KR101894179B1 - Method for improving the resistance to drought stress using pepper transcription factor CaAIEF1 in plants - Google Patents

Abstract

The present invention relates to a novel pepper-derived CaAIEF1 ( Capsicum annuum A bscisic acid-induced Ethylene Responsive Factor 1) gene / protein, and a method for enhancing dry stress resistance of a plant using the same.
The present invention has identified the CaAIEF1 gene encoding a resistance-enhancing protein against drought stress and confirmed that the CaAIEF1 protein functions as a positive regulator of ABA signal transduction and enhances the dry stress resistance in the transgenic plant overexpressing the protein, Of the CaAIEF1 gene It can be used for the improvement of crops available to mankind through the regulation of expression, and it is expected to be useful for improving the productivity of plants.

Description

FIELD OF THE INVENTION [0001] The present invention relates to a method for enhancing dry stress resistance of a plant using the transcription factor CaAIEF1 derived from a green pepper cultivar,

The present invention relates to a novel CaAIEF1 ( Capsicum annuum A biscisic acid-induced ethylene responsive factor 1) gene and protein derived from pepper, and a method for enhancing dry stress resistance of the plant using the same.

Global warming causes extreme climate change, causing environmental stresses that hinder the normal growth and development of plants, while plants have evolved sophisticated defense mechanisms to survive in adverse environments such as cold, high salt and drought. For example, drought is caused by a water-poor environment and seriously affects the normal growth of the plant, resulting in a decrease in the yield of the grain. The plant has a pore closure, abscisic acid (hereinafter abbreviated as " ABA) synthesis and accumulation.

ABA is a regulatory factor for plant protection against abiotic stress, especially dry stress, and is known to play a very important role in plant growth and development. It has been reported that plants pretreated with ABA and stressed are more resistant to stress than those without stress, whereas mutant plants that fail to produce ABA or fail to respond to ABA are said to be stressed. Therefore, using the proteins involved in the ABA response, it is expected that plants with improved resistance to environmental stress can be developed.

ABA signaling is known to modulate the expression of various stress-related genes such as transcription factors and E3 ligase that are involved in the regulation of osmotic adaptation and hydraulic conductivity, but the complete ABA signaling pathway has not yet been identified It was not. In order to initiate ABA signaling in plant cells, the ABA receptor must be present and signal to the sub-protein. PYR / PYL / RCARs as ABA receptors are known to play a role in recognizing ABA. When the receptor recognizes ABA, it promotes expression of specific genes and ion channel activation through phosphorylation of the target protein, which allows the plant to adapt to the adverse environment.

As the desertification progresses today, water shortage causes big problems in agriculture and the environment. Therefore, it is necessary to develop plants that can survive in a dry environment even if water is used less. When these techniques are developed and applied to crops, agricultural production is expected to increase greatly. In particular, dry areas can contribute to improving agricultural productivity because plants with improved dry resistance, that is, plants capable of lowering the transpiration activity, In addition, it can be useful for environmental purification in areas where the environment is very dry.

Accordingly, a method for enhancing resistance to dry stress of a plant has been the subject of research, and studies have been conducted on genes related to dry stress tolerance and growth promotion and transgenic plants corresponding thereto, 10-1291365), but it is still not enough.

The present inventors investigated the relationship between the dry stress response through the regulation of the ABA signal transduction pathway and found that CaAIEF1 ( Capsicum annuum A bscisic acid-induced Ethylene Responsive Factor 1) gene was identified and the present invention was completed by confirming that the gene functions as a positive regulator of ABA signal transduction promoting dry stress resistance of plants.

Accordingly, an object of the present invention is to encode a protein that promotes resistance to a dry stress, and comprises CaAIEF1 ( Capsicum annuum A bscisic acid-induced Ethylene Responsive Factor 1) and an object thereof is to provide a recombinant expression vector containing the gene, CaAIEF1 protein, and the CaAIEF1 gene consisting of the amino acid sequence of SEQ ID NO: 2 encoded by the gene CaAIEF1.

Another object of the present invention is to provide a novel CaAIEF1 A gene / protein, and a composition for promoting dry stress resistance of a plant comprising the gene or protein as an active ingredient.

