KR102092069B1 - Method for improving resistance to the drought stress using pepper E3 ligase CaAIRE1 in plants - Google Patents

Abstract

The present invention relates to an E3 ligase CaAIRE1 gene derived from a Korean dark green pepper variety, a protein composed of an amino acid encoded by the gene, and a method for enhancing drought stress resistance of plants using the gene or the protein. The CaAIRE1 protein functions as a positive regulator of ABA signal transduction to confirm a drought stress resistance enhancement effect in a transgenic plant where the protein is overexpressed. Thus, expression regulation of the CaAIRE1 gene is expected to be used for modify crops, etc., which can be used by the human, and especially, be usefully used to enhance the productivity of the plants.

Description

Method for improving resistance to the drought stress using pepper E3 ligase CaAIRE1 in plants}

The present invention relates to a CaAIRE1 ( Capsicum annuum CaAIPP1 Interacting RING type E3 ligase) gene derived from the pepper green bean variety, a protein composed of amino acids encoded by the gene, and a method for enhancing dry stress resistance of the plant using the gene or protein .

Global warming causes severe climate change, causing environmental stress that inhibits the normal growth and development of plants, while plants have evolved sophisticated defense mechanisms to survive in adverse environments such as cold, high salt, and drought. For example, drought is caused by an environment lacking moisture and severely affects the normal growth of plants, resulting in a decrease in crop yields. Plants are closed with pores, abscisic acid (abscisic acid) to adapt to this dry stress. ABA) activates various defense mechanisms such as synthesis and accumulation.

ABA is a regulatory factor for protecting plants against abiotic stress, especially dry stress, and is known to play a very important role in plant growth and development. Reportedly, plants that pre-treated and stressed ABA were more resistant to stress than those that did not, whereas mutant plants that did not produce ABA or responded to ABA were found to be less susceptible to stress. Therefore, it is expected that by using proteins involved in the reaction of ABA, plants with improved resistance to environmental stress can be developed.

ABA signaling is known to regulate the expression of various stress-related genes such as E3 ligase and transcription factors involved in osmotic adaptation and regulation of root hydraulic conductivity, but the complete ABA signaling pathway has yet to be identified. Did not. In order to initiate ABA signaling in plant cells, the ABA receptor must be present and the signal must be delivered to the lower protein. Until now, it was known that PYR / PYL / RCARs as ABA receptors play a role in ABA recognition. When the receptor recognizes ABA, phosphorylation of the target protein promotes the expression of specific genes and ion channel activation, which allows the plant to adapt to adverse environments.

Today, as desertification progresses, water shortages cause great problems for agriculture and the environment. Therefore, there is a need to develop plants that can survive and survive in a dry environment even when using less water. When these technologies are developed and applied to crops, it is expected that agricultural production will increase significantly. Especially in arid regions, plants with improved dry resistance, that is, plants that can lower the production action, are beneficial for survival, thus contributing to the improvement of agricultural productivity. In addition, it can be useful for environmental cleanup in areas with very dry environments.

Accordingly, a method for improving the resistance of plants to dry stress has become a major research subject, and in this regard, studies on genes related to dry stress tolerance and growth promotion and the resulting transformed plants have been conducted, but they are still incomplete. .

Republic of Korea Patent Publication No. 10-2017-0104039

The present inventors identified a CaAIRE1 gene in red pepper while researching to investigate the relationship between dry stress responses through regulation of the ABA signaling pathway, and the gene regulates ABA-mediated pore closure, thereby allowing resistance to dry stress in plants. The present invention was completed by examining the function as a positive regulator that promotes.

Accordingly, an object of the present invention is to provide a composition for promoting dry stress resistance of a plant comprising the CaAIRE1 gene, the CaAIRE1 protein and the gene or protein as an active ingredient.

Another object of the present invention is to provide a method for promoting dry stress resistance of a plant comprising the step of transforming a gene encoding the CaAIRE1 protein into a plant, and a transformed plant produced by the method.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems that are not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the object of the present invention, the present invention provides a CaAIRE1 gene that encodes a positive regulator protein against dry stress and consists of the nucleotide sequence of SEQ ID NO: 1.

In addition, the present invention provides a CaAIRE1 protein consisting of the amino acid sequence of SEQ ID NO: 2 encoded by the CaAIRE1 gene.

In addition, the present invention provides a composition for enhancing dry stress resistance of a plant, comprising the gene or the protein as an active ingredient.

In addition, the present invention provides a method for enhancing dry stress resistance of a plant, comprising the following steps:

(A) transforming the gene of SEQ ID NO: 1 encoding the CaAIRE1 protein in plants; And

(B) over-expressing the CaAIRE1 protein in the transformed plant.

In addition, the present invention provides a transgenic plant with improved dry stress resistance by the above method.

