KR102101691B1 - Method for improving the resistance to the drought stress using CaSIBZ1 in plants - Google Patents

Abstract

The present invention is a novel CaSIBZ1 derived from pepper (Capsicum annuum SIR1-Interacting bZIP transcription factor 1) Gene / protein, and a method for improving dry stress resistance of plants using the same.
The present invention has identified the CaSIBZ1 gene that encodes a protein that promotes resistance to dry stress, and the CaSIBZ1 protein functions as a negative regulator of ABA signaling and confirms the effect of reducing dry stress resistance in transgenic plants overexpressed with the protein. CaSIBZ1 gene Through expression control, it can be used for improvement of crops that can be used by humans, and it is expected to be useful for improving plant productivity.

Description

Method for improving the resistance to the drought stress using CaSIBZ1 in plants}

The present invention is a novel CaSIBZ1 (Capsicum annuum) derived from pepper SIR1-Interacting bZIP transcription factor 1) Gene, protein, and relates to a method for enhancing dry stress resistance of plants using the same.

Global warming causes severe climate change, causing environmental stress that inhibits the normal growth and development of plants, while plants have evolved sophisticated defense mechanisms to survive in adverse environments such as cold, high salt, and drought. For example, drought is caused by an environment lacking moisture and severely affects the normal growth of plants, resulting in a decrease in crop yields. Plants are closed with pores, abscisic acid (abscisic acid) to adapt to this dry stress. ABA) activates various defense mechanisms such as synthesis and accumulation.

ABA is a modulator for protecting plants against abiotic stress, especially dry stress, and is known to play a very important role in plant growth and development. ABA signaling is known to regulate the expression of various stress-related genes such as E3 ligase and transcription factors involved in osmotic adaptation and regulation of root hydraulic conductivity, but the complete ABA signaling pathway has yet to be identified. Did not. In order to initiate ABA signaling in plant cells, the ABA receptor must be present and the signal must be delivered to the lower protein. To date, it is known that PYR / PYL / RCARs as ABA receptors play a role in ABA recognition. When the receptor recognizes ABA, sub-proteins are phosphorylated and dephosphorylated by SnRK2 (non-fermenting 1-related subfamily 2) protein kinase and PP2Cs (type 2C protein phosphatases), respectively. SnRK2, SnRK2.3, and SnRK2 phosphatases such as SnRK2.6 (OST1) function as a positive regulator of ABA signaling, whereas group A PP2Cs phosphatase functions as a negative regulator of ABA. , ABA receptor PYR / PYL / RCAR proteins interact with group A PP2Cs and have been reported to inhibit their activity. When ABA expression increase is recognized by PYR / PYL / RCAR, protein phosphatase-phosphatase interaction is inhibited, and SnRK2 type phosphatase secretion is induced. SnRK2 phosphatase promotes the expression of specific genes and ion channel activation through phosphorylation of target proteins including transcription factors and SLAC1 anion channels, which allows plants to adapt to adverse environments.

On the other hand, proteolysis through the ubiquitination pathway is one of the important mechanisms for plants to regulate adaptive and defense responses to abiotic stress. Ubiquitination is an important post-translational regulatory process caused by the continuous action of three enzymes consisting of ubiquitin activating enzyme (E1), ubiquitin-conjugating enzyme (E2) and ubiquitin ligase (E3). When ubiquitin is activated by E1, the activated ubiquitin is transferred to E2 and the E3 ligase binds the ubiquitin and target protein. In this process, E3 ligase determines the target protein and binds it.

Ubiquitination is an intrinsic mechanism in cells, and it is known that hundreds or thousands of E3 ligases exist in eukaryotic cells depending on various target proteins. E3 ligase is classified into two types according to the subunit configuration: RING (really interesting new gene), HECT (homology to E6-AP C-terminus), and PUB (plant U-box) E3 ligase is a single sub While composed of units, SCF (S-phase kinase-associated protein) / cullin / F-box (Skp) and CUL4-DDB1 (CULLIN4-damaged-specific DNA binding protein1) are composed of multiple subunits. Recently, more than 1,400 E3 ligases have been reported in Arabidopsis plants, Arabidopsis genomes encode 242 RING E3 ligase, and RING E3 ligase adapts to biological and abiotic stress. It was reported to be involved. RING E3 ligase is rice ( Oryza sativa ), corn ( Zea mays ), pepper ( Capsicum annum ) and Arabidopsis ( Arabidopsis) thaliana ) is known to act as a positive or negative regulator in response to ABA signaling and abiotic stress in various monocotyledonous and dicotyledonous plants, which means that it is widely preserved in plants (Plant Biotechnol J 11, 432 -445). Recently, it has been reported that RSL1, a RING type E3 ligase, is involved in the degradation through ubiquitination of ABA receptors such as PYR1 and PYL4 in the cell membrane, and CRL4-type E3 ligase complex degrades the PYL8 ABA receptor.

Meanwhile, one of the most prevalent transcription factors in plants is the bZIP protein. The bZIP gene is present in all eukaryotic organisms, has a basic region required for DNA binding and a leucine zipper motif responsible for dimerization, and homo- or hetero-dimerization of the bZIP protein before binding to the promoter. dimerization). Such bZIP transcription factors include OsABF3, CAbZIP1, and the like.

Accordingly, research into a method for improving resistance to various environmental stresses such as drought, salt, cold, heat, and pathogens using these bZIP transcription factors has been conducted. The development of crops resistant to environmental stress is expected to greatly contribute to the increase in agricultural production, and the need for more active research is emerging.

Republic of Korea Registered Patent 10-1775788 Republic of Korea Registered Patent 10-1608175

The present invention is conceived to solve the above problems, the present inventors have dried in pepper susceptibility bZIP transcription factor gene CaSIBZ1 (Capsicum annuum SIR1-Interacting bZIP transcription factor 1) The gene was identified, and when the gene was silenced, it was confirmed that it promotes the dry stress resistance of the plant, and based on this, the present invention was completed.

