make fumonisins toxic, removal of amino group is the key point for detoxification of fumonisins. The transaminase PHTA of the invention has the activity of degrading and hydrolyzing fumonisin HFB1, can be applied to agriculture, feed, food and other industries, and reduces the harm of fumonisin to the health of animals and human beings.

Drawings

FIG. 1 is a SDS-PAGE purification of the transaminase PHTA of the present invention; wherein, M: protein marker; transaminase PHTA;

FIG. 2 is a schematic diagram showing the degradation effect of transaminase PHTA in the present invention;

FIG. 3 is a graph showing the optimum temperature of transaminase PHTA of the present invention;

FIG. 4 is a graph showing the optimum pH of transaminase PHTA of the present invention.

Detailed Description

The following detailed description of the embodiments of the present invention is provided for the purpose of illustration and not limitation, and should not be construed as limiting the scope of the invention.

The raw materials used in the invention are conventional commercial products unless otherwise specified; the methods used in the present invention are conventional in the art unless otherwise specified.

A transaminase PHTA, the amino acid sequence of which is SEQ ID No. 1.

The preparation method of the transaminase PHTA comprises the following steps:

and (5) separating and purifying the obtained transaminase PHTA.

Preferably, in the first step, the host cell is a large intestine cell, a beer yeast cell or a polytypic yeast cell, preferably escherichia coli BL21(DE 3).

Use of the transaminase PHTA described above for degrading fumonisins.

A transaminase PHTA gene encoding a transaminase PHTA as described above.

Preferably, the nucleotide sequence of the gene is SEQ ID NO. 2.

A recombinant vector comprising the transaminase PHTA gene described above.

A recombinant strain comprising the transaminase PHTA gene as described above.

Preferably, the recombinant strain is escherichia coli.

Specifically, the amino acid sequence of the transaminase PHTA is shown as SEQ ID NO. 1:

SEQ ID NO.1：

MTRQRAKDAELRERAYRVVPGGVYGHLSTALLPSGYPQFFRRGKGAHLWDVDDNMYIDYLCAYGPNLFGYGFEPIERAAVRQQNLGDTLTGPTEALVELAEAFVGMVTHADWAMFCKNGTDANTIALMISRAHTGRATVLVAEGAYHGAAPWSTPRPAGVTAGDRANIVTYRYNDPESLAAAYRAHRHDLAAIFATPFRHEVFADQEDLNVTYARLARELCDQAGALLVVDDVRAGFRIARDCSWSPSGVQPDLSAWGKCFANGYPISAVLGSDKARKAAAEIFVTGSFWMSATPMAAAIEGLKQIRETDYLERLVESGLALRHGLQRQAAAHGFTLRQTGPAQMPQILFEEDPDFRVGYAWAEACVERGVYFSPYHNMFLSTAHTDGVIRRTLEVTDVAFETVKRQRGSLRTPAQLVPYAQEMAARLAT

wherein, the enzyme gene codes 430 amino acids without signal peptide, so the theoretical molecular weight of mature transaminase PHTA is 48.21 kDa.

The present invention provides PHTA encoding the above-described transaminase. The genome sequence of the gene is shown in SEQ ID NO. 2:

SEQ ID NO.2：

ATGACTAGACAGAGAGCTAAGGACGCTGAGTTGAGAGAGAGAGCCTACAGAGTTGTTCCAGGTGGTGTTTACGGTCACTTGTCCACTGCTTTGTTGCCATCTGGTTACCCACAGTTCTTCAGACGTGGTAAGGGTGCTCATTTGTGGGATGTTGACGACAACATGTACATCGACTACTTGTGTGCCTACGGTCCAAACTTGTTCGGTTACGGTTTCGAGCCAATTGAGAGAGCTGCTGTCAGACAACAAAACTTGGGTGACACTTTGACTGGTCCAACCGAGGCTTTGGTTGAATTGGCTGAGGCTTTCGTTGGTATGGTTACTCATGCTGACTGGGCCATGTTCTGCAAGAACGGTACTGACGCTAACACTATCGCCTTGATGATTTCCAGAGCACACACTGGTAGAGCCACTGTTTTGGTTGCTGAAGGTGCTTATCATGGTGCTGCACCTTGGTCTACTCCAAGACCTGCTGGTGTTACTGCTGGTGATAGAGCTAACATCGTCACCTACAGATACAACGACCCAGAATCTTTGGCTGCTGCTTACAGAGCCCATAGACATGACTTGGCTGCTATCTTCGCTACCCCATTCAGACACGAAGTTTTCGCTGATCAAGAGGACCTGAACGTTACCTACGCTAGATTGGCCAGAGAATTGTGTGATCAGGCTGGTGCCTTGTTGGTTGTTGATGATGTTAGAGCCGGTTTCAGAATCGCCAGAGACTGTTCTTGGTCCCCATCTGGTGTTCAACCAGATTTGTCTGCTTGGGGTAAGTGTTTCGCTAACGGTTACCCAATCTCCGCTGTTTTGGGTTCTGACAAGGCTAGAAAAGCTGCCGCCGAGATTTTCGTTACTGGTTCTTTTTGGATGTCCGCCACTCCAATGGCTGCCGCTATTGAAGGTTTGAAGCAGATCAGAGAGACTGACTACTTGGAGAGATTGGTCGAATCCGGTTTGGCTTTGAGACACGGTCTGCAAAGACAAGCTGCTGCTCACGGTTTTACCTTGAGACAAACTGGTCCAGCTCAGATGCCACAGATTTTGTTCGAAGAGGACCCAGACTTCAGAGTTGGTTATGCTTGGGCTGAAGCCTGTGTTGAAAGAGGTGTTTACTTCTCCCCATACCACAACATGTTCTTGTCCACCGCTCACACTGACGGTGTTATCAGAAGAACTTTGGAGGTTACCGACGTCGCCTTCGAGACTGTTAAGAGACAAAGAGGTTCCCTGAGAACCCCAGCTCAATTGGTTCCATACGCTCAAGAAATGGCTGCTAGACTGGCTACT

the transaminase PHTA is separated and cloned by a PCR method, and the total length of the open reading frame sequence (ORF) of the transaminase PHTA gene is 1290bp as shown by a DNA full sequence analysis result.

The invention also provides a recombinant vector containing the transaminase PHTA, and a preferred recombinant vector is named as pET28 a-PHTA. The transaminase PHTA gene of the present invention is inserted between the appropriate restriction sites of an expression vector so that its nucleotide sequence is operably linked to an expression control sequence. As a most preferred embodiment of the present invention, it is preferable that the detoxification enzyme gene of the present invention is inserted between the EcoR I and Xhol I restriction sites on the plasmid pET28a such that the nucleotide sequence is located downstream of and under the control of the T7 promoter to give a recombinant large intestine expression plasmid pET28 a-PHTA.

More specifically, the preparation and detection are as follows:

test materials and reagents:

1. bacterial strain and carrier: the invention obtains a new transaminase PHTA. The Escherichia coli expression vector pET28a (+) and the strain BL21(DE3) are stored in the laboratory.

2. Enzymes and other biochemical reagents: the endonuclease was purchased from TaKaRa, and the ligase was purchased from Invitrogen. Purchased from Sigma, and others are made by home-made reagents (all available from general biochemicals).

3. Culture medium:

coli medium LB (1% peptone, 0.5% yeast extract, 1% NaCl, pH 7.0).

Description of the drawings: the following molecular biology experiments, which are not specifically described, are performed by referring to the specific methods listed in molecular cloning, a laboratory manual (third edition) J. SammBruke, or according to the kit and product instructions.

Cloning of mono-and transaminase PHTA

The gene segment of transaminase PHTA is obtained by means of artificial chemical synthesis, and endonuclease site EcoR I is introduced into 5 'end and endonuclease site Xhol I is introduced into 3' end.

Preparation of recombinant transaminase PHTA

The expression vector pET28a is subjected to double enzyme digestion (EcoR I + XholI), meanwhile, the gene coding for transaminase PHTA is subjected to double enzyme digestion (EcoR I + XholI), a gene fragment coding for mature transaminase is cut out and connected with the expression vector pET28a, a recombinant plasmid pET28a-PHTA containing the transaminase gene PHTA is obtained, escherichia coli BL21(DE3) is transformed, and the recombinant escherichia coli strain BL21/PHTA is obtained.