Yet another object of the present invention is to provide a method The present invention provides a method for enhancing dry stress resistance of a plant by transgenic transformation of a gene into a plant.

It is still another object of the present invention to provide a transgenic plant improved in dry stress resistance by the above method.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In order to accomplish the object of the present invention, the present invention encodes a protein that promotes resistance to drying stress, and comprises CaAIEF1 ( Capsicum annuum A bscisic acid-induced Ethylene Responsive Factor 1) provides CaAIEF1 protein, and a recombinant expression vector containing the gene CaAIEF1 consisting of the amino acid sequence of SEQ ID NO: 2 encoded by the gene, the gene CaAIEF1.

The present invention also provides a composition for promoting dry stress resistance of a plant comprising the gene or the CaAIEF1 protein consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient.

The present invention also provides a method for enhancing dry stress resistance of a plant, comprising the following steps.

(a) transforming the gene of SEQ ID NO: 1 encoding the CaAIEF1 protein into a plant; And

(b) overexpressing the CaAIEF1 protein in the transformed plant.

The present invention also provides a transgenic plant improved in dry stress resistance by the above method.

The present invention relates to novel CaAIEF1 coding for resistance to dry stress And the CaAIEF1 protein functioned as a positive regulator of ABA signal transduction. As a result of confirming the effect of enhancing the dry stress resistance in the transgenic plant overexpressing the protein, the CaAIEF1 gene It can be used for the improvement of crops available to mankind through the regulation of expression, and it is expected to be useful for improving the productivity of plants.

FIG. 1 shows the result of confirming a new transcription factor induced by ascicic acid (ABA). FIG. 1A shows the CaAIEF1 gene (Capsicum annuum ABA-Induced ERF 1) isolated from a leaflet treated with 50 μM ABA, Figure 1B shows that CaAIEF1 1C shows that the CaAIEF1 can function as a transactivation function in a yeast having a series of deletion constructs. Fig. 1C shows that the C-terminal region contains an acidic domain. to be.
Figure 2a shows the effect of CaAIEF1 on response to abiotic stresses such as drought, ABA and salinity 2b shows the result of confirming the intracellular location of the CaAIEF1 protein.
Figures 3A-3G in Figure 3 show that ABA and abiotic stress induced CaAIEF1 In order to investigate the expression level of the gene, we examined the in vivo function of CaAIEF1 using virus-induced gene silencing (VIGS) pepper and overexpressed Arabidopsis thaliana.
Figures 4A through 4G of Figure 4 show that the CaAIEF1 overexpressing ( CaAIEF1- OX) transgenic plants have increased ABA susceptibility compared to wild-type plants.
5A to 5E in Fig. 5 are results of confirming whether the CaAIEF1- overexpressing ( CaAIEF1- OX) transgenic plant has a phenotypic change with respect to drought stress as compared with a wild-type plant.
FIG. 6 shows whether stress-responsive genes of pepper and Arabidopsis are directly or indirectly regulated by expression levels of CaAIEF1 . FIG. 6a shows the results of qRT-PCR analysis FIG. 6b shows that the induction of various stress-responsive genes was lower in leaves of CaAIEF1- OX plants than in wild-type plants.

The present inventors have identified CaAIEF1 ( Capsicum annuum ABA-induced Ethylene Responsive Factor 1) gene which functions as a positive regulator of ABA signal transduction and confirmed the increase in resistance to dry stress in transgenic Arabidopsis plants overexpressing the gene The present invention has been completed.

Accordingly, the present invention provides a CaAIEF1 gene consisting of the nucleotide sequence of SEQ ID NO: 1, which encodes a positive regulatory factor protein for dry stress.

The gene of the present invention, CaAIEF1 , preferably consists of the nucleotide sequence of SEQ ID NO: 1, and the peptide encoded by the CaAIEF1 gene may preferably comprise the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.

As used herein, a " positive regulator protein " refers to a protein that acts in an increasing direction in the regulation of life events. That is, when the gene of the present invention, CaAIEF1, is overexpressed, the resistance to ABA sensitivity increase and dry stress can be increased.