An object of the present invention is a CaSIBZ1 (Capsicum annuum) consisting of the nucleotide sequence of SEQ ID NO: 1 that encodes a negative regulator protein against dry stress. SIR1-Interacting bZIP transcription factor 1) to provide a gene.

Another object of the present invention is to provide a CaSIBZ1 protein consisting of the amino acid sequence of SEQ ID NO: 2 encoded by the CaSIBZ1 gene.

Another object of the present invention is to provide a recombinant expression vector containing the CaSIBZ1 gene.

Another object of the present invention is to provide a composition for enhancing the dry resistance of plants, comprising an inhibitor of the expression or activity of CaSIBZ1 (Capsicum annuum SIR1-Interacting bZIP transcription factor 1) protein as an active ingredient.

Another object of the present invention is a method for enhancing dry stress resistance of a plant comprising the step of inhibiting the expression or activity of the CaSIBZ1 protein, wherein the CaSIBZ1 protein is composed of the amino acid sequence of SEQ ID NO: 2, and the dry stress of the plant. It is to provide a method for enhancing resistance.

However, the technical problem to be achieved by the present invention is not limited to the problems mentioned above, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the object of the present invention as described above, the present invention is a CaSIBZ1 (Capsicum annuum SIR1 -Interacting bZIP transcription factor 1) consisting of the nucleotide sequence of SEQ ID NO: 1 encoding a negative regulator protein for dry stress. Gene.

The present invention provides a CaSIBZ1 protein consisting of the amino acid sequence of SEQ ID NO: 2 encoded by the CaSIBZ1 gene.

The present invention provides a recombinant expression vector containing the CaSIBZ1 gene.

The present invention provides a composition for enhancing the dry resistance of plants, comprising an inhibitor of the expression or activity of CaSIBZ1 (Capsicum annuum SIR1-Interacting bZIP transcription factor 1) protein.

The present invention is a method for enhancing dry stress resistance of a plant comprising the step of inhibiting the expression or activity of the CaSIBZ1 protein, wherein the CaSIBZ1 protein is composed of an amino acid sequence of SEQ ID NO: 2, and a method for enhancing dry stress resistance of a plant. to provide.

The present invention provides a recombinant Virus Induced Gene Silencing (VIGS) vector comprising an open reading frame (ORF) of a gene encoding a CaSIBZ1 (Capsicum annuum SIR1-Interacting bZIP transcription factor 1) protein.

The present invention transforms the plant with the vector to CaSIBZ1 (Capsicum annuum SIR1-Interacting bZIP transcription factor 1) provides a method for enhancing the drying resistance of a plant comprising the step of silencing the gene.

The present invention relates to a novel gene CaSIBZ1 encoding a negative regulator protein for dry stress, wherein the CaSIBZ1 plays an important role in relation to the environmental stress of plants, and negative regulation in Absis acid (ABA) signal transduction As it performs a role, it was confirmed that the effect of controlling the resistance to drying in the plant using this, it is used for the improvement of crops and the like that can be used by humans by regulating the expression of the CaSIBZ1 gene. It is expected to improve productivity.

1A schematically shows the CaSIBZ1 protein.
1B is a result of comparing the amino acid sequence between CaSIBZ1 protein and other plant species proteins.
2A is a result of analyzing changes in the amount of CaSIBZ1 expression through qRT-PCR under ABA, high salt and dry stress conditions.
2B is a result of observing the fluorescence signal of the CaSIBZ1-GFP fusion protein with a confocal microscope to confirm the location of the CaSIBZ1 protein in plant cells.
Figure 3a, CaSIBZ1 -silenced shows the difference in the amount of transcription of CaSIBZ1 between the pepper plant and the control group.
3B is a comparison of the dry phenotype and survival rate of CaSIBZ1- silenced pepper plants and controls.
Figure 3c, CaSIBZ1 -silenced pepper plants and control leaves show the loss rate of water.
3D shows the leaf temperature of CaSIBZ1- silenced pepper plants and controls.
3e shows the porosity of CaSIBZ1- silenced pepper plants and control leaves.
4 is a result of performing the RT-PCR analysis of CaSIBZ1 overexpressing plants ( CaSIBZ1- OX) and control (wild type, WT) plants, confirming the CaSIBZ1 expression level.
FIG. 5A compares the germination rates of CaSIBZ1 overexpressing plants ( CaSIBZ1- OX) and control (wild-type, WT) plants under ABA treatment conditions.
5B shows the hair growth rate of CaSIBZ1 overexpressing plants ( CaSIBZ1- OX) and control (wild-type, WT) plants under ABA treatment conditions.
5C shows the results of FIG. 5B graphically.
FIG. 5D compares the root growth of CaSIBZ1 overexpressing plants ( CaSIBZ1- OX) and control (wild-type, WT) plants under ABA treatment conditions.
Fig. 5E is a graph showing the result of Fig. 5D.
Figure 6a shows the dry phenotype and survival rate of CaSIBZ1 overexpressing plants ( CaSIBZ1- OX) and control (wild type, WT) under dry stress or ABA treatment conditions.
Figure 6b shows the water loss rate of the CaSIBZ1 overexpressing plant ( CaSIBZ1- OX) and control (wild type, WT) leaves under dry stress or ABA treatment conditions.
6C shows the temperature of CaSIBZ1 overexpressing plants ( CaSIBZ1- OX) and control (wild-type, WT) leaves under dry stress or ABA treatment conditions.
6D shows the porosity of leaves in CaSIBZ1 overexpressing plants ( CaSIBZ1- OX) and control (wild type, WT) under dry stress or ABA treatment conditions.
6E is a result of comparing the expression levels of RD29B, RD26, RAB18, and KIN2 with qRT-PCR to confirm the correlation between CaSIBZ1- OX plants and marker genes that respond to drying.