BL21(DE3) strain containing plasmid was inoculated into 100mL LB medium, cultured with shaking at 37 ℃ and 220rpm for about 2 hours, added with 1mM IPTG, induced at 25 ℃ and 220rpm, and the intracellular and extracellular transaminase activities were measured after about 20 hours. The activity of the transaminase is detected in cells, and the recombinant transaminase is expressed by SDS-PAGE results after nickel column purification. As shown in FIG. 1, lane 1 shows the result after purification.

Determination of properties of recombinant transaminase

The high performance liquid chromatography is used for detecting the enzyme activity of transaminase, and the specific method is as follows:

(1) HFB1 standard stock solution: the standard solution with the concentration of 100 mug/mL is prepared and stored at-20 ℃.

(2) Preparation of a sample: mu.L of purified transaminase solution was taken, 100. mu.L of HFB1 standard stock solution and 50. mu.L of pyruvic acid solution were added thereto, and the final concentration of HFB1 was 10. mu.g/mL, cultured at 37 ℃ and 220rpm for 20min in the absence of light.

(3) Derivatization of the sample: and (3) taking 100 mu L of a sample to be detected, adding 400 mu L of 50% acetonitrile water and 500 mu L of OPA derivative solution, uniformly mixing for 30s, carrying out sample injection within 2min of derivatization, and filtering the membrane to be detected. The enzymatic activity of the transaminase PHTA was determined by comparison with the peak pattern of a standard of HFB 1.

1. Determination of the degradability of fumonisin-degrading enzymes

To 900 μ L of a mixed solution of an enzyme solution of transaminase PHTA and pyruvic acid (citric acid-disodium hydrogenphosphate buffer, pH 7.0), 100 μ L of HFB1 solution was added so that the final concentration of HFB1 was 10 μ g/mL. The reaction mixture was left at 37 ℃ and pH7 for 12 hours, and a solution of the purified transaminase PHTA was not added as a control. After the reaction is finished, boiling for 10min to inactivate the enzyme. Cooling to room temperature, passing through a membrane, and detecting by high performance liquid chromatography.

The results are shown in FIG. 2, in which FIG. 2a shows a mixed solution of a buffer and HFB1, and FIG. 2b shows a reaction solution of an enzyme solution and HFB 1. It can be seen that HFB1 showed the highest peak at 11.646min, whereas HFB1 was not detected in the solution to which the purified recombinant transaminase PHTA was added. Therefore, it can be concluded that the transaminase PHTA has the ability to completely degrade HFB1, and can completely degrade 10. mu.g/mLHFB 1 within 12 h.

2. Determination of optimum temperature of fumonisin-degrading enzyme

Using HFB1 as a substrate, 100. mu.L of the substrate was added with 850. mu.L of enzyme solution and 50. mu.L of pyruvic acid solution to a final concentration of 10. mu.g/mL, reacted for 1 hour in a citric acid-disodium hydrogenphosphate buffer solution (pH 7.0) buffer solution system at different temperatures, and then boiled in boiling water for 10 minutes to inactivate the enzyme. Cooling to room temperature, passing through a membrane, and detecting by high performance liquid chromatography.

As shown in FIG. 3, the optimum temperature of transaminase PHTA was 35 ℃. After the temperature is higher than 35 ℃, the activity of the enzyme shows a continuous decline phenomenon, and when the temperature is higher than 70 ℃, the enzyme only has the relative activity which is not higher than 10 percent.

The optimum temperature of the transaminase PHTA is 35 ℃ which is very close to the body temperature of 37 ℃ of mammals, and the transaminase PHTA can exert greater efficacy in animal bodies when used in animal feed.

3. Determination of the optimum pH of the transaminase PHTA

The purified recombinant transaminase PHTA was subjected to enzymatic reactions under different pH buffers to determine the optimum pH, and the buffer solutions selected were a buffer gradient of 100mM citric acid-disodium hydrogen phosphate (pH 3.0-8.0), 100mM Tris-HCl (pH7.0-9.0), 100mM glycine-NaOH (pH 9.0-12.0). The transaminase PHTA was reacted with the substrate HFB1 (final concentration 1. mu.g/mL) in the above different buffers at 37 ℃ for 1h, boiled in boiling water for 10min, and subjected to HPLC.

