KR20190118470A - Method for improving the resistance to the drought stress using CaSIBZ1 in plants - Google Patents

Abstract

The present invention relates to a chili pepper-derived Capsicum annuum SIR1-Interacting bZIP transcription factor 1 (CaSIBZ1) gene/protein and a plant drought stress resistance enhancing method using the same. According to the present invention, the CaSIBZ1 gene encoding a negative regulator protein against drought stress is identified and it is confirmed that the CaSIBZ1 protein functions as a negative regulator for ABA signal transfer and a drought stress resistance-enhancing effect is exhibited in a transgenic in which the protein is over-expressed, thereby being utilized for improvement of crops and the like available to human beings through expression regulation of CaSIBZ1 gene and especially being expected to be useful for improving productivity of plants.

Description

Method for improving the resistance to the drought stress using CaSIBZ1 in plants}

The present invention is a novel CaSIBZ1 derived from capsicum annuum SIR1-Interacting bZIP transcription factor 1) Genes, proteins, and methods for enhancing the dry stress resistance of plants using the same.

Global warming causes extreme climate change, causing environmental stress that hinders the normal growth and development of plants, against which plants have evolved sophisticated defense mechanisms to survive in adverse environments such as cold, high salt and drought. Drought, for example, is caused by a poor water environment and severely affects the normal growth of plants, resulting in reduced yields of grains, which can be used to control pore closure, abscisic acid, Activate various defense mechanisms such as synthesis and accumulation of ABA).

ABA is a regulator for protecting plants against abiotic stress, especially dry stress, and is known to play a very important role in plant growth and development. ABA signaling is known to regulate the expression of various stress-related genes such as transcription factors and E3 ligase involved in osmotic adaptation and regulation of root hydraulic conductivity, but the complete ABA signaling pathway is still unknown. It wasn't. Initiation of ABA signaling in plant cells requires the presence of ABA receptors and signaling to downstream proteins. To date, it is known that PYR / PYL / RCARs play a role in recognizing ABA as an ABA receptor. When the receptor recognizes ABA, the subproteins are phosphorylated and dephosphorylated by SnRK2 (non-fermenting 1-related subfamily 2) protein kinase and PP2Cs (type 2C protein phosphatases), respectively. SnRK2 kinases such as SnRK2.2, SnRK2.3, and SnRK2.6 (OST1) function as positive regulators of ABA signaling, whereas group A PP2Cs phosphatase functions as a negative regulator of ABA. It is reported that PYR / PYL / RCAR proteins, ABA receptors, interact with group A PP2Cs and inhibit their activity. Recognition of increased ABA expression by PYR / PYL / RCAR inhibits protein phosphatase-kinase interactions and induces SnRK2 type kinase secretion. SnRK2 kinase promotes expression of specific genes and ion channel activation through phosphorylation of target proteins, including transcription factors and SLAC1 anion channels, which allow plants to adapt to adverse environments.

On the other hand, proteolysis through the ubiquitination pathway is one of the important mechanisms for the plant to regulate the adaptation and defense response to abiotic stress. Ubiquitinylation is an important post-translational regulatory process caused by the sequential action of three enzymes consisting of ubiquitin activating enzyme (E1), ubiquitin-conjugating enzyme (E2) and ubiquitin ligase (E3). When ubiquitin is activated by E1, the activated ubiquitin is delivered to E2 and E3 ligase binds ubiquitin with the target protein. In this process, E3 ligase determines and binds to the target protein.

Ubiquitination is a unique mechanism in cells and it is known that hundreds or thousands of E3 ligase are present in eukaryotic cells depending on various target proteins. E3 ligase is classified into two types according to the subunit composition, RING (really interesting new gene), HECT (homology to E6-AP C-terminus), and PUB (plant U-box) E3 ligase. SCF (S-phase kinase-associated protein / cullin / F-box) and CUL4-DDB1 (CULLIN4-damaged-specific DNA binding protein1) are composed of multiple subunits. Recently, more than 1,400 species of E3 ligase have been reported in Arabidopsis plants, the Arabidopsis genome encodes 242 RING E3 ligase, and the RING E3 ligase is responsible for adaptation to biological and abiotic stresses. It is reported to be involved. RING E3 ligase is available for rice ( Oryza sativa ), maize ( Zea mays ), capsicum ( Capsicum annum ) and Arabidopsis ( Arabidopsis). Various monocotyledonous and dicotyledonous plants, such as thaliana ), are known to act as positive or negative regulators in response to ABA signaling and abiotic stress, which means they are widely conserved in plants (Plant Biotechnol J 11, 432). -445). Recently, it has been reported that RSL1, a RING type E3 ligase, is involved in the degradation through ubiquitination of ABA receptors such as PYR1 and PYL4 in cell membranes, and the CRL4-type E3 ligase complex degrades the PYL8 ABA receptor.

On the other hand, one of the most transcription factors present in plants is the bZIP protein. The bZIP gene is present in all eukaryotes, has a basic region for DNA binding and a leucine zipper motif responsible for dimerization, and homo or hetero- dimerization of bZIP proteins prior to binding to the promoter. dimerization). Such bZIP transcription factors include OsABF3, CAbZIP1 and the like.

Thus, studies on how to improve the resistance to various environmental stresses such as drought, salt, cold, heat, pathogens using the bZIP transcription factor is being studied. The development of crops resistant to environmental stress is expected to contribute greatly to the increase in agricultural production, and the need for more active research is on the rise.

Republic of Korea Patent Registration 10-1775788 Republic of Korea Patent Registration 10-1608175

The present invention has been made to solve the above problems, the present inventors CaSIBZ1 (Capsicum annuum) which is a dry sensitive bZIP transcription factor gene in red pepper SIR1-Interacting bZIP transcription factor 1) gene was identified, and when the gene was silenced, it was confirmed that it enhances the dry stress resistance of plants, and based on this, the present invention was completed.