The present inventors identified the CaSIBZ1 gene, which is a bZIP gene that functions as a negative regulator of ABA signaling, and completed the present invention by confirming a decrease in ABA sensitivity and reduced resistance to dry stress in transgenic Arabidopsis plants overexpressed with the gene. .

Accordingly, the present invention provides a CaSIBZ1 (Capsicum annuum SIR1 -Interacting bZIP transcription factor 1) gene consisting of the nucleotide sequence of SEQ ID NO: 1, which encodes a negative regulator protein for dry stress, and of SEQ ID NO: 2 encoded thereby. Provided are amino acid sequence peptides.

The gene of the present invention, CaSIBZ1 , preferably consists of the nucleotide sequence of SEQ ID NO: 1, the CaSIBZ1 The peptide encoded by the gene may preferably consist of the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.

As used herein, "negaitive regulator protein" refers to a protein that acts in a direction of inhibition in regulating life phenomena. That is, when the gene of the present invention, CaSIBZ1, is overexpressed, ABA sensitivity may be reduced and resistance to dry stress may be reduced.

While studying the genes involved in the dry stress response, the present inventors identified the bZIP transcription factor protein, CaSIBZ1 (see Example 2), and promoted pore closure as the sensitivity of abscisic acid (ABA) increased, resulting in drying resistance. Based on the fact that it can promote, abscisic acid or dry stress and CaSIBZ1 The purpose of this study was to investigate the association between genes.

First, in one embodiment of the present invention, it was confirmed through GFP fluorescence that the CaSIBZ1 protein is expressed in the nucleus (see Example 2).

In another embodiment of the present invention, the expression pattern of the CaSIBZ1 gene treated with abiotic stress (ABA, dry or salt) was confirmed, and as a result, it was confirmed that the CaSIBZ1 gene is involved in ABA-signaling and response to dry stress. (See Example 3).

In another embodiment of the present invention, ABA sensitivity by CaSIBZ1 gene silencing is measured by measuring leaf temperature, porosity , moisture loss rate, etc. on the leaves of pepper and normal control pepper plants whose expression of CaSIBZ1 is inhibited under ABA treatment conditions. The increase effect was confirmed, and in fact, it was confirmed that the dry stress resistance was increased compared to the control group in the plants where CaSIBZ1 expression was inhibited (see Example 4).

In yet another embodiment of the present invention, a transgenic Arabidopsis plant overexpressing CaSIBZ1 was prepared to measure leaf temperature, increase rate, morphology and survival rate, and expression changes of related genes in wild-type plants and CaSIBZ1 overexpressing plants under conditions of ABA treatment. Through this, it was confirmed that CaSIBZ1 acts as a negative regulator that enhances the dry stress resistance of plants (see Example 5), and in fact, it was confirmed that the dry resistance decrease when overexpressing the CaSIBZ1 gene in Arabidopsis thaliana plants (see Example 6).

As another aspect of the present invention, a recombinant expression vector containing the CaSIBZ1 gene is provided. In addition, the present invention provides a recombinant Virus Induced Gene Silencing (VIGS) vector comprising an open reading frame (ORF) of a gene encoding the CaSIBZ1 protein.

Virus-induced gene silencing (VIGS), a virus-induced gene silencing phenomenon, is also called virus-induced RNA silencing. It is a kind of gene silencing after transcription that is well-known in various plants and fungi, insects, nematodes, fish, and rats. It is resistant when a virus invades a plant and replicates it. It can be said that the expression and replication of genes and viral genomes are suppressed together. That is, when a part or all of a specific gene derived from the host is inserted into the cDNA of the viral genome and produced by infectious RNA, the target RNA is targeted, and the expression of the target gene is inhibited in the infected host plant. Is lost. As a result, the function of the target gene can be indirectly estimated. The virus-induced gene silencing (VIGS) mechanism is known to be a type of RNA-mediated plant defense mechanism against viruses, and is characterized by 1) gene silencing after transcription 2) RNA conversion 3) nucleotide sequence specificity.

In the present invention, by inserting the transformation vector TRV (Tobacco Rattle Virus) for VIGS into the Agrobacterium, inserting the ORF region of CaSIBZ1 into Agrobacterium and successfully inhibiting the expression of the CaSIBZ1 gene by infiltrating the plant. There is one bar.

In the present invention, the term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a heterologous peptide, or a protein encoded by a heterologous nucleic acid. Recombinant cells can express genes or gene segments not found in the natural form of the cells in either sense or antisense forms. In addition, recombinant cells can express genes found in natural cells, but the genes have been modified and reintroduced into cells by artificial means.

The term "vector" above is used to refer to DNA fragment (s), nucleic acid molecules that are delivered into a cell. Vectors replicate DNA and can be independently reproduced in host cells. Preferred examples of recombinant vectors in the present invention may be, but are not limited to, plasmid vectors, pTRV1 or pTRV2 capable of transferring some of them to plant cells when present in a suitable host such as Agrobacterium tumefaciens Other suitable vectors that can be used to introduce the DNA according to the invention into a plant host include viruses such as those that can be derived from double-stranded plant viruses (e.g., CaMV) and single-stranded viruses, gemini viruses, etc. Vectors, such as incomplete plant viral vectors. The vector can be advantageously used when it is difficult to properly transform a plant host. Further, in the recombinant vector of the present invention, the promoter may be a CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter, but is not limited thereto. The term "promoter" refers to a region upstream of a DNA from a structural gene and refers to a DNA molecule to which RNA polymerase binds to initiate transcription.

As another aspect of the present invention, the present invention provides a composition for enhancing the dry resistance of a plant comprising an inhibitor of expression or activity of CaSIBZ1 protein as an active ingredient.