In the present invention, the CaAIRE1 gene encoding a protein for enhancing resistance to dry stress was identified, and the CaAIRE1 protein functions as a positive regulator of ABA signaling, confirming the effect of enhancing dry stress resistance in transgenic plants overexpressing the protein, It can be used to improve crops that can be used by humans through regulation of the expression of the CaAIRE1 gene, and it is expected to be useful for improving plant productivity.

1a is a result of analyzing the number of phylogenetic trees of CaAIRE1 of the present invention.
Figure 1b shows the results of the amino acid sequence alignment of the RING zinc finger C3HC4 type domains of various species.
Figure 1c shows the results of in vitro ubiquitin analysis of the CaAIRE1 protein labeled with maltose binding protein (MBP).
Figure 1d is a result of observing the intracellular location of CaAIRE1 based on the transient expression of the green fluorescent protein (GFP) fusion protein.
1E shows the expression pattern of the CaAIRE1 gene over time during ABA or drought treatment.
Figures 2a to 2e will observe the change in sensitivity to the drought stress of CaAIRE1- silenced pepper plants, Figure 2a is a control plant (TRV: 00) and CaAIRE1 -silenced pepper plants (TRV2: CaAIRE1 ) CaAIRE1 expression in the leaves, Figure 2b is the result of comparing the change in phenotype during drought treatment on the plant, Figure 2c is the pore opening degree of the plant, Figure 2d is the temperature of the plant leaf, Figure 2c is the evaporation moisture loss of the plant.
3A to 3D test the improved ABA sensitivity of CaAIRE1 overexpressing (OX) plants, FIGS. 3A and 3B show the germination rates of wild type (WT) and CaAIRE1 -OX plants, and FIGS. 3C and 3D show the growth of the roots of the two plants. The degree is compared.
Figures 4a to 4d is to observe whether the strengthening of the drought tolerance of CaAIRE1 -OX plants, Figure 4a is a wild-type (WT) and CaAIRE1 -OX, the weight of the leaves separated from the plant over time, Figure 4b is the porosity of the plant , Figure 4c is the temperature of the plant leaves, Figure 4d is a comparison of the phenotypic changes during drought treatment on the plant.
5 is a result of analyzing the expression of ABA response gene in the leaves of wild-type and CaAIRE1- OX plants through qRT-PCR.

The present inventors identified the CaAIRE1 gene in red pepper, and completed the present invention by identifying that the gene functions as a positive regulator that promotes dry stress resistance of plants by controlling ABA-mediated pore closure.

In an embodiment of the present invention, it was confirmed that analyzes the identification and molecular characteristics of CaAIRE1 CaAIRE1 coding sequence is configured at the C- terminal region to copine domain and RING E3 domain and Lee have a dehydratase activity (see Example 2 ).

In another embodiment of the present invention, it was confirmed that the CaAIRE1- silenced pepper plant is vulnerable to drought stress, such as moisture evaporation loss and porosity being greater than that of the wild-type plant (see Example 3).

In another embodiment of the present invention, it was confirmed that in the Arabidopsis thaliana overexpressing CaAIRE1 , ABA susceptibility is increased, such as lower germination rate and inhibiting root growth, than in wild-type plants during ABA treatment (see Example 4).

In another embodiment of the present invention, it was confirmed that in case of Arabidopsis thaliana overexpressing CaAIRE1 , improved drought resistance was exhibited, such as showing a less withered phenotype and showing a higher survival rate when treated with drought stress compared to wild-type plants (see Example 5). .

In another embodiment of the present invention, it was confirmed that the expression of the ABA-response marker gene was higher in Arabidopsis thaliana overexpressing CaAIRE1 than in wild type plants (see Example 6).

Hereinafter, the present invention will be described in detail.

The present invention encodes a positive regulator protein against dry stress, and provides a CaAIRE1 gene consisting of the nucleotide sequence of SEQ ID NO: 1.

In the present invention, "positive regulator (positive regulator) protein" means a protein that acts in an increasing direction in the regulation of life phenomena. That is, when the gene of the present invention, CaAIRE1 is overexpressed, ABA sensitivity may be increased and resistance to dry stress may be increased.

As another aspect of the present invention, the present invention provides a CaAIRE1 protein consisting of the amino acid sequence of SEQ ID NO: 2 encoded by the CaAIRE1 gene.

As another aspect of the present invention, the present invention provides a composition for enhancing dry stress resistance of a plant, comprising the gene or the protein as an active ingredient.

As another aspect of the present invention, the present invention provides a method for enhancing dry stress resistance of a plant, comprising the following steps:

(A) transforming the gene of SEQ ID NO: 1 encoding the CaAIRE1 protein in plants; And

(B) over-expressing the CaAIRE1 protein in the transformed plant.

As another aspect of the present invention, the present invention provides a transformed plant having improved dry stress resistance by the above method.