An object of the present invention is CaSIBZ1 (Capsicum annuum) consisting of the nucleotide sequence of SEQ ID NO: 1 encoding a negative regulator protein for dry stress SIR1-Interacting bZIP transcription factor 1) gene is provided.

Another object of the present invention is to provide a CaSIBZ1 protein consisting of the amino acid sequence of SEQ ID NO: 2 encoded by the CaSIBZ1 gene.

Still another object of the present invention is to provide a recombinant expression vector containing the CaSIBZ1 gene.

Still another object of the present invention is to provide a composition for enhancing dry resistance of plants, including an inhibitor of CaSIBZ1 (Capsicum annuum SIR1-Interacting bZIP transcription factor 1) protein expression or activity.

Another object of the present invention is a method of enhancing the dry stress resistance of a plant, comprising the step of inhibiting the expression or activity of CaSIBZ1 protein, wherein the CaSIBZ1 protein is characterized by consisting of the amino acid sequence of SEQ ID NO: 2, dry stress of the plant It is to provide a method of increasing resistance.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the object of the present invention as described above, the present invention is CaSIBZ1 (Capsicum annuum SIR1 -Interacting bZIP transcription factor 1) consisting of the nucleotide sequence of SEQ ID NO: 1 encoding the negative regulator protein (negative regulator) for dry stress Provide the gene.

The present invention provides a CaSIBZ1 protein consisting of the amino acid sequence of SEQ ID NO: 2 encoded by the CaSIBZ1 gene.

The present invention provides a recombinant expression vector containing the CaSIBZ1 gene.

The present invention provides a composition for enhancing the dry resistance of plants comprising an inhibitor of CaSIBZ1 (Capsicum annuum SIR1-Interacting bZIP transcription factor 1) protein expression or activity.

The present invention provides a method for enhancing dry stress resistance of a plant comprising inhibiting the expression or activity of CaSIBZ1 protein, wherein the CaSIBZ1 protein comprises the amino acid sequence of SEQ ID NO: 2, wherein the method for enhancing dry stress resistance of a plant is provided. to provide.

The present invention provides a recombinant VIGS (Virus Induced Gene Silencing) vector comprising an open reading frame (ORF) of a gene encoding CaSIBZ1 (Capsicum annuum SIR1-Interacting bZIP transcription factor 1) protein.

The present invention transforms a plant with the vector CaSIBZ1 (Capsicum annuum SIR1-Interacting bZIP transcription factor 1) Provides a method for enhancing the drying resistance of a plant comprising the step of silencing the gene.

The present invention relates to a novel gene, CaSIBZ1 , which encodes a negative regulator protein for dry stress, wherein the CaSIBZ1 plays a negative role in the transmission of abscic acid (ABA) signaling, which plays an important role in relation to the environmental stress of plants. As a result, it was confirmed that the effect of controlling the resistance to drying in the plant using this, it is utilized in the improvement of crops and the like that can be used by humans by controlling the expression of the CaSIBZ1 gene, thereby It is expected to improve productivity.

1A schematically illustrates a CaSIBZ1 protein.
1B is a result of comparing amino acid sequences between CaSIBZ1 protein and other plant species proteins.
FIG. 2A shows the results of analyzing the change in CaSIBZ1 expression level through qRT-PCR under ABA, high salt and dry stress conditions.
Figure 2b is a result of observing the fluorescent signal of the CaSIBZ1-GFP fusion protein under confocal microscopy to confirm the position of the CaSIBZ1 protein in the plant cell.
Figure 3a shows the difference in the amount of transcription accumulation CaSiBZ1 between CaSIBZ1- silenced pepper plants and the control.
Figure 3b is a comparison of the dry phenotype and survival rate of CaSIBZ1 -silenced pepper plants and the control group.
Figure 3c shows the water loss rate of CaSIBZ1- silenced pepper plants and control leaves.
3D shows the leaf temperatures of CaSIBZ1 -silenced pepper plants and controls.
Figure 3e shows the pore opening of CaSIBZl -silenced pepper plants and control leaves.
4 shows the results of confirming CaSIBZ1 expression by performing RT-PCR analysis of CaSIBZ1 overexpressing plants ( CaSIBZ1- OX) and control (wild type, WT) plants.
5A compares germination rates of CaSIBZl overexpressing plants ( CaSIBZl- OX) and control (wild type, WT) plants under ABA treatment conditions.
5B shows the recruitment rates of CaSIBZl overexpressing plants ( CaSIBZl- OX) and control (wild type, WT) plants under ABA treatment conditions.
FIG. 5C graphically shows the results of FIG. 5B.
5D compares root growth of CaSIBZl overexpressing plants ( CaSIBZl- OX) and control (wild type, WT) plants under ABA treatment conditions.
FIG. 5E graphically shows the results of FIG. 5D.
FIG. 6A shows the dry phenotype and survival of CaSIBZ1 overexpressing plants ( CaSIBZ1- OX) and control (wild type, WT) under dry stress or ABA treatment conditions.
FIG. 6B shows the water loss rate of CaSIBZl overexpressing plants ( CaSIBZl- OX) and control (wild type, WT) leaves under dry stress or ABA treatment conditions.
FIG. 6C shows the temperatures of CaSIBZl overexpressing plants ( CaSIBZ1- OX) and control (wild type, WT) leaves under dry stress or ABA treatment conditions.
6D shows the pore opening of leaves in CaSIBZl overexpressing plants ( CaSIBZl- OX) and control (wild type, WT), under dry stress or ABA treatment conditions.
6E is a result of comparing qD-PCR expression levels of RD29B, RD26, RAB18, and KIN2 in order to confirm the correlation between CaSIBZ1- OX plants and marker genes in response to drying.

