KR101876634B1 - Method for improving the resistance to the drought stress using pepper transcription factor CaDILZ1 in plants - Google Patents

Abstract

The present invention relates to a novel pepper-derived CaDILZ1 ( Capsicum annuum Drought-Induced Leucine Zipper 1) gene / protein, and methods for enhancing dry stress resistance of plants using the same.
The present inventors have identified CaDILZ1 gene encoding a resistance-enhancing protein against dry stress, and confirmed that CaDILZ1 protein functions as a positive regulator of ABA signal transduction and enhances dry stress resistance in transgenic plants overexpressing the protein, Of the CaDILZ1 gene It can be used for the improvement of crops available to mankind through the regulation of expression, and it is expected to be useful for improving the productivity of plants.

Description

FIELD OF THE INVENTION [0001] The present invention relates to a method for enhancing dry stress resistance of a plant using the pepper transcription factor CaDILZ1,

The present invention relates to a novel CaDILZ1 ( Capsicum annuum Drought-Induced Leucine Zipper 1) gene / protein derived from pepper and a method for enhancing dry stress resistance of the plant using the same.

Water shortage in plants is one of the harmful environmental stressors, caused by drying, high salinity and cold, resulting in significant grain yield reduction. In order to survive in this water-poor environment, plants have evolved several defense mechanisms to minimize water loss due to vaporization in pores and maximize water uptake from root tips. Although the physiological and molecular mechanisms of plants in water-poor environments have been extensively studied, defense mechanisms in plant water-deficient environments are caused by complex and precise processes, and although they have not yet been clearly elucidated, the plant hormone abscisic acid ABA) is known to occur under drying conditions.

ABA is a major plant hormone for protecting plants against abiotic stress, especially dry stress, and is known to play a very important role in plant growth and development. ABA functions to help plants adapt to dry conditions by promoting pore closure, inducing defensive genes, and accumulating various defensive metabolites, while at the same time elevating genes by ABA biosynthesis and biosynthesis . 9-cis-epoxycarotenoid dioxygenases (NCED) are the major enzymes involved in ABA synthesis, and the expression of the NCED gene is expressed by osmotic stresses including dryness, high salt, and low temperature. The NCED gene is a positive regulator of ABA biosynthesis and biological stress tolerance. Mutations overexpressing the NCED gene showed an increase in ABA levels and increased tolerance to dry and high salt in several higher plants. On the other hand, the NCED3 non-marker mutation showed a phenotypic decrease in tolerance to dry stress, with a lower ABA level. However, the precise molecular action due to increased ABA biosynthesis has not been fully elucidated.

In the signaling pathway, specific genes are regulated by interactions between cis-acting elements and transcription factors. Transcription factors have various properties such as nuclear transfer, transcriptional activation or inhibition essential for the expression of the target gene, and DNA-binding to the targeted region of the target gene. These transcription factors are associated with adaptation to the stress environment, such as drying, high salt and temperature changes. Several transcription factors, including the type of cis-acting elements, including ERF, MYB, RAV or bZIP, are affected by the adaptive response of the plant and deletion or overexpression mutations show resistance or susceptibility to other stressors. Studies on bZIP factors in plants have suggested that bZIP factors regulate a variety of biological processes such as seed maturation, aging, adaptive responses to environmental stress, and the bZIP factor in plant adaptation responses to abiotic stress (Blanco & Judelson 2005, Lee et al. 2006, Pitzschke et al. 2009).

An alternative approach to adaptation to abiotic stress in plants is post-translational modification, a fast and effective mechanism to reduce impact. One type of post-translational modification, ubiquitination, is associated with various cellular processes and stress responses in plant development. In ubiquitin adducts, the substrate protein undergoes protein hydrolysis by 26S proteasome and the three enzymes -ubiquitin (E1), ubiquitin-conjugating enzyme (E2) and ubiquitin ligase (E3). Among these enzymes, the E3 ligase determines the specificity and constitutes the target protein. More than 1400 E3 ligands have been found through genomic sequencing in Arabidopsis.