In the present invention, the plant (sieve) includes rice, wheat, barley, corn, soybeans, potatoes, red beans, oats, food crops including sorghum; Vegetable crops including Arabidopsis, Chinese cabbage, radish, pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion, and carrot; Special crops including ginseng, tobacco, cotton, sesame, sugar cane, beet, perilla, peanut, and rapeseed; Fruit trees including apple trees, pear trees, date palms, peaches, spears, grapes, tangerines, persimmons, plums, apricots, and bananas; Flowers including roses, gladiolus, gerbera, carnation, chrysanthemum, lily, tulip; And ryegrass, red clover, orchardgrass, alpha waves, tol pesque, may be feed logistics including perennial grass, and most preferably, Arabidopsis thaliana or pepper, but is not limited thereto.

Hereinafter, preferred embodiments are provided to help understanding of the present invention. However, the following examples are only provided to more easily understand the present invention, and the contents of the present invention are not limited by the following examples.

[ Example ]

Example  1. Experiment preparation and method

1-1. Yeast double Hybridization  analysis ( Yesst  two-hybrid assay, Y2H )

For yeast library screening, the N-terminal 19 amino acid deletion construct was amplified from PP2CA cDNA and cloned into the pGBKT7 vector. The partial PP2CA BD-structure was transformed by introducing it into the yeast strain Y2Hgold using a lithium acetate-regulated transfer method. At this time, Y2H analysis was performed according to a conventionally known method.

More specifically, each construct was prepared by cloning full-length CaAIRE1 and PP2Cs into pGBKT7 and pGADT7 vectors, respectively, and the bait and prey structures were co-transformed into yeast strain AH109 using a lithium acetate-regulated transfer method. Ordered.

Transformants were selected with SC-leucine-tryptophan medium and transferred on interation selection medium (SC-adenine-histidine-leucine-tryptophan) to measure growth rate as an indicator of protein-protein interaction. For serial dilution analysis, the exponentially grown yeast cells are collected, the OD ₆₀₀ value is adjusted to 0.5 with sterile double-distilled water, and 5 μl of each yeast cell culture solution is added with or without 10 μM ABA. Spotted on SC-leucine-tryptophan medium and SC-adenine-histidine-leucine-tryptophan medium.

1-2. Recombinant protein expression and purification

For the expression of the MBP-CaAIRE1 recombinant protein, in the Y2H analysis of Example 1-1, a truncated CaAIRE1 sequence corresponding to the region interacting with CaAIPP1 was inserted into a pMAL-c2X vector (New England Biolabs), and the recombinant vector. Was introduced into E. coli strain C + cells, and the MBP- CaAIRE1 fusion protein was induced and purified according to the manufacturer's instructions (New England Biolabs).

More specifically, cells were grown at OD ₆₀₀ 0.6 to 1.0 at 0.1 μM isopropylthio-P-galactoside for 12 hours at 20 ° C., and harvested cell pellets were grown in 20 mM Tris-HCl (pH 7.4). ), Resuspended in MBP column complete solution containing 200 mM NaCl and 1 mM EDTA, and sonicated on ice with Vibracell Sonics and Materials. Next, for the expression of CaAIPP1, the coding sequence of CaAIPP1 was introduced into a pGEX4T-3 vector (GE Healthcare Bio-Sciences, Uppsala, Sweden), and then transformed into E. coli strain c + cells, and the expression of GST-CaAIPP1 fusion protein was It was performed as described above. Recombinant fusion protein was affinity purified from bacterial lysates according to the manufacturer's instructions using glutathione-Sepharose 4 Fast Flow (GE Healthcare Bio-Sciences), and the purified protein concentration Was measured using the Pierce BCA Protein Assay Kit (Thermo Scientific, Rockford, IL, USA), and the purified protein was stored at -20 ° C until used in an in vitro ubiquitination assay.

1-3. in vitro ubiquitination  assay

For in vitro ubiquitination assay, GST-CaAIRE1 protein (500 ng) was added to 250 ng of recombinant human UBE 1 (Boston Biochemicals, Cambridge, MA, USA), 250 ng of human UbcH5b (Hig-tag; Enzo Life Sciences, Farmingdale, NY, USA) and 10 μg bovine ubiquitin (Sigma-Aldrich) ubiquitination reaction buffer solution [50 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 0.05 mM ZnCl ₂ , 1 mM Mg -ATP, 0.2 mM dithiothreitol, 10 mM phosphocreatine, and 0.1 unit of creatine kinase (Sigma-Aldrich)] and then incubated at 30 ° C. for 3 hours to determine whether CaAIRE1 mediates PP2CA ubiquitination. , GST-PP2CA fusion protein (50 ng) was added to the ubiquitin mixture, and the mixture was incubated for 12 hours. The reacted proteins were separated using SDS-PAGE, and then analyzed by immunoblotting with anti-Ub (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and anti-GST antibody (Santa Cruz Biotechnology).