The inventors have identified the CaSIBZ1 gene, a bZIP gene that functions as a negative regulator of ABA signaling, and the present invention was completed by identifying a decrease in ABA sensitivity and reduced resistance to dry stress in transgenic Arabidopsis plants overexpressed. .

Accordingly, the present invention provides a CaSIBZ1 (Capsicum annuum SIR1 -Interacting bZIP transcription factor 1) gene consisting of the nucleotide sequence of SEQ ID NO: 1, which encodes a negative regulator protein for dry stress, and the sequence number 2 encoded by the present invention. It provides a peptide of amino acid sequence.

CaSIBZ1 , a gene of the present invention, preferably consists of the nucleotide sequence of SEQ ID NO: 1, and the CaSIBZ1 The peptide encoded by the gene may preferably consist of the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.

As used herein, the term "negaitive regulator protein" refers to a protein that acts in an inhibitory direction in the regulation of life phenomena. That is, when CaSIBZ1, which is a gene of the present invention, is overexpressed, ABA sensitivity may be reduced, and resistance to dry stress may be reduced.

While studying the genes involved in the dry stress response, the inventors identified CaSIBZ1, a bZIP transcription factor protein (see Example 2), and promoted pore closure as the sensitivity of abscic acid (ABA) increased, resulting in dry resistance. Based on the fact that it can increase the amount of absic acid or dry stress and CaSIBZ1 The relationship between genes was attempted.

First, in one embodiment of the present invention, it was confirmed by GFP fluorescence that CaSIBZ1 protein is expressed in the nucleus (see Example 2).

In another embodiment of the present invention, the expression pattern of abiotic stress (ABA, dry or salt) treated CaSIBZ1 gene was confirmed, and as a result, the CaSIBZ1 gene was involved in the response to ABA-signal and dry stress. (See Example 3).

In another embodiment of the present invention, ABA susceptibility by CaSIBZ1 gene silencing by measuring the leaf temperature, pore opening, moisture loss rate, etc. in the leaves of pepper and normal control pepper plants inhibited CaSIBZ1 expression under ABA treatment conditions Increasing effect was confirmed, and in fact, it was confirmed that dry stress resistance was increased in the plants inhibited by CaSIBZ1 expression compared to the control group (see Example 4).

In another embodiment of the present invention, a transgenic Arabidopsis plant overexpressing CaSIBZ1 was prepared to measure leaf temperature, transpiration rate, morphology and survival rate, and expression changes of related genes in wild-type and CaSIBZ1 overexpressing plants under ABA treatment. It was confirmed that CaSIBZ1 acts as a negative regulator to enhance the dry stress resistance of the plant (see Example 5), and actually reduced the dry resistance upon overexpression of CaSIBZ1 gene in Arabidopsis plants (see Example 6).

In another aspect of the present invention, a recombinant expression vector containing a CaSIBZ1 gene is provided. The present invention also provides a recombinant virus induced gene silencing (VIGS) vector comprising an open reading frame (ORF) of a gene encoding a CaSIBZ1 protein.

Virus-induced gene silencing (VIGS), a gene-induced gene silencing phenomenon, is also called virus-induced RNA silencing. It is a kind of post-transcriptional gene silencing that is well known in various plants, fungi, insects, nematodes, fish, and rats. It is resistant to the expression of resistance genes homologous to the viral genome in infected plants during virus invasion and replication. Expression and replication of genes and viral genomes are suppressed together. That is, when a part or all of a specific gene derived from the host is inserted into the cDNA of the viral genome, and the infective RNA is made to infect the plant, the RNA of the corresponding host is targeted, and the expression of the target gene is suppressed in the infected host plant. Lost. As a result, the function of the target gene can be estimated indirectly. Virus-induced gene silencing (VIGS) mechanism is known to be a type of RNA-mediated plant defense mechanism against viruses, characterized by 1) gene silencing after transcription 2) RNA conversion 3) nucleotide sequence specificity.

In the present invention, by inserting the transforming vector TRV (Tobacco Rattle Virus) for VIGS into which the ORF region of CaSIBZ1 is inserted into Agrobacterium, the expression of CaSIBZ1 gene is successfully inhibited by infiltrating the Agrobacterium into a plant. I've done it.

As used herein, the term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. Recombinant cells can express genes or gene fragments that are not found in their natural form in either the sense or antisense form. In addition, recombinant cells can express genes found in cells in their natural state, but the genes are modified and reintroduced into cells by artificial means.

The term “vector” is used herein to refer to DNA fragment (s), nucleic acid molecules that are delivered into a cell. Vectors can replicate DNA and be reproduced independently in host cells. Preferred examples of recombinant vectors in the present invention may be, but are not limited to, plasmid vectors, pTRV1 or pTRV2, which are capable of transferring part of themselves to plant cells when present in a suitable host such as Agrobacterium tumefaciens. Other suitable vectors that can be used to introduce the DNA according to the invention into a plant host are viruses such as those that can be derived from double stranded plant viruses (eg CaMV) and single stranded viruses, gemini viruses and the like. Vector, for example an incomplete plant virus vector. The vector can be advantageously used when it is difficult to properly transform the plant host. In addition, in the recombinant vector of the present invention, the promoter may be, but is not limited to, CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter. The term "promoter" refers to a DNA upstream region from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription.

As another aspect of the present invention, the present invention provides a composition for enhancing the dry resistance of plants comprising an inhibitor of CaSIBZ1 protein expression or activity as an active ingredient.

