KR101950782B1 - Single nucleotide polymorphism marker for discrimination of Larix olgensis var. koreana and Larix kaempferi and method using the same - Google Patents

Abstract

The present invention relates to an SNP primer for identifying Larix olgensis var. koreana, which is specific to a psbC gene, and a method for distinguishing Larix olgensis var. koreana and Larix kaempferi using the SNP primer. More specifically, the SNP primer using the SNP of the psbC gene region of Larix olgensis var. koreana and a primer set by a combination of the primers are PCR analyzed, so that amplified products can be observed in both Larix olgensis var. koreana and Larix kaempferi, and the amplified products specific to Larix olgensis var. koreana can be observed, thereby clearly distinguishing the two species. Therefore, the present invention can be effectively utilized for management of genetic resources, seed management, breeding of hybrids, and management of the distribution of timber of Larix olgensis var. koreana and Larix kaempferi.

Description

[0001] The present invention relates to a SNP marker for discriminating a leafberry and a Japanese myrtle tree, and a method for discriminating the same using a single nucleotide polymorphism marker for discrimination of Larix olgensis var. koreana and Larix kaempferi and method using the same}

The present invention relates to a method for distinguishing between Leptododivorus japonica and Japanese Leptocorosus using a single base polymorphism marker.

About 20 species of Larix species are distributed throughout the world. Korea has Larix Olgensis (Larix north of Mt. There is olgensis . koreana (Nakai) Nakai) 1 paper and the native, Japan ipgal tree (Larix kaempferi (Lamb.) Carriere) is introduced from Japan in 1904 was planted (Non-Patent Document 0001, 0002, 0003).

Leaf trees are distributed in the north of Mt. Geumgang, and are planted in some parts of the south. Japanese myrtle trees were introduced from Japan in 1904 and are now planted in an area of about 500,000 hectares. Both species grow up to 40m in height and 1m in diameter, and are used as building materials such as construction, civil engineering, sleepers, support trees and so on. Both species are very similar in external morphology, with the most prominent difference being the number of chambers forming the cones and the shape of the chambers. The corolla is composed of 20 ~ 40 pieces and is almost unfolded backward, whereas the Japanese pedicel is more than 50 pieces and is bent backward (Non-Patent Document 0002). However, if the cones can not be observed or if the number and shape of the cones are not clearly distinguishable, they may not be clearly identified. In addition, the two kinds of woods have very similar histological characteristics, so that it is difficult to identify them, and there is a concern that mixing and illegal distribution of wood may be problematic (Non-Patent Document 0004).

The prior art related to the present invention includes a method using a universal primer and a restriction enzyme amplifying a specific region of chloroplast DNA and mitochondrial DNA (Non-Patent Document 0005), a method of confirming the presence or absence of a DNA fragment amplified using a RAPD primer Non-Patent Document 0006), a method of identifying a species using RAPD, EST, etc. (Non-Patent Document 0007) and the like are disclosed.

However, in the case of the above-mentioned prior art, it is difficult to predict the success of the amplification or the PCR amplification reproducibility is remarkably deteriorated due to the low annealing temperature depending on the short nucleotide sequence and the stability of the assay is insufficient. It does not provide a clear discrimination method. Specifically, non-patent document 0005 discloses a discrimination method for some European varieties and Japanese varieties, and non-patent literature 0007 discloses a variety of species such as L. laricina , L. decidua , L. kaempferi, L. sibirica, L. gmelinii, L. griffithiana, L. lyallii, L. mastersiana, L. occidentalis, Larix Olgensis (Larix presenting a criterion for L. potaninii). However, in native country There is olgensis . koreana ) and Japanese blackberry ( Larix kaempferi (Lamb.) Carriere) species can not distinguish species by amplifying the same marker. Therefore, the present inventors prepared a primer set based on a common primer set of a common primer set of Leucumber and Japanese myrtle, and a primer set using a single base polymorphism in order to discriminate the species of L. and Mulberry The present invention has been completed as a result of diligent efforts to apply to the PCR method.