1-4. Plant material and growth conditions

Red pepper ( Capsicum annuum L., cv. Nockwang), Arabidopsis thaliana : ecotype Col-0) and tobacco ( Nicotiana benthamiana seeds are steam sterilized blended soil (peat moss: perlite: vermiculite = 5: 3: 2, v / v / v), sand, and loam soil. Mix and sow 1: 1: 1 (v / v / v). The plants were then grown under white fluorescent light (130 μmol photons m ^-2 S ^-1 ; for 16 hours a day) in a growth chamber at 24 ± 1 ° C.

1-5. Sequence alignment

The amino acid sequence encoded by CaAIRE1 and its homologous sequence were obtained using BLAST searches (http://www.ncbi.nlm.nih.gov/BLAST). SMART (http://smart.embl-heidelberg.de) web server was used to identify the RING finger. Amino acid alignment was performed using CLUSTALW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2), and the result was using Genedoc software (http://www.nrbsc.org/gfx/genedoc) Was edited.

1-6. Subcellular localization analysis

The CaAIRE1-GFP fusion protein was transiently expressed in the leaves of tobacco ( N. benthamiana ) epidermal cells using agroinfiltration of Agrobacterium tumefaciens strain GV3101 (1: 1 ratio; OD ₆₀₀ = 0.5) with p19 strain. . After 2 days infiltration, GFP signals were observed with a confocal microscope (510 UV / Vis Meta; Zeiss, Oberkochen, Germany) equipped with LSM Image Browser software.

1-7. ABA, dry stress treatment and morphology analysis

To observe the change in the expression pattern of the CaAIRE1 gene in the pepper plant, ABA, or dried leaf samples were prepared. Pepper plants in the six-leaf stage were sprinkled with 100 μM ABA and carefully removed from the soil to prevent damage. Next, the entire plant was dried on 3-mm paper (Whatman, Clifton, UK) or the roots were removed and the aerial part of the plant dried. After this treatment, the third and fourth leaves were harvested at a given time point.

For dehydration tolerance assays, four major gene-silenced pepper plants and control pepper plants and three major Arabidopsis and wild-type plants of the transgenic line were randomly placed and watered for 10 days each. Drying stress was given by interruption. After that, the plants were watered again for 12 hours, and the survival rate was calculated by counting the number of plants with rehydrated leaves. In order to quantitatively measure the dry resistance, the leaves isolated from gene-silenced pepper plants and transformed Arabidopsis thaliana plants were dried to measure the water loss rate. The leaves were placed in a growth chamber at 40% relative humidity, and the loss of fresh weight was measured at a fixed time, and the experiment was repeated three times.

For quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis, carefully remove and dry the 4 week old transgenic and wild-type plants overexpressing the CaAIEF1 gene from the soil They were harvested at a fixed time after treatment under stress.

1-8. Virus-induced gene silencing ( VIGS )

For loss-of function analysis of CaAIRE1 , virus-induced gene silencing (VIGS) was performed in pepper plants. Briefly, the Agrobacterium tumefaciens strain GV3101 carrying pTRV1 and pTRV2: CaAIRE1 or pTRV2: 00 as a negative control was infiltrated into fully expanded cotyledons of pepper (OD ₆₀₀ = 0.2 for each strain). Plants were placed in a growth chamber at 24 ° C. with a photoperiod of 16 hours light / 8 hours dark cycle so that growth and viruses could multiply.

1-9. CaAIRE1  Preparation of transgenic Arabidopsis thaliana gene overexpressed

For the function analysis of CaAIRE1 , a Arabidopsis thaliana overexpressing the CaAIEF1 gene was prepared. The full-length coding region of the CaAIRE1 gene was inserted into the pENTR / D-TOPO vector (Invitrogen, Carlsbad, CA). Through the LR reaction, the cloned gene was introduced into pK2GW7 to express each gene constitutively under the control of the CaMV 35S promoter (Karimi et al. 2002), and the correct structure was introduced into the Agrobacterium tumefaciens strain GV3101. . The pollen dip method was applied to the transformation of Arabidopsis thaliana using CaAIRE1 . The overexpressed plants were selected from germinated seeds presumed to be transformed seeds in MS plates supplemented with a selection marker of kanamycin 50 μg · mL ⁻¹ . Seeds from T3 plants were harvested from second generation transgenic plants showing a 3: 1 separation ratio in MS plates supplemented with the same antibiotic.

1-10. Of the stomatal aperture  Biological assay

For the bioassay of porosity, the primary and secondary leaves of peppers and 4-week-old Arabidopsis thaliana plants are harvested to separate the bark of the leaves, and stomatal opening solution (SOS :) for 2.5 hours under light conditions. 50 mM KCl, 10 mM MES-KOH, pH 6.15, 10 mM CaCl ₂ ). Pore occlusion was induced by replacing with SOS solutions containing various concentrations of ABA. After further incubation for 2.5 hours, 100 pores were randomly observed in each sample using a Nikon eclipse 80i microscope, and the width and length of the pores were imaged using Image J 1.46r (http://imagej.nih.gov/ij). It was measured. Each of the experiments was performed independently three times.