The inhibitor may be siRNA (small interference RNA), shRNA (short hairpin RNA), miRNA (microRNA), which complementarily binds to the sequence of the CaSIBZ1 gene, the complementary sequence to the sequence, or the mRNA for the fragment of the gene sequence. ), Ribozyme, DNAzyme, peptide nucleic acids (PNA), antisense nucleotides, and compounds that bind to and inhibit the activity of the CaSIBZ1 protein, peptides, peptide mimetics (Peptide Minetics), an antibody, or an aptamer (preferably any one), but is not limited thereto.

As another aspect of the present invention, the present invention provides a method for enhancing dry stress resistance of a plant comprising the step of inhibiting the expression or activity of CaSIBZ1 protein.

In the present invention, the plant (sieve) is a food crop including rice, wheat, barley, corn, soybeans, potatoes, red beans, oats, millet; Vegetable crops including Arabidopsis, Chinese cabbage, radish, peppers, strawberries, tomatoes, watermelons, cucumbers, cabbages, melons, pumpkins, green onions, onions, carrots; Special crops including ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut, rapeseed; Fruit trees including apple trees, pears, jujube trees, peaches, leeks, grapes, citrus fruits, persimmons, plums, apricots, bananas; Flowers, including roses, gladiolus, gerberas, carnations, chrysanthemums, lilies and tulips; And feed logistics including lygragrass, red clover, orchardgrass, alfalfa, tolsque cue, perennial lygragrass, and the like, and most preferably, Arabidopsis or capsicum, but not limited thereto.

Hereinafter, preferred examples are provided to aid in understanding the present invention. However, the following examples are merely provided to more easily understand the present invention, and the contents of the present invention are not limited by the following examples.

[ EXAMPLE ]

EXAMPLE  1. Preparation and Experiment Method

1-1. Plant material and growing conditions

Pepper (Capsicum annuum L., cv. Nockwang), and Tobacco ( Nicotiana benthamiana ) seeds were steam sterilized (Peat moss: perlite: vermiculite = 5: 3: 2, v / v) / v), sand, and loam soil were mixed at 1: 1: 1 (v / v / v) and sown. Since the pepper plants were grown under a white fluorescent lamp (80 μm photons m ⁻² · S ⁻¹ ) with 16 hours light / 8 hours dark cycle in a growth room at 27 ± 1 ° C. Tobacco plants were maintained in growth chambers at 25 ± 1 ° C. with a 16 hour light / 8 hour dark cycle. Arabidopsis thaliana (Eco-type Col-0) plant seeds were germinated in Murashige and Skoog (MS) salt containing 1% sucrose and Microagar (Duchefa biochemistry). All seeds were allowed to bloom for 2 days at 4 ° C. before being placed in the growth chamber, and the plates were incubated at 24 ° C. in a 16 hour light / 8 hour dark cycle in the growth chamber. Baby pole seedlings are white with steam for 8 hours at 8 ° C for 16 hours at 24 ° C on steam sterilized compound soil (peat moss: perlite: vermiculite = 9: 1: 1, v / v / v). Fluorescent lamps (130 μm photons m ⁻² · S ⁻¹ ) were maintained at 60% relative humidity under light.

1-2. CaSIBZ1  Gene overexpressed transformation Baby pole  Produce

The full-length CaSIBZ1 cDNA is bound to the pENTR / D-TOPO vector (Invitrogen, Carlsbad, CA, USA), and the pK2GW7 binary vector is transformed into a baby pole cauliflower mosaic using the LR response for constitutive expression of the CaSIBZ1 gene. virus (CaMV) was inserted under 35S promoter control. 35S: CaSIBZ1 structure was transformed with Agrobacterium tumefaciens strain GV3101. Agrobacterium tumefaciens-mediated transformation was carried out via the floral dip method (Clough and Bent, 1998). To select transformed lines, seeds harvested from the transformed plants were sown in MS agar plates containing 50 μg · mL ⁻¹ of kanamycin.

1-3. Yeast two-hybrid assay Y2H )

Full-length cDNA of CaSIBZ1 or CaSIR1 was subcloned into the pGBKT7 vector. The structure obtained by the above method was introduced into the yeast AH109 strain according to the lithium acetate-mediated transformation method (Ito et al., 1983.) After selection was carried out on the synthesized (SC) -leucine-tryptophan medium. The transformants were transferred to SC-adenine-histidine-leucine-tryptophan medium for growth evaluation; this assessment provided an indication of protein-protein interactions, followed by 10-fold in each yeast cell culture (OD600 = 0.5). Step dilutions were prepared and 5 μL of each sample was spotted in SC-Leucine-Tryptophan medium or SC-Adenine-Histidine-Leucine-Tryptophan medium.

1-4. Bimolecular fluorescence complementation assay, BiFC )

Full-length cDNA of CaSIBZ1 or CaSIR1 without a stop codon was subcloned into a 35S-VYNE vector for generation of a bimolecular fluorescence complementation (BiFC) construct (Waadt et al., 2008). For transient expression, the Agrobacterium tumefaciens strain GV3101 containing this structure was mixed with the p19 strain to avoid gene silencing, followed by a 5 mL N. benthamiana plant (OD600) using a 1 mL needleless syringe. Permeate into the axial plane of the leaf of = 0.5). After 3 days of infiltration, the leaf discs were cut and the lower epidermal cells examined under confocal microscopy (510 UV / Vis Meta; Zeiss) equipped with LSM Image Browser software.

1-5. Subcellular localization analysis

A CaSIBZ1 coding region without a stop codon was inserted into the GFP-fused binary vector p326GFP. Agrobacterium tumefaciens strain GV3101 was mixed with p19 strain (1: 1 ratio, OD600 = 0.5) and co-precipitated to 5 weeks fully expanded tobacco plant leaves. After 2 days of infiltration, microscopic analysis was performed as described above.