The present inventors investigated the relationship between the dry stress response through the regulation of the ABA signal transduction pathway and found that CaDILZ1 ( Capsicum annuum ), a bPIP bZIP transcription factor, Drought-Induced Leucine Zipper 1) gene was identified. When the gene was overexpressed, it was confirmed that the plant was able to enhance dry stress resistance, thus completing the present invention.

Accordingly, an object of the present invention is to provide a composition for promoting dry stress resistance of a plant containing the novel CaDILZ1 gene and / or protein and the gene or protein as an active ingredient.

It is another object of the present invention to provide a method for enhancing dry stress resistance of a plant by transforming and overexpressing the CaDILZ1 gene into a plant.

It is still another object of the present invention to provide a transgenic plant improved in dry stress resistance by the above method.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In order to achieve the object of the present invention, the present invention encodes a protein that promotes resistance to drying stress, and comprises CaDILZ1 ( Capsicum annuum Drought-Induced Leucine Zipper 1) gene.

In addition, the present invention provides a composition for promoting dry stress resistance of a plant comprising the gene or CaDILZ1 protein consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient.

The present invention also provides a method for enhancing dry stress resistance of a plant, comprising the following steps.

(a) CaDILZl ( Capsicum annuum Transforming a gene of SEQ ID NO: 1 encoding a Drought-Induced Leucine Zipper 1) protein into a plant; And

(b) overexpressing the CaDILZl protein in the transformed plant.

The present invention also provides a transgenic plant improved in dry stress resistance by the above method.

The present invention identified a novel CaDILZ1 gene encoding a resistance-enhancing protein against dry stress, and the CaDILZ1 protein functioned as a positive regulator of ABA signal transduction and confirmed the effect of enhancing dry stress resistance in transgenic plants overexpressing the protein , The CaDILZ1 gene It can be used for the improvement of crops available to mankind through the regulation of expression, and it is expected to be useful for improving the productivity of plants.