In studying dry stress resistance through regulation of ABA signaling pathway, we have identified CaAIEF1 , an ethylene-responsive transcription factor induced by ascisic acid (ABA) (see Example 2), and the CaAIEF1 gene Were associated with ABA signal transduction and abiotic stress response.

First, in one embodiment of the present invention, the expression level of the CaAIEF1 gene in response to abiotic stresses such as drought, ABA and salinity was confirmed by performing qRT-PCR, and the expression of CaAIEF1 protein in the nucleus was confirmed by GFP fluorescence (See Example 3).

In another embodiment of the present invention, the in vivo function of CaAIEF1 was confirmed using virus-induced gene silencing (VIGS) pepper and overexpressed Arabidopsis thaliana (see Example 4).

In another embodiment of the present invention, it has been determined whether the CaAIEF1 overexpressing ( CaAIEF1- OX) transgenic Arabidopsis plants increase ABA susceptibility compared to wild type plants (see Example 5).

In another embodiment of the present invention, it has been determined whether the CaAIEF1 overexpression ( CaAIEF1- OX) plants are altered in phenotype relative to wild-type plants (see Example 6) for drought stress, Was directly or indirectly regulated by the level of expression of CaAIEFl (see Example 7).

Therefore, by increasing the expression or activity of CaAIEF1 protein can enhance the resistance (tolerance) to the drought stress the plants, and thus, another aspect of the invention, the invention comprises a CaAIEF1 protein or a gene encoding the same, as an active ingredient The present invention provides a composition for promoting dry stress resistance of a plant.

In another aspect of the present invention, the present invention provides a method for producing (a) CaAIEF1 ( Capsicum annuum Transforming the gene of SEQ ID NO: 1 encoding the ABA-induced Ethylene Responsive Factor 1) protein into a plant; And (b) overexpressing the CaAIEF1 protein in the transgenic plant, and a method for promoting dry stress resistance of a plant, and a transgenic plant having enhanced dry stress resistance by the method.

In the present invention, the plant (sieve) is a food crop including rice, wheat, barley, corn, soybean, potato, red bean, oats, sorghum; Vegetable crops including Arabidopsis, cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, squash, onions, onions and carrots; Special crops including ginseng, tobacco, cotton, sesame seed, sugar cane, beet, perilla, peanut, and rapeseed; Fruit trees including apple trees, pears, jujube trees, peaches, sheep grapes, grapes, citrus fruits, persimmons, plums, apricots, and bananas; Roses, gladiolus, gerberas, carnations, chrysanthemums, lilies, tulips; And feedstuffs including ragras, red clover, orchardgrass, alfapa, tall fescue, perenniallaigrus, and the like, most preferably Arabidopsis or pepper.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[ Example ]

Example  1. Experimental Preparation and Experimental Methods

1-1. Plant materials and growth conditions

Pepper (Capsicum annuum L., cv. Nockwang), Arabidopsis ( Arabidopsis (peat moss: perlite: vermiculite = 5: 3: 2, v / v / v), and saturates of seeds of the thaliana : ecotype Col-0 and tobacco ( Nicotiana benthamiana ) sand, and loam soil were mixed with 1: 1: 1 (v / v / v) and sowed. The pepper plants and tobacco plants were then grown under the light of white fluorescent lamps (130 μmol photons m ^-2 S ^-1 ; 16 hours per day) in the growth chamber at 24 ± 1 ° C.

1-2. CaAIEF1 of  Transcriptional activation assay ( Transactivation  analysis)

The coding region of the full length and truncated CaAIEF1 was cloned into pGBKT7 vector (Clontech, Palo Alto, Calif.) Containing the GAL4 DNA-binding domain. Beer yeast ( Saccharomyces Transcriptional activation by CaAIEF1 in S. cerevisiae strain AH109 was investigated, and Ade1 and His3 reporter genes were induced by the GAL4 promoter. Yeast cells were transformed with an expression vector (Clontech, Palo Alto, Calif.) Carrying the GAL4- CaAIEF1 fusion gene (GAL4- CaAIEF1 fusion genes) as described in the manufacturer's instructions. Transfected yeast cells were transferred to SD (-Ade, -His, -Leu, -Trp) medium after SD (-Trp, -Leu) medium selection.