The mutation of chloroplast DNA in the cytoplasm of plants is highly conserved in plant species and the species identification is very useful. In particular, a single nucleotide sequence variation due to a difference in one nucleotide sequence in a specific DNA region such as a gene has a low mutation rate and can provide stable information for species identification. However, it is not easy to find SNPs that can distinguish very similar species, such as Lepticum japonica and Japanese Leptoptera. There is no known method for efficiently producing SNP primers. Even if the primers are 70 ~ 80% similar Because SNP primers are likely to hybridize with the parent DNA, the production and use of SNP primers with different base sequences is difficult. Therefore, in order to solve the problem of identification error caused by external morphology and histologic similarity of Lepticum japonica and Japanese Lepticum japonica, development of a genetic molecular marker capable of discriminating Leptodon sp. It is a situation.

 Fu L-K, Li N, Mill R R (1999) Larix. In: Flora of China (eds Wu Z-Y, Raven PH), Vol. 4, pp. 3337. Science Press, Beijing / Missouri Botanical Garden Press, St Louis.  Compensation. 2012. Economic Species 4 Larch. Korea Forest Research Institute. ISBN: 978-89-8176-900-0.  National Standard List of Forests (Nature). www.nature.go.kr  However, 2006. Method of tree species identification. National Forestry Academy Open Seminar Kit.  Achere V. Rampant PF, Paques LE, Prat D (2004) Chloroplast and mitochondrial molecular tests identity European x Japanese larch hybrids. Theor Appl Genet. 108: 1643-1649.  Scheepers D, Eloy MC, Briquet M (2000) Identification of larch species (Larix decidua, Larix kaempferi and Larix 占 eurolepis) and estimation of hybrid fraction in seed lots by RAPD fingerprints. Theor Appl Genet. 100: 71-74.  Gros-Louis MC, Bousquet J, Paques LE, Isabel N (2005) Species-diagnostic markers in Larix spp. based on RAPDs and nuclear, cpDNA and mtDNA gene sequences, and their phylogenic implication. Tree Genetics and Genomes. 1 (2): 50-63.

Disclosure of Invention Technical Problem [8] The present invention has been made in view of the above problems, and it is an object of the present invention to search for a single nucleotide sequence variation of species-specific chloroplast DNA capable of discriminating leaf- And to provide a primer which can be used for mutation-specific polymerase chain reaction.

It is another object of the present invention to provide a DNA polymerase which is capable of discriminating the objectivity and the definite consistency of discrimination based on DNA mutation which is not influenced by the external morphology and environmental variation by using the primer in order to solve the problem of uncertainty of external form comparison and subjective identification error The present invention relates to a method for identifying a Japanese lantern tree and a Japanese lantern tree.

It is still another object of the present invention to provide an identification kit for a leaf blade and a Japanese leaf blade having the objectivity and distinct consistency of identification based on a DNA variation having no influence of an external form and an environmental variation by including the primer.

In order to achieve the above object, the present invention provides a pair of SNP primers for discriminating lobster comprising the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2.

In addition, the present invention provides a primer set for discriminating lobsters and Japanese lobsters, further comprising a forward primer of SEQ ID NO: 3 in the pair of SNP primers for discriminating lobstorm.

The base sequence of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, and the forward primer of SEQ ID NO: 3 was developed based on the nucleotide sequence information including the psb C gene of the chloroplast DNA of Leucumber Lt; / RTI > The nucleotide sequence containing the above-mentioned psb C gene was also analyzed and registered by the inventors for the present invention and is not yet disclosed (NCBI Accession No. MF568538 to MF568542).