As shown in FIG. 4, the optimum pH of transaminase PHTA was 8.0. The relative enzyme activity of transaminase PHTA increases continuously from 20% to 100% at pH between 3 and 8, but after pH above 8 there is a large gradient of decrease and less than 20% at pH 10. The transaminase PHTA has high acid-base capacity, and can maintain certain activity no matter when being added into feed for storage or entering intestines and stomach of animals, so as to achieve the purpose of degrading toxin.

Although the embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that: various substitutions, changes and modifications are possible without departing from the spirit and scope of the invention and the appended claims, and therefore the scope of the invention is not limited to the embodiments disclosed.

Sequence listing

<110> Tianjin science and technology university

<120> transaminase PHTA, preparation method and application

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>430

<212>PRT

<213> amino acid sequence of transaminase PHTA (Unknown)

<400>1

Met Thr Arg Gln Arg Ala Lys Asp Ala Glu Leu Arg Glu Arg Ala Tyr

1 5 10 15

Arg Val Val Pro Gly Gly Val Tyr Gly His Leu Ser Thr Ala Leu Leu

20 25 30

Pro Ser Gly Tyr Pro Gln Phe Phe Arg Arg Gly Lys Gly Ala His Leu

35 40 45

Trp Asp Val Asp Asp Asn Met Tyr Ile Asp Tyr Leu Cys Ala Tyr Gly

50 55 60

Pro Asn Leu Phe Gly Tyr Gly Phe Glu Pro Ile Glu Arg Ala Ala Val

65 70 75 80

Arg Gln Gln Asn Leu Gly Asp Thr Leu Thr Gly Pro Thr Glu Ala Leu

85 9095

Val Glu Leu Ala Glu Ala Phe Val Gly Met Val Thr His Ala Asp Trp

100 105 110

Ala Met Phe Cys Lys Asn Gly Thr Asp Ala Asn Thr Ile Ala Leu Met

115 120 125

Ile Ser Arg Ala His Thr Gly Arg Ala Thr Val Leu Val Ala Glu Gly

130 135 140

Ala Tyr His Gly Ala Ala Pro Trp Ser Thr Pro Arg Pro Ala Gly Val

145 150 155 160

Thr Ala Gly Asp Arg Ala Asn Ile Val Thr Tyr Arg Tyr Asn Asp Pro

165 170 175

Glu Ser Leu Ala Ala Ala Tyr Arg Ala His Arg His Asp Leu Ala Ala

180 185 190

Ile Phe Ala Thr Pro Phe Arg His Glu Val Phe Ala Asp Gln Glu Asp

195 200 205

Leu Asn Val Thr Tyr Ala Arg Leu Ala Arg Glu Leu Cys Asp Gln Ala

210 215 220

Gly Ala Leu Leu Val Val Asp Asp Val Arg Ala Gly Phe Arg Ile Ala

225 230 235 240

Arg Asp Cys Ser Trp Ser Pro Ser Gly Val Gln Pro Asp Leu Ser Ala

245 250 255

Trp Gly Lys Cys Phe Ala Asn Gly Tyr Pro Ile Ser Ala Val Leu Gly

260 265 270

Ser Asp Lys Ala Arg Lys Ala Ala Ala Glu Ile Phe Val Thr Gly Ser

275 280 285

Phe Trp Met Ser Ala Thr Pro Met Ala Ala Ala Ile Glu Gly Leu Lys

290 295 300

Gln Ile Arg Glu Thr Asp Tyr Leu Glu Arg Leu Val Glu Ser Gly Leu

305 310 315 320

Ala Leu Arg His Gly Leu Gln Arg Gln Ala Ala Ala His Gly Phe Thr

325 330 335

Leu Arg Gln Thr Gly Pro Ala Gln Met Pro Gln Ile Leu Phe Glu Glu

340 345 350

Asp Pro Asp Phe Arg Val Gly Tyr Ala Trp Ala Glu Ala Cys Val Glu

355 360 365

Arg Gly Val Tyr Phe Ser Pro Tyr His Asn Met Phe Leu Ser Thr Ala

370 375 380