1-3. Virus-induced gene silencing ( VIGS )

For loss-of-function analysis of CaAIEF1 , virus-induced gene silencing (VIGS) was performed in pepper plants. Briefly Agrobacterium tumefaciens strain GV3101 carrying pTRV1 and pTRV2: CaAIEF1 or pTRV2: 00 as a negative control was infiltrated into fully expanded cotyledons of pepper (OD ₆₀₀ = 0.2 for each strain). The plants were placed in a growth chamber set at 24 ° C for 16 hours / 8 hours at night to allow growth and virus propagation.

1-4. CaAIEF1  Production of transgenic Arabidopsis overexpressed genes

Of CaAIEF1 For functional analysis, CaAIEF1 The Arabidopsis pedigreed with differentiated genes was constructed. The full-length coding region of the CaAIEF1 gene was inserted into the pENTR / D-TOPO vector (Invitrogen, Carlsbad, Calif.). Through the LR reaction, the cloned gene was introduced into pK2GW7 to constitutively express each gene under the control of the CaMV 35S promoter (Karimi et al. 2002), and Agrobacterium tumefaciens ) strain GV3101. The floral dip method was applied to Arabidopsis transformation using CaAIEF1 . The overexpressed plant was selected for germination seeds, which were supposed to be transgenic seeds in MS plates supplemented with kanamycin 50 μg · mL ^-1 selectable marker. The seeds of the T3 plants were harvested in second generation transgenic plants with a 3: 1 dissociation rate on MS plates supplemented with the same antibiotics.

1-5. ABA, dry stress, NaCl treatment and morphology analysis

In pepper plants, CaAIEF1 ABA, NaCl and dried leaf samples were prepared in order to observe the change of gene expression patterns. Six-leaf stage pepper plants were sprinkled with 100 μM ABA, irrigated with salt solution (200 mM) and carefully removed from the soil to prevent damage. Next, whole plants were either dried in 3-mm paper (Whatman, Clifton, UK) or roots were removed and the aerial parts of the plants were dried. After this treatment, the third and fourth leaves were harvested at a given point in time.

For dehydration tolerance assays, 4-week-old gene-silenced pepper plants and control pepper plants and transgenic 3 rd Arabidopsis and wild-type plants were randomly assigned and cultivated on days 12 and 10 During which the water cycle was stopped to give dry stress. The survival rate was then calculated by adding water to the plant and counting the number of plants with rehydrated leaves for 5 days. In order to quantitatively measure the dryness resistance, leaves isolated from gene-silenced pepper plants and transgenic Arabidopsis plants were dried to determine water loss rates. The leaves were placed in a growth chamber with 40% relative humidity, and the loss of fresh weight was measured at the specified time, and the experiment was repeated three times.

For quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis, CaAIEF1 Four-week-old transgenic and wild-type plants overexpressing the gene were carefully removed from the soil and harvested at the set time after treatment with dry stress.

1-6. Stomatal aperture  Biological assay

For biological assays of pore openings, the primary and secondary leaves of red pepper and 4-week-old Arabidopsis plants were harvested, the leaves were removed, and the stomatal opening solution (SOS: 50 mM KCl, 10 mM MES-KOH, pH 6.15, 10 mM CaCl ₂ ). Pore closure was induced by replacing the SOS solution with various concentrations of ABA. After 2.5 hours of incubation, 100 pores were arbitrarily observed in each sample using a Nikon eclipse 80i microscope. Image J 1.46r (http://imagej.nih.gov/ij) was used to measure the pore size and length Respectively. The experiments were performed independently each three times.

1-7. Ten Imaging method (Thermal imaging)

Four-week-old pepper plants with fully grown primary and secondary leaves were treated with 50 μM ABA, and 3-week-old Arabidopsis root was removed to give dry stress. Thermal images were obtained using an infrared camera (FLIR systems; T420), and plant leaf temperatures were measured using FLIR Tools + ver 5.2 software.