1-11. Heat Imaging (Thermal imaging)

Four-week-old pepper plants with fully grown primary and secondary leaves were treated with 50 μM ABA, and the roots of Arabidopsis thaliana plants were removed by three weeks to give dry stress. Thermal images were obtained using an infrared camera (FLIR systems; T420), and the leaf temperature of the plants was measured using FLIR Tools + ver 5.2 software.

1-12. RNA extraction and qRT - PCR

Total RNA was extracted using an RNeasy Mini kit (Qiagen, Valencia, CA). After harvesting the leaves of pepper and Arabidopsis thaliana plants each treated with ABA or subjected to dry stress, all RNA samples extracted from the leaves of the plant are digested with RNA-free DNase (RNA-free DNase) to remove genomic DNA. , Transcript First Strand cDNA was synthesized using cDNA Synthesis kit (Roche, Indianapolis, IN, USA). For qRT-PCR analysis, a cFX96 Touch ™ Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA) with the iQ ™ SYBR Green Supermix and specific primers shown in Table 1 below was used to synthesize cDNA synthesized by the above method. It was amplified using. All reactions were performed in triplicate. PCR was carried out with a program of 45 cycles of 95 ° C for 5 minutes, 95 ° C for 20 seconds, 60 ° C for 20 seconds, and 72 ° C for 20 seconds and 45 cycles. The relative expression level of each gene was calculated by the ΔΔCt method, and the Arabidopsis actin8 ( Atact8 ) gene and the pepper actin 1 ( CaACT1 ) gene were used for normalization.

Primer name Primer sequence (5'- 3 ') Sequence number AtRD29B Forward GTTGAAGAGTCTCCACAATCACTTG 3 Reverse ATTAACCCAATCTCTTTTTCACACA 4 AtRAB18 Forward GGAAGAAGGGAATAACACAAAAGAT 5 Reverse GCGTTACAAACCCTCATTATTTTA 6 AtDREB2A Forward CTACAAAGCCTCAACTACGGAATAC 7 Reverse AAACTCGGATAGAGAATCAACAGTC 8 AtABI5 Forward CAGTGGAGAAAGTAGTGGAGAGAAG 9 Reverse CCCTTGACTTCAAACTCTCAAAATA 10 AtActin8 Forward CAACTATGTTCTCAGGTATTGCAGA 11 Reverse GTCATGGAAACGATGTCTCTTTAGT 12 CaAIRE1 Forward CTCGGTCTGCTTGGAAAAAG 13 Reverse CAAACTGGGCAAACCTTCAT 14 CaACT1 Forward GACGTGACCTAACTGATAACCTGAT 15 Reverse CTCTCAGCACCAATGGTAATAACTT 16

1-13. Statistical analyses

Statistical analysis was performed using student's t-test or ANOVA (Fisher's LSD test) to determine significant differences between genotypes. When the P value was 0.05 or less, it was judged as a significant level difference.

Example 2. CaAIRE1 Identification and molecular characterization

Various E3 ligase modulates ABA responses through degradation of ABA signaling elements, including transcription factors and enzymes. In a previous study, CaAIPP1, a 2C type protein phosphatase, which acts as a negative regulator of ABA signaling and drought stress response, was identified, and drought stress-treated red pepper to identify candidate proteins that interact with CaAIPP1 Yeast two hybrid (Y2H) screening analysis was performed using cDNA library extracted from leaves.

As a result, as a putative CaAIPP1 interaction partner with a C3HC4 type RING domain, E3 ligase, CaAIRE1 ( Capsicum annuum CaAIPP1 Interacting RING type E3 ligase) was discovered and isolated, and the CaAIRE1 sequence encodes a 362 amino acid residue with a molecular weight of 409 kDa It was confirmed that includes a 1089-bp open reading frame. In addition, the SMART (http://smart.embl-heidellberg.de) program and the pFAM program (http://pfam.xfam.org) show that the CaAIRE1 coding sequence consists of a copine domain and a RING domain in the C-terminal region. gave.

In addition, as shown in Figures 1a and 1b, multiple sequence alignment analysis showed high amino acid sequence identity between CaAIRE1 and RING finger proteins of various species in green plants, and C3HC4 type RING domain region capable of decisively acting on E3 ligase activity. Was confirmed to be highly conserved among these species.

CaAIRE1 also shows ubiquitin E3 ligase activity, as previous studies have reported that some E3 ligases containing the C3HC4-RING domain show poly-ubiquitin adhesion activity under abiotic stress conditions. To investigate, an in vitro ubiquitination assay was performed using a recombinant protein of E. coli. The purified GST-CaAIRE1 recombinant protein was cultured in the presence or absence of isolated ATP, ubiquitin, E1 and E2 enzymes using SDS-PAGE gel, followed by immunoblocking with anti-GST and anti-ubiquitin antibodies. As a result, as shown in Figure 1c, an additional ladder band was detected, confirming that CaAIRE1 has E3 ligase activity.