Specifically, the present inventors analyzed the leaf tissues of Japanese blackberry and Japanese brownwood to develop molecular markers for the identification of Leptodon sp. And Japanese Leptomycetes, and selected the genes of chloroplasts for candidate gene selection for marker selection As a result of the comparative analysis, it was judged that the psb C gene of the chloroplast DNA was highly likely to find the lanthomonas species-specific SNP that can distinguish the lanthana tree from the Japanese lantern tree, and the gene was selected as the target gene. As a result of comparison with the genomic sequence of the actual lobsters and Japanese lobsters, the nucleotide sequence containing the psb C gene of the Laurel tree described in SEQ ID NO: 4 is a SNP And thus can be usefully used as a marker gene for the identification of a lobster. The SNP primer pair for discriminating Lawn Bladder of the present invention is specifically designed to bind to the polynucleotide described in SEQ ID NO: 4 and amplify it and not to bind to the polynucleotide described in SEQ ID NO: 5, To 30 mer lengths, more preferably from 18 to 25 mer lengths are all usable, but most preferably polynucleotides of SEQ ID NOS: 1 and 2.

Since the length of the primer of the present invention is not specific to the desired sequence if it is too short and can be mismatched if it is too long, the specific length and sequence of the primer may be selected depending on the complexity of the desired DNA target, Depending on the conditions of use.

In the present invention, an oligonucleotide used as a primer may also include a nucleotide analogue such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, And may include intercalating angents.

In the SNP primer pair, the primer pair consisting of the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2 is a single nucleotide polymorphic guanine (G) which is the 682nd nucleotide of the psb C gene sequence of the chloroplast DNA ) And cytosine (C). That is, at the 682 bp position of the psb C gene sequence, the lobster tree is composed of the base 'C', while the Japanese lobster tree is composed of the base 'G', and the species- Is present.

In a preferred embodiment of the present invention, SNPs for distinction of the breeds or species in the vicinity may have to be discriminated by using only one difference in the base sequence. Therefore, the SNP primer is different from the ordinary primer Otherwise, intentionally design using a mismatching method (FIG. 2).

In the primer set for discriminating lepidoptera and Japanese lepidoptera according to the present invention, the forward primer of SEQ ID NO: 3 and the reverse primer of SEQ ID NO: 2 are primer pairs representing common bands in lanthana and japonica, The forward primer specifically binds only to the leafy tree gene, not the Japanese leafy tree, so that no bands other than the common band appear in the Japanese leafy tree.

Specifically, when the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, and the forward primer of SEQ ID NO: 3 are subjected to multiplex PCR, the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: An amplification product of 122 bp was observed only in the mulberry tree, and an amplification product of 335 bp was commonly observed in the mulberry and Japanese mulberry trees by the forward primer of SEQ ID NO: 3 and the reverse primer of SEQ ID NO: 2 (FIGS. 2 and 3 ). These results indicate that the nucleotide sequence of the 3 'end of the forward primer of SEQ ID NO: 1 is composed of' C ', which corresponds to the base' C 'at 682 bp of the psb C gene sequence of the chloroplast The amplification product is generated by complementing the template DNA and the primer between the template DNA and the primer. However, since the amplification product is generated, it does not coincide with the base 'G' at the 682 bp position of the psb C gene sequence of the Japanese leafy tree chloroplast DNA, This is because the sequence is not complementary and no amplification products are produced.

Thus, SNP primers using the SNP in the psb C gene region of the newly extracted chloroplast DNA of the present invention, and primer set by the combination thereof, were analyzed by PCR and introduced into the genus L. japonica in Japan and plant material It can be used to distinguish Japanese japonica.

In addition, the present invention provides a kit for discriminating lobsters and Japanese lobsters comprising a pair of SNP primers for discriminating lobsters comprising SEQ ID NO: 1 and SEQ ID NO: 2.

According to an embodiment of the present invention, it is further preferable that the kit further comprises a forward primer of SEQ ID NO: 3.