1-6. In vitro Ubiquitin  analysis ( in vitro ubiquitination  assay)

Park et al. (2016) show the process for the expression and purification of maltose binding protein (MBP) -CaSIBZ1 recombinant protein. For in vitro self-ubiquitination assays, purified MBP-CaSIBZ1 (500 ng) was added to recombinant human UBE1 (E1) (Boston Biochemicals, Cambridge, MA), a human h5b enzyme tagged with E1 ( E2) (Enzo Life Sciences, Farmingdale, NY) and ubiquitination reaction buffer (50 mM Tris-HCl, pH 7.5, 2 mM ATP, 5 mM MgCl2) and 10 μg bovine ubiquitin (Sigma-Aldrich) , 2 mM DTT) and incubated at 30 ° C. for 3 hours.

To determine whether CaSIR1 mediates CaSIBZ1 ubiquitination, 50 ng of GST-CaSIBZ1 fusion protein was added to the ubiquitin mixture and the mixture was incubated for 3 hours. Reacted proteins were isolated using SDS-PAGE and analyzed using immunoblotting with anti-Ub (Santa Cruz Biotechnology, SantaCruz, CA) and anti-GST antibodies (Santa Cruz Biotechnology).

1-7. RNA extraction and qRT - PCR (quantitative reverse transcription-polymerase chain reaction)

Total RNA was extracted using the RNeasy Mini kit (Qiagen, Valencia, CA). The leaves of the pepper and cedar pole plants, respectively, treated with ABA or subjected to dry stress, were harvested. All RNA samples extracted from the leaves of the plant were digested with RNA-free DNase (RNA-free DNase) to remove genomic DNA and synthesized cDNA using Transcript First Strand cDNA Synthesis kit (Roche, Indianapolis, IN, USA). It was. For qRT-PCR analysis, cDNA synthesized by the above method was combined with a CQ96 Touch ™ Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA) with iQ ™ SYBR Green Supermix and specific primers as shown in Table 1 below. Amplified using. All reactions were repeated three times. PCR was performed with a program of 45 cycles for 5 minutes at 95 ° C., 20 seconds at 95 ° C., 20 seconds at 60 ° C., 20 seconds at 72 ° C. Relative expression of each gene was calculated by the ΔΔCt method, Arabidopsis actin8 ( Atact8 ) gene and pepper actin 1 ( CaACT1 ) gene was used for normalization.

Prime name Primer sequence (5’-3 ’) For cloning CaSIR1 Forward: ATGGGCCTCTCACAGTATCCAACT
Reverse: TCACATAGGACAAGTATCTTCTTCGC CaSIBZ1 Forward: ATGGGATCTTACCTGAACTTCAAG
Reverse: CTACCAAGGTCCAGTCACTGTCCT For RT-PCR CaSIR1 Forward: TGGGCCTCTCACAGTATCCAACTCC
Reverse: TCTCAGGCAGACCGAGCACTCTTTC CaSIBZ1 Forward: TGGGATCTTACCTGAACTTCAAGAAC
Reverse: ATCATTAGCATTAACACTCTCTTTCTGAA CaACT1 Forward: GACGTGACCTAACTGATAACCTGAT
Reverse: CTCTCAGCACCAATGGTAATAACTT Actin8 Forward: CAACTATGTTCTCAGGTATTGCAGA
Reverse: GTCATGGAAACGATGTCTCTTTAGT RD29B Forward: GTTGAAGAGTCTCCACAATCACTTG
Reverse: ATTAACCCAATCTCTTTTTCACACA RD26 Forward: AGGTCTTAATCCAATTCCAGAGCTA
Reverse: ACCCATCAGTAACTTCACATCTCTC RAB18 Forward: GGAAGAAGGGAATAACACAAAAGAT
Reverse: GCGTTACAAACCCTCATTATTTTTA KIN2 Forward: TCTTAACTTCGTGAAGGACAAGAC
Reverse: ACAACAACAAGTACGATGAGTACGA

1-8. ABA, Dry Stress , NaCl Treatment and Morphological Analysis In order to investigate the expression pattern of CaSIBZ1 in response to ABA, six-leaf stage pepper plants were sprayed with 100 μM ABA or control. Pepper plants were irrigated with 200 mM NaCl solution for NaCl treatment. For dry stress treatment, pepper plants were carefully removed from the soil to avoid damage and then placed on 3 mm paper (Whatman). Leaves were harvested at 0 h, 2 h, 6 h, 12 h and 24 h after each treatment and RNA isolation and RT-PCR analysis were performed.

1-9. Phenotypic analyses

To test seedling growth, 36 seeds per genotype were sown on plates containing MS agar medium with varying ABA concentrations. One week old seedlings from wild type baby poles and CaSIBZ1 and expression (CaSIBZ1-OX) transgenic baby poles were randomly planted in bowls containing soil mixture and grown for 2 weeks in wet conditions. To give drought stress, the watering was withheld for 9-10 days, and after re-watering, after 1-2 days, the survival rate of plants with rehydrated leaves was calculated. In the case of red pepper, drought stress was applied to four-leaf stage plants with water holding for 10-11 days, and survival rates of plants with rehydrated leaves were calculated 1 day after the watering again. . Drought resistance was determined quantitatively by measuring evaporative moisture loss. The leaves were separated from the four-leaf stage pepper and three week old baby pole plants and placed in a Petri dish. The dish was kept at 40% relative humidity in the growth chamber and the loss of raw weight was measured at the indicated time points. All experiments were repeated at least three times independently in biological samples.

1-10. Heat Imaging (Thermal imaging)

For thermal imaging analysis, the 4 week pepper plants, where both the first and second leaves grew, and the 3 or 4 week baby pole plants were treated with 50 μM ABA. Thermal images were obtained using infrared cameras (FLIR systems; T420) and leaf temperatures were measured with FLIR Tools + ver 5.2 software.