Figure 1 is a diagram showing the molecular characteristics of CaDILZl. Figure 1A shows the domain structure of the deduced amino acid in CaDILZl. Two conserved domains were found using the SMART website (http://smart.embl-heidelberg.de) (BRLZ, basic region leucine zipper; DOG , DELAYED OF GERMINATION1), and the red triangle represents the nuclear location signal detected using WoLF PSORT (http://www.genscript.com/wolf-psort.html). Figure 1b shows the results of phylogenetic analysis of CaDILZl. Phylogenetic tree was generated by MEGA software based on multiple alignment of amino acids of CaDILZ1 and homologous proteins of CaDILZ1 using ClustalW2.
FIG. 1C shows the result of confirming the expression level of CaDILZ1 in each tissue according to the drying treatment, and FIG. 1D shows the result of confirming the expression level of CaDILZ1 by ABA, drying, and salt treatment. The CaACT1 (The pepper Actin1) gene was used as a control.
Figure 1e shows the intracellular location of the CaDILZl tobacco plant whose C-terminus is labeled with the GFP protein.
Fig. 2 shows the result of multiple alignments of CaDILZl. Multiple alignments of CaDILZl homologous protein and CaDILZl amino acid sequence were performed using ClustalW2. The same and similar amino acid residues were darkened according to identity, and the gaps introduced to maximize alignment in the homology region were indicated by dashes (the sequences used are: CaDILZ1 (accession no. NP_001311996), Solanum lycopersicum TGA2 (Accession No. XP_010322435), Solanum tuberosum TGA2 (accession No. XP_006347245), Glycine max TGA2-like (accession No. XP_003539469), Citrus sinensis TGA2-like (accession No. XP_006487950), Sesamum indicum TGA2 X1 (accession No. XP_011088884 ), Populus euphratica TGA2-like (Accession No. XP_011000921), Vitis vinifera TGA6 (XP_002276067), Beta vulgaris TGA2 (accession No. XP_010686013), Arabidopsis thaliana TGA9 (Accession No. NP_563810; AT1G08320), and Brassica napus TGA2- accession No. XP_002874883), red mark: BRLZ (green mark): DOG1 (DELAYED IN GERMINATION1) domain, nuclear signal is indicated by a black bar).
FIG. 3 is a graph showing the results of confirming the tolerance to dehydration stress of CaDILZ1-silenced pepper plants. FIG. 3A shows leaf temperatures of pepper plants with silenced ABA-treated CaDILZ1 and CaDILZ1 shows silenced pepper plants : CaDILZ1) and control plants (TRV2: 00) were representative images of leaf temperatures after 6 hours of treatment with 50 μM ABA. FIG. 3b shows the average temperatures of the first and second leaves of each plant Fig.
FIG. 3C shows photographs of pores induced by ABA of CaDILZ1-silenced pepper plants (TRV2: CaDILZ1) and control plants (TRV2: 00), and FIG. 3d shows the results of comparing the diameters and lengths of pores Fig.
Fig. 3 (e) is a diagram showing the change in the water loss loss of CaDILZ1-silenced pepper plants (TRV2: CaDILZ1) and control plant (TRV2: 00) every 1 hour.
FIG. 3f shows the results of confirming the change in the amount of ABA after dehydration stress treatment of CaDILZ1-silenced pepper plants (TRV2: CaDILZ1) and control plants (TRV2: 00).
FIG. 3g shows a significant difference (*) between the CaDILZ1-silenced pepper plants (TRV2: CaDILZ1) and the control plant (TRV2: 00) .
FIG. 4 shows the results of RT-PCR analysis of CaDILZ1 gene expression in CaDILZ1-silenced pepper plants. FIG. 4B shows the result of CaDILZ1 expression in Arabidopsis thaliana. The results are shown in Fig. The level of expression of each gene was analyzed by using 4-week-old Arabidopsis leaf of 35S :: CaDILZ1, and the third and fourth leaves were removed from 6-leaf stage plants that removed roots and applied dehydration effects in pepper plants. CaACT1 and the Arabidopsis Actin8 gene were used as controls.
FIG. 5 shows the results of confirming dehydration resistance of a 35S :: CaDILZ1 transgenic Arabidopsis plant treated with dehydration stress, wherein FIG. 5a shows the temperature of leaves taken from two Arabidopsis wild type plants and two independent 35S: CaDILZ1 plants FIG. 5B shows the average temperature measured from the three largest rosette leaves, FIG. 5C shows the results of checking the amount of water loss in the leaves of the wild-type plant and 35S :: CaDILZ1, 5d shows the result of confirming the pore-closure induced by 10 [mu] M ABA, Fig. 5e shows the result of confirming dehydration sensitivity in the wild type and 35S :: CaDILZ1 plants, Fig. 5f shows the results of confirming the wild type and 35S :: CaDILZ1 plants The relative expression level (ΔΔCT) of each gene was normalized using Actin8 as a control gene.
FIG. 6 shows the result of the CaDSIL protein as an interaction protein of CaDILZ1. FIG. 6A shows the results of cell-free degradation analysis of CaDILZ1. The GST-CaADIP1 protein (500 ng) . Immunoblot analysis was performed using anti-GST antibody (top), and CBB staining (bottom) shows the same loading of extract M, MG132. FIG. 6B shows the result of a yeast two-hybrid assay for confirming the interaction between CaDILZ1 and CaDSR1, and FIG. 6C shows a result of Bimolecular fluorescence complementation (BiFC) analysis. In the tobacco leaf, VYNE :: CaDILZ1 is CYCE :: CaDSR1 Lt; / RTI >
FIG. 7 shows the results of confirming the interaction of CaDILZl and CaDSRl in the nucleus.
FIG. 8 shows the result of confirming the E3 ubiquitin ligase activity of the CaDSR1 protein. FIG. 8a shows the results of confirming the intracellular self ubiquitination of the CaDSR1 protein. The MBP-labeled recombinant CaDSR1 and amino acid deletion mutant CaDSR1 ^C112S protein Arabidopsis E1, E2, Ub, and ATP. Ubiquitinated CaDSRl protein was identified using anti-MBP (top) and anti-Ub (bottom) antibodies. FIG. 8B shows the results of confirming intracellular ubiquitination of CaDILZ1 by CaDSR1. As a result, GST-labeled CaDILZ1 protein was added to the mixture and incubated for 2 hours. Immunoblot analysis revealed anti-GST and anti- Ub (bottom) antibody.