The kit can be prepared by using the above primer set and various reagents required for confirming the experimental procedure and the results necessary for identifying the lanthana and Japanese lanthana such as a PCR reaction mixture, a restriction enzyme, an agarose, a buffer solution necessary for hybridization or electrophoresis Etc. may be further included.

In addition, the present invention provides a method for distinguishing lepidoptera and Japanese lepidoptera using the primer set.

The method for distinguishing the Japanese blackberry and the Japanese blackberry of the present invention comprises the steps of: (a) separating genomic DNA from a leafberry tree to be discriminated; (b) amplifying the isolated genomic DNA by multiplex PCR (PCR) using the SNP primer pair of SEQ ID NO: 2 and SEQ ID NO: 3 as the template and the forward primer of SEQ ID NO: 1; And (c) analyzing the size of the amplification product.

In the method of the present invention, when the amplification product is generated using the SNP primer pair and the forward primer of SEQ ID NO: 3 in the PCR, when the size of the amplification product is 122 bp and 335 bp, If bp alone, it can be distinguished as Japanese brownwood.

According to a preferred embodiment of the present invention, the primer represented by SEQ ID NO: 1: the primer represented by SEQ ID NO: 2: the primer represented by SEQ ID NO: 3 is preferably mixed at a concentration ratio of 1: 2: 1 Do not.

The reaction solution for the polymerase chain reaction was prepared by mixing 20 ng of lanthana or Japanese brownwood genomic DNA, 1x buffer, 0.2 μM of the forward primer of SEQ ID NO: 1, 0.2 μM of SEQ ID NO: 2 Reverse primer, 0.2 袖 M of a primer set of forward primer of SEQ ID NO: 3, 0.2 mM dNTPs, 2.5 mM MgCl ₂ , and 2.5 units of Taq DNA polymerase.

In the PCR reaction conditions, the amplification of step (b) was performed at 94 ° C for 5 minutes, followed by denaturation at 94 ° C for 1 minute, primer binding at 57 ° C for 1 minute, and polymerization at 72 ° C for 1 minute Followed by final polymerization at 72 ° C for 8 minutes.

The single nucleotide sequence variation of the present invention may be labeled with a detectable labeling substance. In one specific example, the labeling material can be, but is not limited to, a material that emits fluorescence, phosphorescence, or radiation. Preferably, the labeling substance is Ethidium Bromide (EtBr), Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence may be labeled with a detectable fluorescent labeling substance. In addition, if the radioactive isotope such as 32P or 35S is added to the PCR reaction solution, the amplification product may be synthesized and the radiation may be incorporated into the amplification product and the amplification product may be labeled with the radiation.

In the above method, the sample to be discriminated may be a petiole sample, which is expected to contain lobsters and Japanese lobsters.

In the embodiment of the present invention, as a result of performing the PCR by the above method, it is possible to specifically distinguish the leaf tree from the Japanese blackberry and the Japanese blackberry by extremely amplifying the DNA fragment of the expected size. Thus, the above method using the SNP primer set of the present invention can be usefully used for the determination of the tree species.

According to the present invention, it is possible to stably and surely distinguish between the leaves and the Japanese myrtle trees by using the primers for identifying the myrtle trees and the Japanese myrtle trees, so that the identification of the myrtle trees and the Japanese myrtle trees It can be a scientific guarantee. Especially, the amplification product specific to the mulberry tree can be observed using the single nucleotide sequence variation.

When the above method of the present invention is used, the external shape comparison itself is impossible, and it can also be utilized in the case of identifying a processed wood which is difficult to be identified even by a microscopic method.

In addition, when the above method of the present invention is used, it can be used for confirming whether or not hybridization occurs between a leafy tree and a Japanese blackberry, depending on the characteristics of pseudotypic transfer of chloroplast DNA in coniferous trees such as a leafy tree.