In addition, as a result of temporarily expressing the fusion protein of CaAIRE1-GFP in Nicotiana benthamiana epidermal cells in order to investigate the intracellular location of CaAIRE1 protein in plant cells, the fluorescent signal of CaAIRE1-GFP was detected in the nucleus as shown in FIG. 1D. It was confirmed that CaAIRE1 functions in the nucleus.

Furthermore, the pattern of CaAIRE1 expression was investigated using qRT-PCR in response to ABA and drought stress. As a result, as shown in FIG. 1E, CaAIRE1 transcript induction by ABA was first detected 2 hours after ABA treatment, and strongly induced at 6 hours, and it was confirmed that drought treatment also slightly induces CaAIRE1 expression. The results indicate that CaAIRE1 functions in ABA and drought stress conditions.

Example 3. CaAIRE1 -Drought tolerance phenotype of silenced pepper plants decreased

To study the biological function of ABA and CaAIRE1 in response to drought stress, knock-down plants were temporarily produced using virus-induced gene silencing (VIGS) technology.

As a result of performing qRT-PCR analysis to investigate the efficiency of VIGS using empty vector control (TRV: 00) and CaAIRE1-silenced (TRV: CaAIRE1 ) pepper leaves, CaAIRE1 in CaAIRE1-silenced pepper plants as shown in FIG. 2A. The expression level was significantly lower than the expression level in the control group.

As a result of measuring the water evaporation amount by measuring the raw weight of the separated pepper leaves to more clearly reveal the biological function of CaAIRE1 against drought stress, as shown in FIG. 2B, the evaporative water loss was lower in the CaAIRE1- silenced pepper leaves than in the control plants. It was confirmed that it was significantly high.

In addition, pore diameter and leaf temperature were measured to clarify whether the reduced rate of increase was affected by ABA-mediated pore closure control. As a result, as shown in FIG. 2C, in the absence of ABA, pore size of pores was not significantly different between CaAIRE1- silenced plants and control plants, but pore pores of CaAIRE1- silenced pepper plants after 10 and 20μM ABA treatment were control It was confirmed that it was larger than the plant.

In addition, to measure evaporative cooling by controlling the opening and closing of the pores, the leaf surface temperature was confirmed using an infrared thermal imaging camera (T420, FLIR system, USA). As a result, as shown in Figure 2d, the surface temperature of the CaAIRE1- silenced plant in the presence of 100 μM ABA was significantly lower than that of the control plant.

Furthermore, in order to investigate whether the changed water loss and ABA sensitivity affect the drought stress response, both plants were subjected to drought stress by limiting watering for 10 days. As a result, under good growth conditions, it was not possible to identify a distinct phenotype between CaAIRE1- silenced pepper and control plants, but when drought stress was applied by limiting watering for 10 days and then re- supplying for 12 hours, CaAIRE1- silenced pepper plants Showed a drought-sensitive phenotype than the control plants. In addition, CaAIRE1- silenced pepper plants recovered only 25% through re-supply, but all control plants resumed their growth. These results indicate that CaAIRE1 expression inhibition affects ABA-mediated pore closure, increasing susceptibility to drought stress.

Example 4. CaAIRE1 -Improved ABA sensitivity analysis of overexpressed (OX) transgenic plants

CaAIRE1- silenced pepper plants reduced drought tolerance through ABA desensitization as in Example 3 above, and further reverse genetic analysis was performed to further investigate the biological function of CaAIRE1.

For the analysis, a cauliflower mosaic virus (cauliflower mosaic virus, CaMV) were prepared in which the Arabidopsis thaliana (Arabidopsis) transgenic plants over-expressing the CaAIRE1 by the 35S promoter in the plant CaAIRE1 -OX been detected body is not detected in wild type plant transcription CaAIRE1 It was confirmed that it was not used for phenotypic analysis of ABA and drought stress.

Seed germination and seedling growth are developmental processes that are negatively regulated by ABA, so seed germination and post-emergence growth of wild-type and CaAIRE1- OX plants were investigated through germination rate and primary root growth measurements in the absence and presence of ABA. As a result, as shown in Figs. 3A and 3B, before ABA treatment, the difference in phenotype could not be observed between wild-type plants and transgenic plants, but the germination rate of CaAIRE1- OX seeds in MS medium containing 0.5 μM and 1.0 μM ABA was The germination rate of wild seeds was significantly lower. In the case of root growth in response to ABA, it was confirmed that growth was significantly inhibited in CaAIRE1- OX plants as compared to wild-type plants, as shown in FIGS. 3C and 3D. The above results indicate that when the expression of CaAIRE1 in Arabidopsis is increased, ABA hypersensitivity is imparted in the germination phase and the growth phase of germination phase.