1-8. RNA extraction and qRT - PCR

Total RNA was extracted using RNeasy Mini kit (Qiagen, Valencia, Calif.). Each leaf was harvested from pepper and Arabidopsis plants which were treated with ABA or given dry stress. All RNA samples extracted from the leaves of the plants were digested with RNAse-free DNase (RNAse free DNase) to remove the genomic DNA and cDNA synthesis was performed using the Transcript First Strand cDNA synthesis kit (Roche, Indianapolis, IN, USA) Respectively. For qRT-PCR analysis, the cDNA synthesized by the above method was amplified using a CFX96 ™ Touch ™ Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA) together with iQ ™ SYBR Green Supermix and specific primers as shown in Table 1 below. . All reactions were performed in triplicate. PCR was performed with a program of 45 cycles at 95 ° C for 5 minutes, 95 ° C for 20 seconds, 60 ° C for 20 seconds, and 72 ° C for 20 seconds. The relative expression level of each gene was calculated by the ΔΔCt method, and Arabidopsis actin8 ( AtACT8 ) gene and pepper actin 1 ( CaACT1 ) gene were used for normalization.

Primer name Primer sequence (5'-3 ') For cloning CaAIEF1 Forward ATGGTTCCAACTCACCAAAGTGAT Reverse TCAGAGCGCCAAGAAATTCTC For RT-PCR CaAIEF1 Forward TGGTTCCAACTCACCAAAGTG Reverse AACGCCTCTGTATTTCTTGCC CaACT1 Forward GACGTGACCTAACTGATAACCTGAT Reverse CTCTCAGCACCAATGGTAATAACTT CaNCED3 Forward AGATTAGTTCAAGAACGTGAATTGG Reverse ACTTGATAAGGGACATCATCTTCAG CaLOX1 Forward ACGTAATCTCTGGGAAAAATGACGAT Reverse ACGTGACATCAAAGGCTGATTCGC CaMLO2 Forward ATGGCTAAAGAACGGTCGATGGA Reverse GGTCATCATACTCAGACTTGACATCTTCAT Actin8 Forward CAACTATGTTCTCAGGTATTGCAGA Reverse GTCATGGAAACGATGTCTCTTTAGT NCED3 Forward ACATGGAAATCGGAGTTACAGATAG Reverse AGAAACAACAAACAAGAAACAGAGC RD29A Forward CACAATCACTTGGCTCCACTGTTG Reverse ACCTAGTAGCTGGTATGGAGGAACT RD29B Forward GTTGAAGAGTCTCCACAATCACTTG Reverse ATTAACCCAATCTCTTTTTCACACA COR15A Forward GATACATTGGGTAAAGAAGCTGAGA Reverse ACATGAAGAGAGAGGATATGGATCA RAB18 Forward GGAAGAAGGGAATAACACAAAAGAT Reverse GCGTTACAAACCCTCATTATTTTTA KIN1 Forward TGTTAACTTCGTGAAGGACAAGAC Reverse AAGTTTGGCTCGTCTAATAATTTTG

1-9. Subcellular localization analysis

CaAIEF1 -GFP fusion protein is Agrobacterium (Agrobacterium strains having a p19 tumefaciens ) Was transiently expressed in leaves of tobacco ( N. benthamiana ) epidermal cells using agroinfiltration of strain GV3101 (1: 1 ratio; OD ₆₀₀ = 0.5). After infiltration for 2 days, GFP signals were observed with a confocal microscope equipped with LSM Image Browser software (510 UV / Vis Meta; Zeiss, Oberkochen, Germany).

1-10. Statistical analyzes

Statistical analysis was performed using student's t-test or ANOVA (Fisher's LSD test) to determine significant differences between genotypes. P value was less than 0.05.

Example 2. Ethylene Reaction Transcription Factor CaAIEF1  Isolation and sequencing

To identify new transcription factors induced by ascisic acid (ABA), CaAIEF1 (Capsicum annuum ABA-Induced ERF) was isolated from the leaflets treated with 50 [mu] M ABA through the RNA-seq analysis according to Example 1-8 above 1) genes were isolated.

As a result, as shown in Fig. 1A, CaAIEF1 contains one conserved AP2 / ERF domain consisting of 65 amino acids (59-123) in the central region of CaAIEF1 encoded with 180502 amino acids and 30 amino acids 151 -180), and these domains can specifically bind to the promoter region to activate the target gene.