Fig. 1 shows the positions of SNPs, the positions of SNP primers, and amplification directions of Leucumber and Japanese Leucoptera.
Fig. 2 shows the result of performing multiplex PCR using a primer set for determining the species of Leptinia japonica and Japanese Brownwood (Lane 1 to 5: Judging from lantern tree, Lane 6 to 10: Judging from Japanese lantern tree, Lane 11: negative control, lane L: DNA size ladder marker).
FIG. 3 shows amplification products using a primer set in order to discriminate species of Leptiger japonica and Japanese brownwood. FIG. 3 (a) shows the result of amplification using a pair of primitive Daegu primers consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: FIG. 3B shows amplification products of the common bands appearing on the lobsters and Japanese lobsters using the forward primers of SEQ ID NO: 3 and the reverse primers of SEQ ID NO: 2, respectively.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are for further illustrating the present invention, and the scope of the present invention is not limited to these examples.

Example 1. Leaf tree  Preparation of sample

In the present invention, among the 20 species of the genus Petunum, the genus and the genus L. were used for the species identification. Specifically, the genetic sequence analysis and the genetic mutation detection of the genus Petal And 2 leaves were collected from planted areas in Gangneung area and National Arboretum, respectively.

Example 2. Mold  Extraction and purification of DNA

In order to prepare samples for template DNA extraction and purification, 200 mg of leaf samples collected from each individual were quantitated and placed in a 2 mL microtube together with ceramic beads. 400 μL of Buffer AP1 from DNeasy Plant Mini Kit (QIAGEN) and 4 μL of RNase A , Followed by shaking for 10 minutes at a rate of 30 times / sec using a Tissue Lyser (QIAGEN) to disrupt the leaf tissue.

DNA was extracted and purified according to the manufacturer's instructions using DNeasy Plant Mini Kit (QIAGEN). The final concentration of extracted DNA was diluted to 5 ng / μL.

Example 3. Genes  Search for mutation

In order to analyze the SNP of the psb C gene of chloroplast DNA present in the leaves of Japanese myrtle trees, the accuracy and sequence of the nucleotide sequences were confirmed and confirmed using Geneious 10.2.3 software, and finally the results were examined by visual observation Respectively. As a result, the SNPs of the psb C gene of Leucumber and Japanese Leaf tree were finally selected (Fig. 1).

Example  4. Leaf tree  SNP positive and negative for discrimination Primer  making

The nucleotide sequence of the region to be amplified was determined so that the single nucleotide sequence variation region was included, and the primer was designed using Primer3 software. Generally, when PCR amplification was performed, mismatching with the template DNA at the 3'-nucleotide of the primer did not cause PCR amplification, and SNP primer was prepared using this. Primer sizes ranged from 18 to 25 mers, Tm ranged from 57 to 63 ° C, one GC clamp, and primer amplified products ranging from 100 bp to 350 bp. In order to design primer specific primer with primer sequence complementary to single nucleotide sequence of the mulberry tree, the 3 'end of the forward primer contains the nucleotide sequence' C '.

Table 1 below shows the nucleotide sequences of Larixok-oF (the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2) and Larixok (the forward primer of SEQ ID NO: 3) of the present invention and the combination of the primer base sequences The combination of the reverse complementary base sequence and the same primer base sequence is regarded as a combination.

primer
name The base sequence (5 '- > 3') Forward primer Reverse primer Larixok-oF TCCTATAGTTTAGCGGCTCTATCTC
(SEQ ID NO: 1) TGAGCTTGAGAGGCTTCTGG
(SEQ ID NO: 2) Larixok CCGACTCTTAACCCAAGTGC
(SEQ ID NO: 3) - * Primer sequence combinations are considered the same primer sequence combinations as reverse complementary sequence combinations.

Example  4. SNP Primer  optimal PCR  Establish condition

Since the SNP primers prepared in Example 3 had different reaction characteristics according to the SNPs, PCR conditions (DNA concentration, number of amplifications, concentration ratio between primers and dNTP concentration) were set up in accordance with the characteristics of each primer.