1-11. Virus-induced gene silencing ( VIGS )

For loss-of function analysis of CaSIBZ1, virus-induced gene silencing (VIGS) was performed in pepper plants. Briefly, Agrobacterium tumefaciens strain GV3101 carrying pTRV1 and pTRV2: CaSIBZ1 or pTRV2: 00 as negative controls was infiltrated into fully expanded cotyledons of pepper (OD ₆₀₀ = 0.2 for each strain). Plants were placed in a growth room at 24 ° C. with a photoperiod of 16 hours day and 8 hours night for growth and virus propagation.

1-12. Of the stomatal aperture  Biological assay

Biological quantification of stomatal aperture was performed as previously described (Lim and Lee, 2016). Briefly, leaf husks were taken from three main rose leaves and suspended in pore open solution (SOS; 50 mM KCl, 10 mM MES-KOH, 10 μM CaCl 2, pH 6.15). The shells were incubated for 3 hours to obtain pore openings greater than 80% in the baby pole plants and the pepper plants. The buffer was replaced with fresh SOS containing various ABA concentrations. The leaf husks were then incubated for 2 more hours. In each individual sample, 100 pores were randomly observed under a Nikon Eclipse 80i microscope. Each experiment was performed three times.

EXAMPLE  2. CaSIBZ1 of  Gene isolation, sequencing and CaSIBZ1  Protein Intracellular  location

To isolate new dry-induced pepper transcription factors, RNA-seq analysis was carried out using pepper leaves treated with ascisic acid (ABA), and candidate factors caused by dry stress were isolated and the CaSIBZ1 gene was isolated. Was separated. As a result of amino acid sequence alignment, as shown in FIG. 1B, the CaSIBZ1 protein was confirmed to have high homology with other Basic-leucine zipper domains.

In addition, according to the method described in Example 1-5, in order to confirm the position of the CaSIBZ1 protein in the plant cell, a vector was constructed to express the CaSIBZ1 coding region under the 35S promoter by binding to a fluorescent protein, Green Fluorescent protein (GFP). . More specifically, the fusion protein of green fluorescent protein (GFP) (35S: CaSIBZ1-GFP) was transiently expressed in tobacco (N. benthamiana) epidermal cells.

As a result, as shown in FIG. 2B, 35S: CaSIBZ1-GFP fusion protein in epidermal cells of tobacco (N. benthamiana) produced GFP signals in the nucleus, and thus expression of 35S: CaSIBZ1-GFP protein As a result, CaSIBZ1-GFP fusion protein was found to be located in the nucleus. More specifically, 4,6-diamidino-2-phenylindole (DAPI) for Fibrillarin-RFP fusion protein and blue fluorescence signal for red fluorescence signal were detected in the nucleus, respectively. The results indicate that the CaSIBZ1 protein is located and functions in the nucleus, so that the CaSIBZ1 protein targets the nucleus and functions at the corresponding position.

EXAMPLE  3. ABA, drought, and High salt  By treatment CaSIBZ1  Confirmation of gene expression change

To determine whether CaSIBZ1 gene is associated with ABA signaling and abiotic stress response, the expression of CaSIBZ1 gene was first measured in the leaves of ABA, dried or highly salted pepper plants. As a result of semi-quantitative RT-PCR analysis, as shown in FIG. 2A, mRNA expression, which is a transcript of CaSIBZ1 gene, was most suppressed at 100 hours after treatment with 100 μM ABA. In the case of 200 mM NaCl treatment, mRNA expression, the transcript of CaSIBZ1 gene, was the highest at 6 hours after treatment.

EXAMPLE  4. CaSIBZ1  Gene Silent  Increased drying resistance in pepper plants

To determine the role of CaSIBZ1 gene in response to abiotic stress, a virus-induced gene silencing (VIGS) based CaSIBZ1 transformant using a tabacco rattle virus (TRV) vector according to the method described in Examples 1-11 above. Gene loss loss analysis was performed. In order to investigate the in vivo function of CaSIBZ1, semi-quantitative RT-PCR analysis. As a result, as shown in Fig. 3a, CaSIBZ1 gene control plants (TRV: 00) than CaSIBZ1 genes are silenced the pepper plant (TRV: CaSIBZ1) It was confirmed that the expression is reduced in (Fig. 3a).

Based on the above contents, the dry resistance of the pepper plant in which the CaSIBZ1 gene was silenced was compared with that of the control group. First, in phenotypic analysis, as shown on the left side of FIG. 3B, the control group and CaSIBZ1 under normal conditions It was observed that there was no phenotypic difference between gene silenced plants. However, as a result of confirming CaSIBZ1's function on dry stress by limiting watering for 17 days, the control plants showed a more withered phenotype than plants in which the CaSIBZ1 gene was silenced (middle of FIG. 3B).

Next, after restarting the water cycle for 3 days, each survival rate was measured. As a result, as shown in the right side of FIG. 3B, the survival rate of the plant in which the CaSIBZ1 gene was silenced after refeeding was about 86.67%, and the survival rate of the control plant was about 25.00%. From the above results, it was confirmed that inhibition of CaSIBZ1 gene expression enhances dry resistance (FIG. 3B).

Next, CaSIBZ1 gene drying of silence pepper plant - to investigate whether due to the increased resistance phenotype water retention by measuring the fresh weight (fresh weight) of leaves taken from the control and CaSIBZ1 pepper plant genes are silenced Transpiration water loss was confirmed. As a result, as shown in Figure 3C, the moisture loss of the leaves was confirmed that the CaSIBZ1 gene silenced in the pepper plants relatively lower than the control plants (Fig. 3c).