In addition, a nuclear localization signal (NLS) was presumed in the AP2 / ERF domain. The amino acid sequence of 4 ERF protein members in CaAIEF1 and other plant species showed that these ERF proteins were highly conserved in the AP2 / ERF region. More specifically, the CaAIEF1 protein is Solanum tuberosum (accession no. XP_006367196.1), Nicotiana tomentosiformis (accession No. XP_009619682.1), Nicotiana tabacum (accession No. XP_016487471.1), and Solanum share the ERF protein of lycopersicum (accession no. XP_004245586.1) (79.1-87.9%).

Further, as shown in FIG. 1B, the CaAIEF1 contains an acidic domain in the C-terminal region, and CaAIEF1 Gene was able to function as a transactivation in yeast with a series of deletion constructs. The deletion construct was fused to a vector for yeast GAL4 DNA binding domain expressed under the control of the ADH1 promoter in Saccharomyces cerevisiae strain AH109.

As a result, as shown in Fig. 1C, yeast cells having a C-terminal region containing an acidic domain grew well in the selective medium, suggesting that the reporter gene was activated. Through this, it was confirmed that the C-terminal region including the acidic domain of CaAIEF1 could serve as a potential transcription promoting function.

Example 3. CaAIEF1 Expression of genes and CaAIEF1  Location of intracellular action of protein

Based on the results of Example 2, qRT-PCR was performed according to Example 1-8 in order to confirm CaAIEF1 gene expression in response to abiotic stresses such as drought, ABA and salinity.

As a result, as shown in Fig. 2A, the expression level of CaAIEF1 was regulated within 2 hours, and decreased in gradually dried green leaf. CaAIEF1 gene was induced in ABA - treated pepper leaves within 6-24 hours. In addition, the CaAIEF1 transcripts began to accumulate within 2 hours and reached a peak level after 12 hours.

In addition, as shown in Fig. 2B, the intracellular location of the CaAIEF1 protein was confirmed. CaAIEF1 has an NLS in the AP2 / ERF domain of the center 1 region (amino acids 202-219), and green fluorescent protein (GFP) cDNA is fused to the full-length coding region of the fused CaAIEF1 under the control of the 35S promoter. As a result, GFP fluorescence signals were detected in Nicotiana benthamiana ) cells, indicating that CaAIEF1 plays a role in the nucleus.

Example 4. CaAIEF1 Reduced dry resistance in gene silenced pepper plants

ABA and CaAIEF1 induced by abiotic stress To investigate the expression levels of genes, in vivo functions of CaAIEF1 were investigated using virus-induced gene silencing (VIGS) pepper and overexpressed Arabidopsis thaliana.

As a result of the semi-quantitative RT-PCR analysis, as shown in Fig. 3A, the CaAIEF1 transcription factor was expressed in the control pepper plant (TRV: 00) but not in the CaAIEF1 gene silent pepper plant (TRV: CaAIEF1 ).

In addition, as shown in FIG. 3B, the biological function of CaAIEF1 against drought stress did not show different phenotypes in both plants when water was well fed (see the upper part of FIG. 3B) , The CaAIEF1 gene silent pepper plants showed a more aged phenotype than the control plants (see middle and bottom of FIG. 3B). The survival rate of the control pepper plants was 80.0% after 3 days of water supply, and only 10.0% of the CaAIEF1 gene silent pepper plants resumed their growth.

On the other hand, as shown in FIG. 3C, the fresh weight of rosette leaves was measured for 8 hours after isolation to investigate the increased sensitivity of drought stress in CaAIEF1 gene silenced pepper plants due to abrupt water loss. Water loss was significantly higher in the CaAIEF1 gene silent pepper plants than in the control plants.

In order to investigate the role of CaAIEF1 in the ABA signaling pathway in drought stress, one pore diameter and leaf temperature of the control and CaAIEF1 gene silenced pepper plants were measured in the absence and presence of ABA, as shown in Figures 3d to 3g.