The inhibitor is a complementary binding to mRNA for the sequence of the CaSIBZ1 gene, a sequence complementary to the sequence, or a fragment of the gene sequence, to inhibit expression by siRNA (small interference RNA), shRNA (short hairpin RNA), miRNA (microRNA) ), Ribozyme (ribozyme), DNAzyme, PNA (peptide nucleic acids), any one of the antisense nucleotides is preferred, a compound that inhibits activity by complementarily binding to the CaSIBZ1 protein, peptide (Peptide), peptide mimetics (Peptide Minetics), an antibody, or an aptamer (aptamer) is preferably any one, but is not limited thereto.

As another aspect of the present invention, the present invention provides a method for enhancing dry stress resistance of a plant comprising the step of inhibiting the expression or activity of the CaSIBZ1 protein.

In the present invention, the plant (sieve) includes rice, wheat, barley, corn, soybeans, potatoes, red beans, oats, food crops including sorghum; Vegetable crops including Arabidopsis, Chinese cabbage, radish, pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion, and carrot; Special crops including ginseng, tobacco, cotton, sesame, sugar cane, beet, perilla, peanut, and rapeseed; Fruit trees including apple trees, pear trees, date palms, peaches, spears, grapes, tangerines, persimmons, plums, apricots, and bananas; Flowers including roses, gladiolus, gerbera, carnation, chrysanthemum, lily, tulip; And ryegrass, red clover, orchardgrass, alpha waves, tol pesque, may be feed logistics including perennial grass, and most preferably, Arabidopsis thaliana or pepper, but is not limited thereto.

Hereinafter, preferred embodiments are provided to help understanding of the present invention. However, the following examples are only provided to more easily understand the present invention, and the contents of the present invention are not limited by the following examples.

[ Example ]

Example  1. Experiment preparation and experiment method

1-1. Plant material and growth conditions

Pepper (Capsicum annuum L., cv. Nockwang), and tobacco ( Nicotiana benthamiana ) seeds are steam sterilized blended soil (peat moss: perlite: vermiculite = 5: 3: 2, v / v / v), sand, and loam soil were mixed and sowed 1: 1: 1 (v / v / v). After that, the pepper plants were grown under white fluorescent light (80 μmol photons m ^-2 · S ^-1 ) in a growth chamber at 27 ± 1 ° C. for 16 hours / 8 hours dark cycle. Tobacco plants were maintained in a growth chamber at 25 ± 1 ° C. for 16 hours light / 8 hours dark cycle. Arabidopsis thaliana (Ectotype Col-0) plant seeds were germinated in Murashige and Skoog (MS) salt with 1% sucrose and Microagar (Duchefa biochemistry). Before all the seeds were placed in the growth chamber, the flowering fruit was allowed to grow for 2 days at 4 ° C, and the plate was cultured at 24 ° C in a growth chamber for 16 hours light / 8 hours dark cycle. Arabidopsis seedlings are steam-sterilized mixed soil (peat moss: perlite: vermiculite = 9: 1: 1, v / v / v) at 24 ° C for 16 hours light / 8 hours dark cycle white Fluorescent lamps (130 μmol photons m ^-2 · S ^-1 ) were maintained at 60% relative humidity under light.

1-2. CaSIBZ1  Gene overexpression transformation Baby pole  Produce

The cDNA of the full-length CaSIBZ1 was coupled to the pENTR / D-TOPO vector (Invitrogen, Carlsbad, CA, USA), and the pK2GW7 binary vector was used for the constitutive expression of the CaSIBZ1 gene using the LR reaction, cauliflower mosaic of the Arabidopsis pole virus (CaMV) was inserted under the control of the 35S promoter. 35S: CaSIBZ1 structure was transformed with Agrobacterium tumefaciens strain GV3101. Agrobacterium tumefaciens mediated transformation was performed through the floral dip method (Clough and Bent, 1998). To select transformed strains, seeds harvested from the transformed plants were sown on MS agar plates containing 50 μg · mL ⁻¹ of kanamycin.

1-3. Yeast two-hybrid assay, Y2H )

The full-length cDNA of CaSIBZ1 or CaSIR1 was subcloned into the pGBKT7 vector. The structure obtained by the above method was introduced into the yeast AH109 strain according to the lithium acetate-mediated transformation method (Ito et al., 1983.) After the synthesis was completed (SC)-leucine-tryptophan medium was selected , Transformants were transferred to SC-adenine-histidine-leucine-tryptophan medium for growth evaluation; this evaluation provided an indicator of protein-protein interaction, then 10-fold in each yeast cell culture (OD600 = 0.5) Step dilutions were prepared and 5 μL of each sample was spotted in SC-leucine-tryptophan medium or SC-adenine-histidine-leucine-tryptophan medium.

1-4. Bimolecular fluorescence complementation assay BiFC )

The full-length cDNA of CaSIBZ1 or CaSIR1 without the termination codon was subcloned into a 35S-VYNE vector for generation of a bimolecular fluorescence complementation (BiFC) construct (Waadt et al., 2008). For transient expression, the Agrobacterium tumefaciens strain GV3101 bearing the above structure was mixed with the p19 strain to avoid gene silencing, and then a 5 week old tobacco (N. benthamiana) plant (OD600) using a 1 mL needleless syringe. = 0.5). Three days after infiltration, the leaf discs were cut and the lower epidermal cells were examined under a confocal microscope (510 UV / Vis Meta; Zeiss) equipped with LSM Image Browser software.

1-5. Subcellular localization analysis

The CaSIBZ1 coding region without stop codon was inserted into the GFP-fusion binary vector p326GFP. The Agrobacterium tumefaciens strain GV3101 was mixed with the p19 strain (1: 1 ratio, OD600 = 0.5) and co-precipitated on the leaves of a 5 week old fully inflated tobacco plant. Two days after penetration, microscopic analysis was performed as described above.