On the other hand, opens the pores, to increase production rate is increased, a bar to drop the temperature of the leaf, a lower transpiration rate of the silence pepper plant CaSIBZ1 gene to identify the group released is also (stomatal aperture) whether by reduction, control and CaSIBZ1 After the ABA treatment of the pepper genes silenced, the leaf temperature and pore size were observed. As a result, as shown in Figures 3d, 3e, the leaf temperature of the CaSIBZ1 gene silenced pepper plant was higher than the leaf temperature of the control (Fig. 3d), and also confirmed that the pore opening was smaller than the control (Fig. 3d). 3e), it was confirmed that this is related to the temperature of the leaves.

EXAMPLE  5. CaSIBZ1  Overexpression ( CaSIBZ1 -OX) Plant ABA Water resistance (hyposensitivity) check

As always described in Example 4, CaSIBZ1 gene silenced pepper plants showed a strong phenotype to dry stress. In order to further confirm the functionality of the in vivo gene CaSIBZ1, the embodiment 1-2 method of manufacturing a permanent expression of the gene is CaSIBZ1 transgenic Arabidopsis under the control of the CaMV 35S promoter in accordance with the described, and the two independent T3 homozygous Line ( CaSIBZl- OX) was obtained and RT-PCR was performed for phenotypic analysis. The results are shown in FIG.

Next, using CaSIBZl overexpression ( CaSIBZl- OX) plants, we compared phenotypic analyzes of CaSIBZl- OX plants at germinative and seedling stages to identify CaSIBZ1 involvement in ABA signaling. More specifically, germination of seeds in Murashige and Skoog (MS) growth medium supplemented with ABA at various concentrations (0, 0.75 and 1.0 μM) confirmed germination rates of CaSIBZ1- OX and control (wild-type) plants. As shown, there was no significant difference in germination rate between the control and CaSIBZ1- OX seed without ABA, but in the presence of ABA, the germination rate of CaSIBZ1- OX seed was significantly higher than that of wild seeds (FIG. 5A).

On the other hand, in order to analyze the response to ABA in the seeding stage (seedling stage), the hair growth rate was measured in ABA. As a result, as shown in FIG. 5, the hair growth rate was significantly higher in CaSIBZ1- OX plants than in control plants (FIGS. 5B-5E).

In addition, according to the method described in Example 1-10 and Example 1-12, after the control plants and CaSIBZ1- OX plants were grown, ABA was treated to determine the pore opening and leaf temperature. When ABA was not treated, it was confirmed that there was no significant phenotypic difference in pore opening or leaf temperature between the control and CaSIBZ1- OX plants. However, as shown in FIG. 6, when exposed to 20 μM ABA, it was confirmed that the pore opening of the CaSIBZ1- OX plants was significantly larger than that of the control plants (FIG. 6D). In addition, as a result of exposure to 50 μM ABA, the leaf temperature of the CaSIBZ1- OX plants was significantly lower than the leaf temperature of the control plants (Fig. 6c). From the results, it was confirmed that the altered ABA sensitivity indicated by CaSIBZ1- OX plants depends on the growth stage.

EXAMPLE  6. CaSIBZ1  Overexpression ( CaSIBZ1 -OX) of the plant Reduced  Confirmation of drying resistance

Pepper plant silenced CaSIBZ1 gene of Example 4 exhibited a dry-resistant phenotype, and the CaSIBZ1 gene overexpression of Example 5 was confirmed to show a reduced sensitivity to ABA, thus overexpression of CaSIBZ1 gene It was confirmed to change the response to this dry stress. First, to determine whether the ABA-sensitive phenotypes exhibited by CaSIBZ1- OX plants are due to reduced water loss, the fresh weights of the leaves of the CaSIBZ1- OX plants and the control plants were compared to compare the transpiration rate between the two plants. It was. As a result, as shown in Figure 6, when treated with ABA, it was confirmed that the water loss in the leaf tissue of the CaSIBZ1- OX plants higher than the control plants (Fig. 6b).

In addition, to investigate the effect of CaSIBZ1 overexpression on dry resistance, phenotypic analysis of control and CaSIBZ1 -OX plants was performed in response to dry stress. As a result, as shown in Figure 6, comparing the phenotype of the control and CaSIBZ1- OX plants under sufficient water conditions, did not find a difference in the phenotype between the two plants (Fig. 6a left). However, by stopping watering for 11 days, CaSIBZ1- OX plants exhibited more withered phenotypes than control plants when exposed to dry stress (Figure 6A middle and right).

In addition, when water was supplied to the plants again for one day, as shown in FIG. 6, 78% of the control plants survived again, while only 0 to 24% of the CaSIBZ1- OX plants survived again. The results indicate that the reduced water retention capacity of CaSIBZ1- OX plants was derived from ABA low water soluble, which contributed to the dry stress sensitive phenotype (FIG. 6A).

On the other hand, in order to ensure that the drying-induced gene expression, either directly or indirectly controlled by CaSIBZ1, according to the method described in Example 1-7, CaSIBZ1 -OX after dehydration in plants and control plants drying-resistant genes RD29B QRT -PCR was performed using primers specific for , RD26, RAB18 and KIN2 . As a result, as shown in FIG. 6, after 6 hours of dehydration , the expression level of stress response genes including RD29B , RD26, RAB18, and KIN2 related to ABA synthesis was significantly higher in the leaves of CaSIBZ1- OX plants than in the control plants. Was confirmed to be low (FIG. 9E). From the above results, it was confirmed that the expression of CaSIBZ1 gene not only affects ABA synthesis but also regulates the response to dry stress.