As a result, as shown in FIGS. 3D and 3E, when the ABA was deficient, no other pore size was observed between the control and the CaAIEF1 gene silent pepper plants. However, after exposure to 10 and 20 μM ABA, the pore size of the CaAIEF1 gene silent pepper leaves was significantly larger than that of the control.

In addition, as shown in Figures 3F and 3G, the leaf temperature of the CaAIEF1 -silenced pepper plants was significantly lower than that of the control plants, indicating that evaporation cooling increased with decreasing pore closure.

These results show that decreasing the ABA susceptibility of the CaAIEF1 gene silent pepper plants increases water loss and induces drought-sensitive phenotypes.

Example 5.  CaAIEF1 Confirmation of increased ABA susceptibility of plants

As shown in Fig. 4, in order to use these transgenic plants for phenotypic analysis in response to ABA and drought stress, CaAIEF1 was induced by ABA and then CaAIEF1 expression was promoted and used to regulate ABA signaling. To test whether CaAIEF1 affects ABA mediated responses, ABA susceptibility analyzes of germination and germination were performed, including seed germination, seedling establishment and root growth by wild-type and CaAIEF1- OX plants.

As a result, both seeds were germinated in a growth medium with or without ABA, as shown in Fig. 4A. However, in the absence of ABA, the wild-type and CaAIEF1- OX plants showed a distinct germination rate, while the CaAIEF1 -OX seeds germinated faster than the wild-type seeds treated with 1.5 μM ABA 1.

In addition, as shown in Figures 4B-4D, after 12 days of seed plating, the seedling establishment of CaAIEF1- OX was lower than that of wild-type plants.

And, as shown in Figs. 4E and 4F, the major root growth of CaAIEF1- OX plants was more damaged than that of the wild-type plants.

As shown in FIG. 4G, when CaAIEF1- overexpressing ( CaAIEF1- OX) transgenic Arabidopsis plants were analyzed by semi- quantitative RT-PCR, CaAIEF1 Was expressed only in two independent T3 homozygous transgenic plants .

The results show that CaAIEF1- OX plants have increased ABA susceptibility compared to wild-type plants, indicating that CaAIEF1 regulates the ABA-mediated response.

Example 6. CaAIRF1 Confirmed increase in dry stress resistance of overexpressed plants

As shown in Fig. 5, the CaAIEF1 gene silent pepper plants exhibited drought-sensitive phenotypes and examined whether the CaAIEF1 overexpressing ( CaAIEF1- OX) plants were altered in phenotype relative to wild-type plants against drought stress.

As a result, no apparent difference was observed between wild type and CaAIEF1- OX plants with sufficient water supply (see left side of FIG. 5A), drought stress (see middle of FIG. 5A) (See right side of Figure 5A), CaAIEF1- OX plants appeared less wilted than wild-type plants. Moreover, the survival rate of CaAIEF1- OX plants was 76.6-93.8% higher than that of wild-type plants (10.7%).

As shown in FIG. 5B, when the biomass of the rosette leaves of the two plants was measured to confirm the drought resistance phenotype, the isolated leaves of the CaAIEF1 -OX plants showed less water loss than the wild type plants corresponding to the drought phenotype .

On the other hand, as shown in Figs. 5C and 5D, no significant difference was found in the pore size between wild-type and CaAIEF1- OX plants before ABA treatment. In both plants ABA treatment resulted in increased pore closure in wild-type and transgenic plants, but the pore size of CaAIEF1- OX plants was significantly smaller than that of wild-type plants.

As shown in FIG. 5E, when leaf temperature, which is an index of pore opening and closing by evaporation cooling, was measured, when the wild type and transgenic plants were exposed to ABA, the leaf 1 temperature of the CaAIEF1 -OX plant was 1 Temperature.

These results show that hypersensitivity to ABA in pores of CaAIEF1- OX plants can reduce water loss and increase drought tolerance.

Example 7: Stress response of plants CaAIEF1 ≪ / RTI > expression level of the < RTI ID = 0.0 >

As the expression level of stress response genes in plants affects the determination of stress resistance or sensitivity, as shown in Fig. 6, the stress-responsive gene of pepper and Arabidopsis is directly or indirectly regulated by the expression level of CaAIEF1 .