1-6. In vitro Ubiquitin  analysis ( in vitro ubiquitination  assay)

Park et al. (2016) shows the expression and purification process of maltose binding protein (MBP) -CaSIBZ1 recombinant protein. For in vitro self-ubiquitination assays, purified MBP-CaSIBZ1 (500 ng) was recombinant human UBE1 (E1) (Boston Biochemicals, Cambridge, MA), human h5b enzyme tagged with E1 ( E2) (Enzo Life Sciences, Farmingdale, NY) and ubiquitination reaction buffer (50 mM Tris-HCl, pH 7.5, 2 mM ATP, 5 mM MgCl2 containing 10 μg of bovine ubiquitin (Sigma-Aldrich) , 2 mM DTT) and incubated at 30 ° C. for 3 hours.

To determine whether CaSIR1 mediates CaSIBZ1 ubiquitination, 50 ng of GST-CaSIBZ1 fusion protein was added to the ubiquitin mixture and the mixture was incubated for 3 hours. The reacted protein was separated using SDS-PAGE and analyzed using immunoblotting with anti-Ub (Santa Cruz Biotechnology, SantaCruz, CA) and anti-GST antibody (Santa Cruz Biotechnology).

1-7. RNA extraction and qRT - PCR (quantitative reverse transcription-polymerase chain reaction)

Total RNA was extracted using an RNeasy Mini kit (Qiagen, Valencia, CA). The leaves of pepper and Arabidopsis thaliana plants, each treated with ABA or subjected to dry stress, were harvested. For all RNA samples extracted from the leaves of the plant, genomic DNA is removed by RNA-free DNase (RNA-free DNase), and cDNA is synthesized using Transcript First Strand cDNA Synthesis kit (Roche, Indianapolis, IN, USA). Did. For qRT-PCR analysis, a cFX96 Touch ™ Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA) combined with the iQ ™ SYBR Green Supermix and specific primers shown in Table 1 below was used to synthesize cDNA synthesized by the above method. It was amplified using. All reactions were performed in triplicate. PCR was carried out with a program of 45 cycles of 95 ° C for 5 minutes, 95 ° C for 20 seconds, 60 ° C for 20 seconds, and 72 ° C for 20 seconds and 45 cycles. The relative expression level of each gene was calculated by the ΔΔCt method, and the Arabidopsis actin8 ( Atact8 ) gene and the pepper Actin 1 ( CaACT1 ) gene were used for normalization.

Primer name Primer sequence (5'-3 ') For cloning CaSIR1 Forward: ATGGGCCTCTCACAGTATCCAACT
Reverse: TCACATAGGACAAGTATCTTCTTCGC CaSIBZ1 Forward: ATGGGATCTTACCTGAACTTCAAG
Reverse: CTACCAAGGTCCAGTCACTGTCCT For RT-PCR CaSIR1 Forward: TGGGCCTCTCACAGTATCCAACTCC
Reverse: TCTCAGGCAGACCGAGCACTCTTTC CaSIBZ1 Forward: TGGGATCTTACCTGAACTTCAAGAAC
Reverse: ATCATTAGCATTAACACTCTCTTTCTGAA CaACT1 Forward: GACGTGACCTAACTGATAACCTGAT
Reverse: CTCTCAGCACCAATGGTAATAACTT Actin8 Forward: CAACTATGTTCTCAGGTATTGCAGA
Reverse: GTCATGGAAACGATGTCTCTTTAGT RD29B Forward: GTTGAAGAGTCTCCACAATCACTTG
Reverse: ATTAACCCAATCTCTTTTTCACACA RD26 Forward: AGGTCTTAATCCAATTCCAGAGCTA
Reverse: ACCCATCAGTAACTTCACATCTCTC RAB18 Forward: GGAAGAAGGGAATAACACAAAAGAT
Reverse: GCGTTACAAACCCTCATTATTTTTA KIN2 Forward: TCTTAACTTCGTGAAGGACAAGAC
Reverse: ACAACAACAAGTACGATGAGTACGA

1-8. ABA, dry stress , NaCl treatment and morphology analysis To investigate the expression pattern of CaSIBZ1 in response to ABA, 100 μM ABA or control solution was sprayed onto a six-leaf stage pepper plant. Pepper plants were irrigated with 200 mM NaCl solution for NaCl treatment. For drying stress treatment, the pepper plants were carefully removed from the soil to avoid damage and then placed on 3mm paper (Whatman). Leaves were harvested at 0, 2, 6, 12 and 24 hours after each treatment, and RNA isolation and RT-PCR analysis were performed.

1-9. Phenotypic analyses

To test seedling growth, 36 seeds per genotype were sown on plates containing MS agar medium with various ABA concentrations. Wild-type Arabidopsis and CaSIBZ1 and Expression (CaSIBZ1-OX) Transplanted Arabidopsis seedlings obtained from the Arabidopsis poles were randomly planted in bowls containing soil mixtures and cultivated for 2 weeks in wet conditions. To give drought stress, watering was withheld for 9-10 days, and after re-watering, the survival rate of rehydrated leafy plants was calculated 1-2 days later. In the case of red pepper, drought stress was applied to the four-leaf stage plants by holding watering for 10-11 days, and the survival rate of plants with rehydrated leaves was calculated one day after the day of watering again. . Drought resistance was determined quantitatively by measuring evaporative moisture loss. The leaves were separated from the four-leaf stage pepper and the three-week-old Arabidopsis thaliana and placed in a petri dish. The dish was maintained at 40% relative humidity in the growth chamber, and the loss of raw weight at the indicated time point was measured. All experiments were repeated at least 3 times independently on biological samples.

1-10. Heat Imaging (Thermal imaging)

For thermal imaging analysis, four-week pepper plants with both first and second leaves growing and three- or four-week Arabidopsis thaliana plants were treated with 50 μM ABA. Thermal imaging images were obtained using an infrared camera (FLIR systems; T420) and leaf temperature was measured with FLIR Tools + ver 5.2 software.