His Thr Asp Gly Val Ile Arg Arg Thr Leu Glu Val Thr Asp Val Ala

385 390 395 400

Phe Glu Thr Val Lys Arg Gln Arg Gly Ser Leu Arg Thr Pro Ala Gln

405 410 415

Leu Val Pro Tyr Ala Gln Glu Met Ala Ala Arg Leu Ala Thr

420 425 430

<210>2

<211>1290

<212>DNA/RNA

<213> transaminase PHTA gene (Unknown)

<400>2

atgactagac agagagctaa ggacgctgag ttgagagaga gagcctacag agttgttcca 60

ggtggtgttt acggtcactt gtccactgct ttgttgccat ctggttaccc acagttcttc 120

agacgtggta agggtgctca tttgtgggat gttgacgaca acatgtacat cgactacttg 180

tgtgcctacg gtccaaactt gttcggttac ggtttcgagc caattgagag agctgctgtc 240

agacaacaaa acttgggtga cactttgact ggtccaaccg aggctttggt tgaattggct 300

gaggctttcg ttggtatggt tactcatgct gactgggcca tgttctgcaa gaacggtact 360

gacgctaaca ctatcgcctt gatgatttcc agagcacaca ctggtagagc cactgttttg 420

gttgctgaag gtgcttatca tggtgctgca ccttggtcta ctccaagacc tgctggtgtt 480

actgctggtg atagagctaa catcgtcacc tacagataca acgacccaga atctttggct 540

gctgcttaca gagcccatag acatgacttg gctgctatct tcgctacccc attcagacac 600

gaagttttcg ctgatcaaga ggacctgaac gttacctacg ctagattggc cagagaattg 660

tgtgatcagg ctggtgcctt gttggttgtt gatgatgtta gagccggttt cagaatcgcc 720

agagactgtt cttggtcccc atctggtgtt caaccagatt tgtctgcttg gggtaagtgt 780

ttcgctaacg gttacccaat ctccgctgtt ttgggttctg acaaggctag aaaagctgcc 840

gccgagattt tcgttactgg ttctttttgg atgtccgcca ctccaatggc tgccgctatt 900

gaaggtttga agcagatcag agagactgac tacttggaga gattggtcga atccggtttg 960

gctttgagac acggtctgca aagacaagct gctgctcacg gttttacctt gagacaaact 1020

ggtccagctc agatgccaca gattttgttc gaagaggacc cagacttcag agttggttat 1080

gcttgggctg aagcctgtgt tgaaagaggt gtttacttct ccccatacca caacatgttc 1140

ttgtccaccg ctcacactga cggtgttatc agaagaactt tggaggttac cgacgtcgcc 1200

ttcgagactg ttaagagaca aagaggttcc ctgagaaccc cagctcaatt ggttccatac 1260

gctcaagaaa tggctgctag actggctact 1290

Claims

1. A transaminase PHTA, characterized by: the amino acid sequence of the transaminase PHTA is SEQ ID NO. 1.

2. The process for the preparation of transaminase PHTA of claim 1, characterized in that: the method comprises the following steps:

and (5) separating and purifying the obtained transaminase PHTA.

3. The process for the preparation of transaminase PHTA of claim 2, characterized in that: the host cell in the step is a large intestine cell, a beer yeast cell or a polytypic yeast cell.

4. Use of the transaminase PHTA of claim 1 for degrading fumonisins.

5. A transaminase PHTA gene encoding the transaminase PHTA of claim 1.

6. The transaminase PHTA gene of claim 5, characterized in that: the nucleotide sequence of the gene is SEQID NO. 2.

7. A recombinant vector comprising the transaminase PHTA gene of claim 5 or 6.

8. A recombinant vector pET28a (+) -PHTA comprising the transaminase PHTA gene of claim 5 or 6.

9. A recombinant strain comprising the transaminase PHTA gene of claim 5 or 6.

10. The recombinant strain of claim 9, wherein: the recombinant strain is escherichia coli.