In order to distinguish the leaves from Japanese blackberry, the PCR reaction solution contained 20 ng of lanthomonas species and 20 μg of genomic DNA of Japanese japonica per 25 μl, 1 × buffer solution, 0.2 μM primer, 0.2 mM dNTPs, 2.5 mM MgCl ₂ , 2.5 Unit Taq DNA polymerase was included. The PCR reaction solution contained the Larixok-oF primer set consisting of the forward primer and the reverse primer shown in Table 1 and the Larixok primer showing the specific amplification to the mulberry single nucleotide sequence mutation.

The PCR conditions were as follows: denaturation at 94 ° C for 5 min, denaturation at 94 ° C for 1 min, primer binding at 57 ° C for 1 min, and polymerization at 72 ° C for 1 min were repeated 35 times followed by final polymerization at 72 ° C for 8 min The constructed PCR was performed.

As a result, a common bands were observed at 335 bp in the leaves of Leptodermodata japonica and Japonica japonica, and a band of 122 bp in the japonica tree was detected.

Example  5. Manufactured Primer  Used Tree with leaves  Judging Japanese Leaf Tree

5 multiplexed PCRs were carried out using 5 primates in the National Arboretum and 5 primate trees collected from the plantations in the Gangneung area. 1 μL of the amplified product was removed and electrophoresis was performed using an Agilent Bioanalyzer 2100 instrument and an Agilent high sensitivity DNA analyzer kit. The fragment size of the amplified product in the electrophoresis was confirmed based on the High Sensitivity DNA ladder included in the kit.

As a result, it was found that the bands were observed at 335 bp and 122 bp in the samples No. 1 to 5, and that they were in the lobsters. In the samples No. 6 to 10, bands were observed only at the 122 bp, ). These results show that the SNP molecular markers in the psb C region are accurate and reproducible, and are effective as markers for the identification of.

Although the present invention has been described in connection with the specific embodiments of the present invention, it is to be understood that the present invention is not limited thereto. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. In addition, the materials of each component described herein can be readily selected and substituted for various materials known to those skilled in the art. In addition, those skilled in the art will recognize that some of the components described herein may be omitted without degrading performance, or components may be added to improve performance. In addition, those skilled in the art may change the order of the method steps described herein depending on the process environment or equipment. Therefore, the scope of the present invention should be determined by the appended claims and equivalents thereof, not by the embodiments described.

Leaves and Japanese lobsters are very similar to each other except for the number and shape of the compartments, which are distinctive, and are difficult to distinguish in the stage of growth which can not be observed. According to the present invention, it is possible to stably and surely distinguish between the leafwood and the Japanese myrtle tree using the primer set for identifying the myrtle tree and the Japanese myrtle tree. Therefore, the scientific guarantee for the identification of the myrtle tree and the Japanese myrtle tree As a molecular marker. Through this, it can be used for the management of genetic resources such as Japanese lantern and japonica, seed management, breeding of hybrids, and management of distribution of timber.

Specifically, it can be used for early selection of crossbreds of Japanese blackberry and Japanese brownberry, depending on the characteristics of chloroplast DNA paternally inherited from leafy trees and Japanese blackberry trees. In order to select and breed interspecific hybrids when cultivating interspecific hybrids through mating by artificial mating or natural mediation, it is easy to confirm the actual mating between mating combinations, but in the case of trees, Since it takes a long time to confirm the crossing through the observed phenotype, the breeding efficiency of the interspecies hybrid can be greatly improved by confirming the crossing at early stage by using the method of identification of the Japanese blackberry and the Japanese blackberry.