1-11. Virus-induced gene silencing ( VIGS )

For loss-of function analysis of CaSIBZ1, virus-induced gene silencing (VIGS) was performed in pepper plants. Briefly, the Agrobacterium tumefaciens strain GV3101 carrying pTRV1 and pTRV2: CaSIBZ1 or pTRV2: 00 as a negative control was infiltrated into fully expanded cotyledons of pepper (OD ₆₀₀ = 0.2 for each strain). Plants were placed in a growth chamber at 24 ° C. with a photoperiod of 16 hours day / 8 hours night to allow growth and virus growth.

1-12. Of the stomatal aperture  Biological assay

Biological quantification of stomatal aperture was performed as previously described (Lim and Lee, 2016). Briefly, leaf crusts were harvested from 3 week-old rose leaves and suspended in pore open solution (SOS; 50 mM KCl, 10 mM MES-KOH, 10 μM CaCl 2, pH 6.15). The bark was incubated for 3 hours in order to obtain a pore opening exceeding 80% in Arabidopsis plants and pepper plants. The buffer was replaced with fresh SOS containing various ABA concentrations. The leaf bark was then incubated for another 2 hours. In each individual sample, 100 pores were randomly observed under a Nikon Eclipse 80i microscope. Each experiment was performed in triplicate.

Example  2. CaSIBZ1 of  Gene isolation, sequencing and CaSIBZ1  Proteinic Intracellular  location

To separate new dry-derived pepper transcription factors, RNA-seq analysis was performed using red pepper leaves treated with ascisic acid (ABA), and candidate factors caused by dry stress were isolated to separate the CaSIBZ1 gene. Was separated. As a result of the amino acid sequence alignment (Sequence alignment), as shown in Figure 1b, it was confirmed that the CaSIBZ1 protein has a high homology with other Basic-leucine zipper domain.

In addition, according to the method described in Example 1-5, in order to confirm the location of the CaSIBZ1 protein in plant cells, a vector was constructed so that the CaSIBZ1 coding region was expressed by a fluorescent protein, Green Fluorescent protein (GFP), and expressed under a 35S promoter. . More specifically, the fusion protein of green fluorescent protein (GFP) (35S: CaSIBZ1-GFP) was transiently expressed in tobacco (N. benthamiana) epidermal cells.

As a result, as shown in FIG. 2B, the 35S: CaSIBZ1-GFP fusion protein in the epidermal cell of tobacco (N. benthamiana) produced GFP signal in the nucleus, thus expressing the 35S: CaSIBZ1-GFP protein. As a result of the analysis, it was confirmed that the CaSIBZ1-GFP fusion protein was located in the nucleus. More specifically, 4,6-diamidino-2-phenylindole (DAPI) for the Fibrillarin-RFP fusion protein and blue fluorescent signal for the red fluorescent signal were detected in the nucleus, respectively. The above results indicate that the CaSIBZ1 protein is located and functions within the nucleus, and thus, the CaSIBZ1 protein targets the nucleus and was confirmed to function at the corresponding position.

Example  3. ABA, drought, and High salt  By treatment CaSIBZ1  Confirmation of gene expression change

To determine whether the CaSIBZ1 gene is associated with ABA signaling and abiotic stress response, the expression change of the CaSIBZ1 gene was first measured on the leaves of ABA, dried, or highly salted pepper plants. As a result of performing a semi-quantitative RT-PCR analysis, as shown in FIG. 2A, when 100 μM ABA was treated, it was found that the mRNA expression level of the transcript of the CaSIBZ1 gene was most suppressed 6 hours after treatment, and dry stress or In the case of 200 mM NaCl treatment, 6 hours after treatment, the mRNA expression level of the transcript of the CaSIBZ1 gene was highest.

Example  4. CaSIBZ1  Gene Silenced  Increased drying resistance in pepper plants

To investigate the role of the CaSIBZ1 gene in response to abiotic stress, according to the method described in Examples 1-11, a virus-induced gene silencing (VIGS) -based CaSIBZ1 transformant using a tabacco rattle virus (TRV) vector Genetic function loss analysis was performed. To investigate the in vivo function of CaSIBZ1, as a result of semi-quantitative RT-PCR analysis, as shown in FIG. 3A, the CaSIBZ1 gene is a pepper plant in which the CaSIBZ1 gene is silenced than the control plant (TRV: 00) (TRV: CaSIBZ1 ) It was confirmed that the expression is reduced in (Fig. 3a).

Based on the above contents, the dry resistance of the pepper plant with the CaSIBZ1 gene silenced and the control group was compared. First, in phenotypic analysis, as shown on the left side of FIG. 3B, in normal conditions, the control group and CaSIBZ1 It was observed that there was no phenotypic difference between the genetically silenced plants. However, as a result of limiting water supply for 17 days to confirm the function of CaSIBZ1 against dry stress, the control plant showed a more withered phenotype than the plant in which the CaSIBZ1 gene was silenced (middle of FIG. 3B).

Next, after resuming watering for 3 days, each survival rate was measured. As a result, as shown in the right side of FIG. 3B, the survival rate of plants in which the CaSIBZ1 gene was silenced after resupply was about 86.67%, and the survival rate of the control plant was about 25.00%. From the above results, it was confirmed that inhibition of CaSIBZ1 gene expression enhances dry resistance (FIG. 3B).

Next, in order to find out if the dry-tolerance phenotype of the CaSIBZ1 gene silenced pepper plant is due to the increased water retention, the control and the fresh weight of the leaves detached from the CaSIBZ1 gene silenced pepper plant were measured. The transpiration water loss was confirmed. As a result, as shown in Figure 3C, it was confirmed that the CaSIBZ1 gene was relatively lower in the pepper plants in which the CaSIBZ1 gene was silenced than in the control plants (FIG. 3C).