As a result, when the root was removed from the soil to apply dry stress to the plant and qRT-PCR analysis was carried out, the induction of the stress-responsive gene of the pepper plants was higher in the CaAIEF1 gene silent pepper than in the control plant .

In contrast, as shown in FIG. 6B, the induction of several stress response genes including NCED3, RD29A, RD29B, COR15A, RAB18 and KIN1 was lower in leaves of CaAIEF1- OX plants than in wild type plants.

From these results, it can be seen that CaAIEF1 expression negatively affects the expression level of the stress response gene.

It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the present invention as defined by the following claims. There will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> Method for improving the resistance to drought stress using          pepper transcription factor CaAIEF1 in plants <130> MP17-033 <160> 2 <170> KoPatentin 3.0 <210> 1 <211> 543 <212> DNA <213> Capsicum annuum Abscisic acid-induced Ethylene Responsive Factor 1 - CaAIEF1 <400> 1 atggttccaa ctcaccaaag tgatctacct cttaatgaga acgactcaca agagatggta 60 ttatacgaag tcctcaatga agctaataac ctccacatcc catatttgcc tcaaagaaac 120 caattgatac ctagaaataa tcatatcctt cgtccatcac aaaccatagg caagaaatac 180 agaggcgttc gacgtcgccc gtgggggaaa tacgcagctg aaattcgaga ttccgctcga 240 catggtgcga gagtatggct aggcacgttt gaaacggccg aagaagctgc tttggcttat 300 gatagagcgg cttttagaat gcgtggtgct aaggcactac ttaatttccc atctgaaata 360 gtcacatcat ctgtttcagt agataaatta agtttgtgct caaacagtta cactactaat 420 agttcaaatt cgaattcaaa tgaagtttca agtggagaga atgatttaa atcaagaatt 480 tcaaatcagt tttctcaaga cgttaagaca gaattgtgca tggagaattt cttggcgctc 540 tga 543 <210> 2 <211> 179 <212> PRT <213> Capsicum annuum Abscisic acid-induced Ethylene Responsive Factor 1 - CaAIEF1 <400> 2 Met Val Pro Thr His Gln Ser Asp Leu Pro Leu Asn Glu Asn Asp Ser   1 5 10 15 Gln Glu Met Val Leu Tyr Glu Val Leu Asn Glu Ala Asn Asn Leu His              20 25 30 Ile Pro Tyr Leu Pro Gln Arg Asn Gln Leu Ile Pro Arg Asn Asn His          35 40 45 Ile Leu Arg Pro Ser Gln Thr Ile Gly Lys Lys Tyr Arg Gly Val Arg      50 55 60 Arg Arg Pro Trp Gly Lys Tyr Ala Ala Glu Ile Arg Asp Ser Ala Arg  65 70 75 80 His Gly Ala Arg Val Trp Leu Gly Thr Phe Glu Thr Ala Glu Glu Ala                  85 90 95 Ala Leu Ala Tyr Asp Arg Ala Ala Phe Arg Met Arg Gly Ala Lys Ala             100 105 110 Leu Leu Asn Phe Pro Ser Glu Ile Val Thr Ser Ser Val Val Asp Lys         115 120 125 Leu Ser Leu Cys Ser Asn Ser Tyr Thr Thr Asn Ser Ser Asn Ser Asn     130 135 140 Ser Asn Glu Val Ser Ser Gly Glu Asn Val Phe Lys Ser Arg Ile Ser 145 150 155 160 Asn Gln Phe Ser Gln Asp Val Lys Thr Glu Leu Cys Met Glu Asn Phe                 165 170 175 Leu Ala Leu            

Claims (7)

delete delete delete delete A method for enhancing dry stress resistance of a plant comprising the steps of:
(a) transforming a plant with a gene of SEQ ID NO: 1 encoding CaAIEF1 ( Capsicum annuum A biscisic acid-induced Ethylene Responsive Factor 1) protein; And
(b) overexpressing the CaAIEF1 protein in the transformed plant.
6. The method of claim 5,
Wherein the CaAIEF1 protein consists of the amino acid sequence of SEQ ID NO: 2.
A transgenic plant having improved dry stress resistance by the method of claim 5.

Images