The present inventors have identified the CaDILZ1 gene, which is a bZIP transcription factor, which functions as a positive regulator of ABA signal transduction, and completed the present invention by confirming the increase in resistance to dry stress in transgenic Arabidopsis plants overexpressing the gene.

Accordingly, the present invention provides a method for screening for CaDILZ1 ( Capsicum annuum (SEQ ID NO: 1)) comprising the nucleotide sequence of SEQ ID NO: 1, which encodes a positive regulator protein for dry stress Drought-Induced Leucine Zipper 1) gene.

The gene CaDILZ1 of the present invention preferably comprises the nucleotide sequence of SEQ ID NO: 1, and the peptide encoded by the CaDILZ1 gene preferably comprises the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.

As used herein, a "positive regulator protein" refers to a protein that acts in an increasing direction in the regulation of life events. That is, when the gene of the present invention, CaDILZ1, is overexpressed, the resistance to ABA sensitivity and dry stress can be increased.

The present inventors have been studying genes involved in the dry stress response, and it has been confirmed that CaDILZl, which is a bZIP transcription factor (see Example 2), is increased in the ABA, dry, and high salt conditions, ABA dry stress response.

First, in one embodiment of the present invention, it was confirmed that the drying resistance was reduced in the pepper plants in which the CaDILZ1 gene was silenced (see Example 3), and the drying resistance was increased in the Arabidopsis plants overexpressing the CaDILZ1 gene (See Example 4).

In addition, it was confirmed in the present invention that the CaDILZ1 gene interacted with the pepper ring finger E3 ligase CaDSR1 (see Example 5).

Accordingly, by increasing the expression or activity of CaDILZ1 protein, resistance to dry stress (resistance) of the plant can be enhanced. Accordingly, as another aspect of the present invention, the present invention provides a method for producing a CaDILZ1 protein, The present invention provides a composition for promoting dryness resistance of a plant.

In the present invention, the plant (sieve) is a food crop including rice, wheat, barley, corn, soybean, potato, red bean, oats, sorghum; Vegetable crops including Arabidopsis, cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, squash, onions, onions and carrots; Special crops including ginseng, tobacco, cotton, sesame seed, sugar cane, beet, perilla, peanut, and rapeseed; Fruit trees including apple trees, pears, jujube trees, peaches, sheep grapes, grapes, citrus fruits, persimmons, plums, apricots, and bananas; Roses, gladiolus, gerberas, carnations, chrysanthemums, lilies, tulips; And feed crops including rice, red clover, orchardgrass, alpha-alpha, tall fescue, perennialla grass, and the like, most preferably, but not limited to, Arabidopsis thaliana or red pepper.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[Example]

Example 1. Experimental Preparation and Experimental Method

1-1. Plant materials and growth conditions

Capsicum annuum L., cv. Nockwang) and tobacco ( Nicotiana benthamiana seeds were grown in steam sterilized blended soil (peat moss: perlite: vermiculite = 5: 3: 2, v / v / v), sand, and loam soil 1: 1: 1 (v / v / v). Then the pepper plants were grown in a 24 ± 1 ° C room with a white fluorescence intensity of 130 μmol photons m ^-2 S ^-1 for 16 hours per day. Arabidopsis thaliana : ecotype Col-0) seeds were germinated in MS (Murashige and Skoog) salt supplemented with 1% sucrose and Microagar (Duchefa Biochemie). The Arabidopsis seedlings were grown under the same conditions as pepper in steam sterilized blended soil (peat moss: perlite: vermiculite = 9: 1: 1, v / v / v)

1-2. Virus-induced gene silencing (VIGS)

A virus-induced gene silencing (VIGS) system based on tobacco rattle virus (TRV) was used to knock down Ca DILZ1 gene in pepper.