Example 5. CaAIRE1 -Improve drought resistance of OX transgenic plants

As observed in Examples 3 and 4, CaAIRE1- silenced pepper showed a drought-sensitive phenotype, and CaAIRE1- OX plants showed an ABA hypersensitivity phenotype. Therefore, it was observed whether the phenotype of drought stress in the case of CaAIRE1- OX plants has changed.

First, as a result of measuring the increased water loss by measuring the weight of fresh rosette leaves isolated from wild-type and CaAIRE1- OX plants, as shown in FIG. 4A, the weight loss of CaAIRE1- OX plants was less than that of wild-type plants.

In addition, as a result of measuring the pore pore size and leaf temperature to confirm whether the change occurred due to the difference in ABA sensitivity, as shown in FIG. 3B, there was no significant difference between wild type and CaAIRE1- OX plants in the absence of ABA. After treatment with uM ABA, the pore pore size of the CaAIRE1- OX leaf was smaller than that of the wild-type plant, and as shown in FIG. 4C, the CaAIRE1- OX plant after ABA treatment showed lower leaf temperature than the wild-type plant.

According to the above results, it is expected that CaAIRE1 will also affect drought resistance since the increase in the expression of CaAIRE1 affects the size of the pores, and then the drought phenotype of wild type and CaAIRE1 -OX plants was analyzed to test the possibility. .

As a result, as shown in FIG. 4D, when the watering was restricted for 10 days for drought stress treatment, and then treated again, the CaAIRE1 -OX plants showed a withered phenotype less than the wild-type plants, and after re-watering for one day, It was confirmed that the CaAIRE1- OX plants recovered 70 and 83.3% growth, while the control plants did not.

Example  6. CaAIRE1 -Gene expression analysis in response to ABA in overexpressed transgenic plants

Based on the physiological analysis of Examples 2 to 5, CaAIRE1 affects the pore size in the presence of ABA, thereby changing the response to the drought condition. To this end, it was hypothesized that CaAIRE1 also affects the expression of the ABA-responsive gene and this changes the phenotype of the CaAIRE1- OX plant, and then to investigate the expression of ABA-responsive marker genes including DREB2A, RD29B, RD18 and ABI5, QRT-PCR analysis was performed with leaves of ABA treated wild type and CaAIRE1- OX transgenic plants for 3 hours.

As a result, as shown in FIG. 5, it was confirmed that the expression level of the marker gene was higher in CaAIRE1- OX plants than in wild-type plants after ABA treatment.