On the other hand, when the pores open, the rate of increase increases, and the temperature of the leaves decreases. In order to confirm whether the low rate of increase of the pepper plant in which the CaSIBZ1 gene is silenced is due to a decrease in stomatal aperture, the control group and CaSIBZ1 After ABA treatment was performed on the pepper plant with the gene silenced, the leaf temperature and pore size were observed. As a result, as shown in Figure 3d, 3e, the leaf temperature of the CaSIBZ1 gene is silent pepper plant was higher than the control leaf temperature (Fig. 3d), it was also confirmed that the porosity is smaller than the control group (Fig. 3e), it was confirmed that this is related to the temperature of the leaves.

Example  5. CaSIBZ1  Overexpression ( CaSIBZ1 -OX) Plant ABA Reduced water (hyposensitivity) check

As always described in Example 4, CaSIBZ1 gene-silent pepper plants showed a strong phenotype against dry stress. In order to further confirm the in vivo function of the CaSIBZ1 gene, a transgenic Arabidopsis thaliana overexpressing the CaSIBZ1 gene was prepared under the control of the CaMV 35S promoter, which was always expressed according to the method described in Example 1-2 above, and two independent T3 isoforms were prepared. A line ( CaSIBZ1- OX) was obtained, which was subjected to RT-PCR for phenotypic analysis. The results are shown in FIG. 4.

Next, a phenotypic analysis of CaSIBZ1- OX plants in germinative and seedling steps was compared to reveal that CaSIBZ1 is involved in ABA signaling using CaSIBZ1 overexpressing ( CaSIBZ1- OX) plants. More specifically, germination of seeds in Murashige and Skoog (MS) growth medium supplemented with ABA at various concentrations (0, 0.75 and 1.0 μM) confirmed the germination rates of CaSIBZ1 -OX and control (wild type) plants. As shown, in the absence of ABA, there was no significant difference in germination rate between the control group and CaSIBZ1- OX seeds, but in the presence of ABA, the germination rate of CaSIBZ1- OX seeds was significantly higher than that of wild seeds (FIG. 5A).

Meanwhile, in order to analyze the response to ABA in the seeding stage, the hair growth rate in ABA was measured. As a result, as shown in FIG. 5, as a result consistent with the result of the germination rate, the hair growth rate was significantly higher in the CaSIBZ1- OX plant than in the control plant (FIGS. 5B to 5E).

In addition, according to the methods described in Examples 1-10 and Examples 1-12, the control plants and CaSIBZ1- OX plants were grown, and then ABA was treated to measure porosity and leaf temperature. When ABA was not treated, it was confirmed that there was no significant phenotypic difference in pore opening or leaf temperature between the control and CaSIBZ1- OX plants. However, as shown in Figure 6, as a result of exposure to 20 μM ABA, it was confirmed that the pore opening of the CaSIBZ1 -OX plant was significantly larger than the control plant (Fig. 6d). In addition, as a result of exposure to 50 μM ABA, the leaf temperature of the CaSIBZ1- OX plant was significantly lower than that of the control plant (FIG. 6C). From the above results, it was confirmed that the changed ABA sensitivity indicated by the CaSIBZ1- OX plant is dependent on the growth stage.

Example  6. CaSIBZ1  Overexpression ( CaSIBZ1 -OX) plant Reduced  Dry resistance check

The pepper plants in which the CaSIBZ1 gene of Example 4 was silenced exhibited a dry-resistant phenotype, and it was confirmed that the plants overexpressing the CaSIBZ1 gene of Example 5 showed reduced sensitivity to ABA, thereby overexpressing the CaSIBZ1 gene. It was confirmed that the response to this dry stress was changed. First, in order to confirm whether the ABA-sensitive phenotype represented by the CaSIBZ1- OX plant is due to a decrease in the water loss rate, the fresh weight of the leaves of the CaSIBZ1- OX plant and the control plant is compared to compare the increase rate between the two plants. Did. As a result, as shown in Figure 6, when treated with ABA, it was confirmed that the water loss is higher in the leaf tissue of the CaSIBZ1 -OX plant compared to the control plant (Fig. 6b).

In addition, to investigate the effect of CaSIBZ1 overexpression on dry resistance, phenotypic analysis of control and CaSIBZ1 -OX plants was performed in response to dry stress. As a result, as shown in FIG. 6, when the phenotypes of the control and CaSIBZ1- OX plants were compared under sufficient water conditions, no phenotypic differences were found between the two plants (FIG. 6A left). However, when watering was stopped for 11 days, when the plants were exposed to dry stress, the CaSIBZ1- OX plants showed a more withered phenotype than the control plants (FIG. 6A middle and right).

In addition, as a result of watering the plants again for one day, as shown in FIG. 6, 78% of the control plants survived again, while only 0 to 24% of the CaSIBZ1- OX plants survived again. The above results indicate that the decrease in water retention capacity of the CaSIBZ1- OX plant originated from ABA-reduced water, which contributes to a phenotype sensitive to dry stress (FIG. 6A).

On the other hand, in order to ensure that the drying-induced gene expression, either directly or indirectly controlled by CaSIBZ1, according to the method described in Example 1-7, CaSIBZ1 -OX after dehydration in plants and control plants drying-resistant genes RD29B , RD26, RAB18, and qRT-PCR were performed using primers specific for KIN2 . As a result, as shown in Fig. 6, after 6 hours of dehydration treatment, the expression levels of stress response genes including RD29B , RD26, RAB18 and KIN2 related to ABA synthesis were more significant in the leaves of CaSIBZ1- OX plants than those of the control plants. It was confirmed to be very low (Fig. 9e). From the above results, it was confirmed that the expression of the CaSIBZ1 gene not only affects ABA synthesis, but also regulates the response to dry stress.