It is also expected that the demand for timber of lepidoptera will continue to increase because of its high value as construction materials. Leaf trees and Japanese brownwood can not be distinguished from each other in terms of wood histology. Therefore, the identification methods of the present invention can be used to effectively identify wood of Leucumber and Japanese Leucumber. Since the DNA is likely to be degraded or fragmented in wood tissue, the PCR reaction using wood DNA improves the efficiency of amplification as the length of the DNA to be amplified is shorter. In this respect, the primers developed in the present invention amplify a DNA fragment of at least 122 bp and a maximum of 335 bp, so that it is possible to efficiently utilize the DNA fragment to identify these species.

<110> National Institute of Forest Science <120> Single nucleotide polymorphism marker for discrimination of Larix          There is olgensis. koreana and Larix kaempferi and method using the          same <130> 17-10875 <160> 5 <170> KoPatentin 3.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> forward primer of Larixok-oF <400> 1 tcctatagtt tagcggctct atctc 25 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of Larixok-oF <400> 2 tgagcttgag aggcttctgg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of Larixok <400> 3 ccgactctta acccaagtgc 20 <210> 4 <211> 122 <212> DNA <213> Artificial Sequence <220> <223> amplified product of Larixok-oF <400> 4 tcctatagtt tagcggctct atctctcttt ggttttattg cttgttgttt tgtttggttc 60 aacaatacag cttatcccag tgaattctat gggcccaccg gcccagaagc ctctcaagct 120 ca 122 <210> 5 <211> 335 <212> DNA <213> Artificial Sequence <220> <223> amplified product of Larixok <400> 5 ccgactctta acccaagtgc tatatttggt tatttactga aatctccttt cggaggagaa 60 ggatggatcg ttagcgtgga caatctagaa gatgtaattg gaggacatgt atggttaggt 120 tccatttgta tcttcggtgg tatctggcat atcttaacca aaccttttgc atgggctcgc 180 cgtgcattcg tatggtccgg agaagcttat ttgtcctata gtttagcggc tctatctctc 240 tttggtttta ttgcttgttg ttttgtttgg ttcaacaata cagcttatcc cagtgaattc 300 tatgggccca ccggcccaga agcctctcaa gctca 335

Claims (8)

A pair of SNP primers for discriminating lobster comprising the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2. The primer pair comprising the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2 is selected from the group consisting of a single nucleotide polymorphic guanine (G) which is the 682nd nucleotide of the psb C gene sequence of the chloroplast DNA And a cytosine (C). A primer set for discriminating lobsters and Japanese lobsters, further comprising a forward primer of SEQ. ID. NO. 3 in the SNP primer pair for discriminating the mossy leaves of claim 1. (a). Isolating the genomic DNA from the petiole species sample to be discriminated;
(b). Amplifying the isolated genomic DNA by multiplex PCR (PCR) using a pair of primers consisting of SEQ ID NO: 1 and SEQ ID NO: 2 and a forward primer of SEQ ID NO: 3; And
(c). And analyzing the size of the amplified product. 5. The method according to claim 4, wherein the reaction solution for the multiplex polymerase chain reaction is prepared by mixing 20 ng of genomic DNA of a rootstock or Japanese brownwood genome, 1x buffer, 0.2 mu M of a primer of SEQ ID NO: 1, 0.2 μM of SEQ ID NO: 3, 0.2 μM of primer, 0.2 mM dNTPs, 2.5 mM MgCl ₂ , and 2.5 Unit Taq DNA polymerase. 5. The method according to claim 4, wherein the amplification of step (b) is performed at 94 ° C for 5 minutes, followed by denaturation at 94 ° C for 1 minute, primer binding at 57 ° C for 1 minute, and polymerization at 72 ° C for 1 minute Followed by final polymerization at 72 ° C for 8 minutes. [Claim 4] The method according to claim 4, wherein when the amplified product is generated using the primer, the size of the amplified product is 122 bp and 335 bp, and when the primer is 335 bp, How to Identify Japanese Leaf Tree. A kit for discriminating lobsters and Japanese lobsters comprising the pair of SNP primers for discriminating lobsters of claim 1 and the forward primer of SEQ ID NO: 3.

Images