The description of the present invention set forth above is for illustrative purposes, and it will be understood by those skilled in the art that the present invention may be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. There will be. Therefore, it should be understood that the embodiments described above are exemplary in all respects and not restrictive.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> Method for improving the resistance to the drought stress using          CaSIBZ1 in plants <130> MP18-060 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 1056 <212> DNA <213> CaSIBZ1 <400> 1 atgggatctt acctgaactt caagaacttc gctgacgcat cacaaccaga gagcagtggg 60 actaataatt tttcattggc cagacaatct accatatact cctttacgtt tgatgagctg 120 caaagtacat gtggacttgg aaaagatttt ggatcgatga atatggatga cttcttaaag 180 aatattgaag gggaaaattt gcagagacag ggttctttga cactgcctag gacacttagt 240 cagaaaacta tagatgaagt atggaaagac tttcagaaag agagtgttaa tgctaatgat 300 gtaagtgaga ctggaggatc aaactttggg cagagggaat ctaccttggg agaaatgaca 360 ttagaagagt ttttggttag agcaggggcg gtgagagaag atatgcaacc aactggatac 420 tcaaatgatg ttacattaac tactactagt ggtttcattc aacctagtag taatgtgacc 480 ataaaatttc ttcaagcaac ccaaaaccct ggacatcaaa ttgcagggac taacatattc 540 aatgtggtca gtactacatc tttaccgcag cagccccttt tccccaaaca aacaactgtg 600 gaatttgcat cacccatgca attagggaca agggctccca tgccaaatcc gtctgcaaat 660 actaatagta tcatgcaggg tggtgttatg agcatgccag taaaaggagt atcccctgga 720 aatctagata catcttctct ttcactttca ccgtatgcat gtggtgaagg tggaagagga 780 aggagatcat gtacctctat tgaaaaagtt gttgagagaa ggcgtaagag gatgataaag 840 aacagagagt ctgctgccag atcaagggat cggaagcagg catatacttt ggagttggaa 900 gctgaagtgg caaagctgaa agaaattaag caacagttgc agaagaatca ggctgaattt 960 attgagaagc agaaaaatca gttgttagaa aagatgaata tgccatggga aaataaacta 1020 atatgcttga gaaggacagt gactggacct tggtag 1056 <210> 2 <211> 351 <212> PRT <213> CaSIBZ1 <400> 2 Met Gly Ser Tyr Leu Asn Phe Lys Asn Phe Ala Asp Ala Ser Gln Pro   1 5 10 15 Glu Ser Ser Gly Thr Asn Asn Phe Ser Leu Ala Arg Gln Ser Thr Ile              20 25 30 Tyr Ser Phe Thr Phe Asp Glu Leu Gln Ser Thr Cys Gly Leu Gly Lys          35 40 45 Asp Phe Gly Ser Met Asn Met Asp Asp Phe Leu Lys Asn Ile Glu Gly      50 55 60 Glu Asn Leu Gln Arg Gln Gly Ser Leu Thr Leu Pro Arg Thr Leu Ser  65 70 75 80 Gln Lys Thr Ile Asp Glu Val Trp Lys Asp Phe Gln Lys Glu Ser Val                  85 90 95 Asn Ala Asn Asp Val Ser Glu Thr Gly Gly Ser Asn Phe Gly Gln Arg             100 105 110 Glu Ser Thr Leu Gly Glu Met Thr Leu Glu Glu Phe Leu Val Arg Ala         115 120 125 Gly Ala Val Arg Glu Asp Met Gln Pro Thr Gly Tyr Ser Asn Asp Val     130 135 140 Thr Leu Thr Thr Thr Ser Gly Phe Ile Gln Pro Ser Ser Asn Val Thr 145 150 155 160 Ile Lys Phe Leu Gln Ala Thr Gln Asn Pro Gly His Gln Ile Ala Gly                 165 170 175 Thr Asn Ile Phe Asn Val Val Ser Thr Thr Ser Leu Pro Gln Gln Pro             180 185 190 Leu Phe Pro Lys Gln Thr Thr Val Glu Phe Ala Ser Pro Met Gln Leu         195 200 205 Gly Thr Arg Ala Pro Met Pro Asn Pro Ser Ala Asn Thr Asn Ser Ile     210 215 220 Met Gln Gly Gly Val Met Ser Met Pro Val Lys Gly Val Ser Pro Gly 225 230 235 240 Asn Leu Asp Thr Ser Ser Leu Ser Leu Ser Pro Tyr Ala Cys Gly Glu                 245 250 255 Gly Gly Arg Gly Arg Arg Ser Cys Thr Ser Ile Glu Lys Val Val Glu             260 265 270 Arg Arg Arg Lys Arg Met Ile Lys Asn Arg Glu Ser Ala Ala Arg Ser         275 280 285 Arg Asp Arg Lys Gln Ala Tyr Thr Leu Glu Leu Glu Ala Glu Val Ala     290 295 300 Lys Leu Lys Glu Ile Lys Gln Gln Leu Gln Lys Asn Gln Ala Glu Phe 305 310 315 320 Ile Glu Lys Gln Lys Asn Gln Leu Leu Glu Lys Met Asn Met Pro Trp                 325 330 335 Glu Asn Lys Leu Ile Cys Leu Arg Arg Thr Val Thr Gly Pro Trp             340 345 350

Claims (5)

CaSIBZ1 (Capsicum annuum SIR1 -Interacting bZIP transcription factor 1) gene consisting of the nucleotide sequence of SEQ ID NO: 1 encoding a negative regulator protein for dry stress. CaSIBZ1 protein consisting of the amino acid sequence of SEQ ID NO: 2 encoded by the CaSIBZ1 gene according to claim 1. A recombinant expression vector containing the CaSIBZ1 gene according to claim 1. CaSIBZ1 (Capsicum annuum SIR1-Interacting bZIP transcription factor 1) comprising a protein expression or activity inhibitor as an active ingredient, a composition for enhancing the dry resistance of plants. A method of enhancing dry stress resistance of a plant comprising inhibiting the expression or activity of CaSIBZ1 protein, wherein the CaSIBZ1 protein is composed of the amino acid sequence of SEQ ID NO: 2, a method of enhancing dry stress resistance of a plant.

Images