The above-described description of the present invention is for illustration only, and a person having ordinary knowledge in the technical field to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. There will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> Method for improving the resistance to the drought stress using          CaSIBZ1 in plants <130> MP18-060 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 1056 <212> DNA <213> CaSIBZ1 <400> 1 atgggatctt acctgaactt caagaacttc gctgacgcat cacaaccaga gagcagtggg 60 actaataatt tttcattggc cagacaatct accatatact cctttacgtt tgatgagctg 120 caaagtacat gtggacttgg aaaagatttt ggatcgatga atatggatga cttcttaaag 180 aatattgaag gggaaaattt gcagagacag ggttctttga cactgcctag gacacttagt 240 cagaaaacta tagatgaagt atggaaagac tttcagaaag agagtgttaa tgctaatgat 300 gtaagtgaga ctggaggatc aaactttggg cagagggaat ctaccttggg agaaatgaca 360 ttagaagagt ttttggttag agcaggggcg gtgagagaag atatgcaacc aactggatac 420 tcaaatgatg ttacattaac tactactagt ggtttcattc aacctagtag taatgtgacc 480 ataaaatttc ttcaagcaac ccaaaaccct ggacatcaaa ttgcagggac taacatattc 540 aatgtggtca gtactacatc tttaccgcag cagccccttt tccccaaaca aacaactgtg 600 gaatttgcat cacccatgca attagggaca agggctccca tgccaaatcc gtctgcaaat 660 actaatagta tcatgcaggg tggtgttatg agcatgccag taaaaggagt atcccctgga 720 aatctagata catcttctct ttcactttca ccgtatgcat gtggtgaagg tggaagagga 780 aggagatcat gtacctctat tgaaaaagtt gttgagagaa ggcgtaagag gatgataaag 840 aacagagagt ctgctgccag atcaagggat cggaagcagg catatacttt ggagttggaa 900 gctgaagtgg caaagctgaa agaaattaag caacagttgc agaagaatca ggctgaattt 960 attgagaagc agaaaaatca gttgttagaa aagatgaata tgccatggga aaataaacta 1020 atatgcttga gaaggacagt gactggacct tggtag 1056 <210> 2 <211> 351 <212> PRT <213> CaSIBZ1 <400> 2 Met Gly Ser Tyr Leu Asn Phe Lys Asn Phe Ala Asp Ala Ser Gln Pro   1 5 10 15 Glu Ser Ser Gly Thr Asn Asn Phe Ser Leu Ala Arg Gln Ser Thr Ile              20 25 30 Tyr Ser Phe Thr Phe Asp Glu Leu Gln Ser Thr Cys Gly Leu Gly Lys          35 40 45 Asp Phe Gly Ser Met Asn Met Asp Asp Phe Leu Lys Asn Ile Glu Gly      50 55 60 Glu Asn Leu Gln Arg Gln Gly Ser Leu Thr Leu Pro Arg Thr Leu Ser  65 70 75 80 Gln Lys Thr Ile Asp Glu Val Trp Lys Asp Phe Gln Lys Glu Ser Val                  85 90 95 Asn Ala Asn Asp Val Ser Glu Thr Gly Gly Ser Asn Phe Gly Gln Arg             100 105 110 Glu Ser Thr Leu Gly Glu Met Thr Leu Glu Glu Phe Leu Val Arg Ala         115 120 125 Gly Ala Val Arg Glu Asp Met Gln Pro Thr Gly Tyr Ser Asn Asp Val     130 135 140 Thr Leu Thr Thr Thr Ser Gly Phe Ile Gln Pro Ser Ser Asn Val Thr 145 150 155 160 Ile Lys Phe Leu Gln Ala Thr Gln Asn Pro Gly His Gln Ile Ala Gly                 165 170 175 Thr Asn Ile Phe Asn Val Val Ser Thr Thr Ser Leu Pro Gln Gln Pro             180 185 190 Leu Phe Pro Lys Gln Thr Thr Val Glu Phe Ala Ser Pro Met Gln Leu         195 200 205 Gly Thr Arg Ala Pro Met Pro Asn Pro Ser Ala Asn Thr Asn Ser Ile     210 215 220 Met Gln Gly Gly Val Met Ser Met Pro Val Lys Gly Val Ser Pro Gly 225 230 235 240 Asn Leu Asp Thr Ser Ser Leu Ser Leu Ser Pro Tyr Ala Cys Gly Glu                 245 250 255 Gly Gly Arg Gly Arg Arg Ser Cys Thr Ser Ile Glu Lys Val Val Glu             260 265 270 Arg Arg Arg Lys Arg Met Ile Lys Asn Arg Glu Ser Ala Ala Arg Ser         275 280 285 Arg Asp Arg Lys Gln Ala Tyr Thr Leu Glu Leu Glu Ala Glu Val Ala     290 295 300 Lys Leu Lys Glu Ile Lys Gln Gln Leu Gln Lys Asn Gln Ala Glu Phe 305 310 315 320 Ile Glu Lys Gln Lys Asn Gln Leu Leu Glu Lys Met Asn Met Pro Trp                 325 330 335 Glu Asn Lys Leu Ile Cys Leu Arg Arg Thr Val Thr Gly Pro Trp             340 345 350

Claims (5)

delete delete delete A composition for enhancing the dry resistance of a plant, comprising an inhibitor of the expression of CaSIBZ1 (Capsicum annuum SIR1-Interacting bZIP transcription factor 1) protein consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient,
The inhibitor is a recombinant VIGS (Virus Induced Gene Silencing) vector containing an ORF (open reading frame) of the gene encoding the CaSIBZ1 protein, composition. A method for enhancing dry stress resistance of a plant, comprising the step of inhibiting the expression or activity of the CaSIBZ1 protein, wherein the CaSIBZ1 protein is composed of the amino acid sequence of SEQ ID NO: 2, a method for enhancing dry stress resistance of a plant.

Images