The above description of the present invention is for illustration only, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> Method for improving resistance to the drought stress using          pepper E3 ligase CaAIRE1 in plants <130> MP19-076 <160> 16 <170> KoPatentIn 3.0 <210> 1 <211> 1086 <212> DNA <213> CaAIRE1 <400> 1 atgatggaga ataagaagag gggcaagtat tactatattc ctgataattt caaatcactt 60 gatcaggtga ctttggccct gagagaatca ggtttggagt catcaaattt gattattggg 120 atagatttca cgaaaagcaa cgaatggaca ggtaaagttt cgttcaacaa cagaagcttg 180 catgcaatag gcgaattagt caatccatat gagaaagcca tatctatcat tggaaagaca 240 ttatctccat tcgatgagga caatttaatt ccttgttttg gatttggtga tgtgaccacg 300 catgatcaag acgtgtttag ctttcacagc gatcactctc cttgccatgg atttgaagaa 360 gtcctagctt gctacaagaa aatagttcca aatctgcaat tatccggacc aacatcgtac 420 ggtccagtaa tagatgctgc agtagatata gtagagagaa ctggtggaca ataccatgtg 480 ttggttatca tcgctgatgg acaggttacc aggagtgtca acacaagtga ttcggaactc 540 agcccacaag aagacaacac aattaagtct attgttactg caagcatgta tcctctctct 600 atcgttcttg ttggagttgg cgatggacct tgggaagaca tgcaaaaatt tgatgaccgt 660 atacctgctc gtgaaattga taattttcag tttgtgaatt tcaccgctat cgtgaacaaa 720 cattcaactg attcggaaaa agaagctgca ttcgctcttg ctgcactcat ggagatccct 780 atccaatata aagcagctag agaactcggt ctgcttggaa aaagaacagg caaggcaaaa 840 aagattgttc caaagccacc tcctatctct tatcgtcgcc ccatgagaat cccaactcaa 900 gatcaaagca gtagtctttc aggatccgcg caaaatgaac acagtcaagt ttgcccagtt 960 tgtctaactg gtactaagga catggctttt ggttgtggac acatgacctg cagagaatgt 1020 gctccaagat tatcagattg tcccatatgt cgtcgacgta taactagccg tatacggtta 1080 tacact 1086 <210> 2 <211> 362 <212> PRT <213> CaAIRE1 <400> 2 Met Met Glu Asn Lys Lys Arg Gly Lys Tyr Tyr Tyr Ile Pro Asp Asn   1 5 10 15 Phe Lys Ser Leu Asp Gln Val Thr Leu Ala Leu Arg Glu Ser Gly Leu              20 25 30 Glu Ser Ser Asn Leu Ile Ile Gly Ile Asp Phe Thr Lys Ser Asn Glu          35 40 45 Trp Thr Gly Lys Val Ser Phe Asn Asn Arg Ser Leu His Ala Ile Gly      50 55 60 Glu Leu Val Asn Pro Tyr Glu Lys Ala Ile Ser Ile Ile Gly Lys Thr  65 70 75 80 Leu Ser Pro Phe Asp Glu Asp Asn Leu Ile Pro Cys Phe Gly Phe Gly                  85 90 95 Asp Val Thr Thr His Asp Gln Asp Val Phe Ser Phe His Ser Asp His             100 105 110 Ser Pro Cys His Gly Phe Glu Glu Val Leu Ala Cys Tyr Lys Lys Ile         115 120 125 Val Pro Asn Leu Gln Leu Ser Gly Pro Thr Ser Tyr Gly Pro Val Ile     130 135 140 Asp Ala Ala Val Asp Ile Val Glu Arg Thr Gly Gly Gln Tyr His Val 145 150 155 160 Leu Val Ile Ile Ala Asp Gly Gln Val Thr Arg Ser Val Asn Thr Ser                 165 170 175 Asp Ser Glu Leu Ser Pro Gln Glu Asp Asn Thr Ile Lys Ser Ile Val             180 185 190 Thr Ala Ser Met Tyr Pro Leu Ser Ile Val Leu Val Gly Val Gly Asp         195 200 205 Gly Pro Trp Glu Asp Met Gln Lys Phe Asp Asp Arg Ile Pro Ala Arg     210 215 220 Glu Ile Asp Asn Phe Gln Phe Val Asn Phe Thr Ala Ile Val Asn Lys 225 230 235 240 His Ser Thr Asp Ser Glu Lys Glu Ala Ala Phe Ala Leu Ala Ala Leu                 245 250 255 Met Glu Ile Pro Ile Gln Tyr Lys Ala Ala Arg Glu Leu Gly Leu Leu             260 265 270 Gly Lys Arg Thr Gly Lys Ala Lys Lys Ile Val Pro Lys Pro Pro Pro         275 280 285 Ile Ser Tyr Arg Arg Pro Met Arg Ile Pro Thr Gln Asp Gln Ser Ser     290 295 300 Ser Leu Ser Gly Ser Ala Gln Asn Glu His Ser Gln Val Cys Pro Val 305 310 315 320 Cys Leu Thr Gly Thr Lys Asp Met Ala Phe Gly Cys Gly His Met Thr                 325 330 335 Cys Arg Glu Cys Ala Pro Arg Leu Ser Asp Cys Pro Ile Cys Arg Arg             340 345 350 Arg Ile Thr Ser Arg Ile Arg Leu Tyr Thr         355 360 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> AtRD29B Forward primer <400> 3 gttgaagagt ctccacaatc acttg 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> AtRD29B Reverse primer <400> 4 attaacccaa tctctttttc acaca 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> AtRAB18 Forward primer <400> 5 ggaagaaggg aataacacaa aagat 25 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AtRAB18 Reverse primer <400> 6 gcgttacaaa ccctcattat ttta 24 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> AtDREB2A Forward primer <400> 7 ctacaaagcc tcaactacgg aatac 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> AtDREB2A Reverse primer <400> 8 aaactcggat agagaatcaa cagtc 25 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> AtABI5 Forward primer <400> 9 cagtggagaa agtagtggag agaag 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> AtABI5 Reverse primer <400> 10 cccttgactt caaactctca aaata 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> AtActin8 Forward primer <400> 11 caactatgtt ctcaggtatt gcaga 25 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> AtActin8 Reverse primer <400> 12 gtcatggaaa cgatgtctct ttagt 25 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CaAIRE1 Forward primer <400> 13 ctcggtctgc ttggaaaaag 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CaAIRE1 Reverse primer <400> 14 caaactgggc aaaccttcat 20 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CaACT1 Forward primer <400> 15 gacgtgacct aactgataac ctgat 25 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CaACT1 Reverse primer <400> 16 ctctcagcac caatggtaat aactt 25

Claims (5)

delete delete CaAIRE1 ( Capsicum annuum CaAIPP1 Interacting RING type E3 ligase) consisting of the nucleotide sequence of SEQ ID NO: 1 or CaAIRE1 protein consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient, a composition for promoting dry stress resistance of plants.
A method for promoting dry stress resistance of a plant, comprising the following steps:
(a) CaAIRE1 ( Capsicum annuum CaAIPP1 Interacting RING type E3 ligase) step of transforming the gene of SEQ ID NO: 1 encoding a protein in a plant; And
(B) over-expressing the CaAIRE1 protein in the transformed plant.
A transgenic plant with improved dry stress resistance by the method of claim 4.

Images