Agrobacterium tumefaciens strains GV3101 carrying pTRV1 and pTRV2: CaDILZ1 or pTRV2: 00 as negative regulators were infiltrated into fully grown cotyledons of pepper plants (OD ₆₀₀ = 0.2). The plants were placed in a growth chamber set at 24 ° C for 16 hours / 8 hours at night to allow growth and virus propagation.

1-3. Ca DILZ1  Production of transgenic Arabidopsis overexpressed genes

The full-length Ca DILZ1 cDNA (accession no. NM_001325067) was inserted into the pENTR / D-TOPO vector (Invitrogen, Carlsbad, CA, USA). After the LR reaction, the gene cloned under the control of CaMV (cauliflower mosaic virus) 35S promoter was introduced into pK2GW7 to essentially express each gene. Each precise construct was introduced into Agrobacterium strain GV3101 by electroporation. All mutations used in the present invention are based on Col-0, and the floral dip method was used to transform Arabidopsis with the Ca DILZ1 gene (Clough & Bent, Plant Journal 16, 735-743, 1998). Transgenic lines were selected by germination of the estimated mutant seeds on MS medium supplemented with kanamycin 50 μg · mL ^-1 . T3 plant seeds were harvested from a second generation transgenic plant with a 3: 1 dissociation ratio in MS medium containing the same antibiotic.

1-4. ABA, dehydration, and high salt treatment

To analyze the phenotype of CaDILZ1 gene in ABA, NaCl, and dehydrated pepper plants, leaf samples were sprayed with 100 μM ABA on six-leaf-stage red pepper plants, irrigated with salt solution (200 mM) Carefully removed from the soil, then dried in 3MM paper (Whatman, Clifton, UK), or only the top part of the pepper plant was dried. After treatment, the third and fourth leaves were harvested at the specified time.

For dehydration tolerance analysis, 4 weeks of gene silencing or control plants, and 3 weeks of transgenic Arabidopsis and wild type plants were randomly assigned and dry stress was given by stopping the water cycle for 10 and 12 days. After 5 days of rehydration, the survival rate was calculated by counting the number of plants with rehydrated leaves. To quantitatively measure dry tolerance, water loss rates were measured by drying leaves removed from the genetically silenced pepper plants and transgenic Arabidopsis plants. Leaves were placed in a growth chamber with 40% humidity, loss of fresh weight was measured at the indicated time, and all experiments were repeated three times.

For qRT-PCR analysis, 4-week-old 35S :: CaDILZ1 mutants and wild-type plants were isolated from the soil to treat dehydration stress and harvested at the given time after treatment.

1-5. Biological tests of stomatal aperture

For biological assays of pore openings, leaf peel was removed from the rosette leaves of the four-week-old Arabidopsis thaliana plant, and the first round of secondary harvesting was harvested and stomatal opening solution (SOS: 50 mM KCl, 10 mM MES-KOH , pH 6.15, 10 mM CaCl 2). pore occlusion was induced by replacing with SOS containing ABA at various concentrations. after incubation for 2.5 hours, optionally up to 100 pores by Nikon eclipse 80i microscope , And the width and length of each pore were recorded using Image J 1.46r. The experiments were performed independently each three times.

1-6. Thermal imaging

Four-week-old pepper plants with fully grown primary and secondary leaves were treated with 50 μM ABA, and 3-week-old Arabidopsis plants were subjected to drying stress by removing their roots. Thermal images were obtained using an infrared camera (FLIR systems; T420), and plant leaf temperatures were measured using FLIR Tools + ver 5.2 software.

1-7. RNA isolation and qRT-PCR (quantitative reverse transcription-polymerase chain reaction)

Total RNA was isolated from leaves of Arabidopsis and pepper plants subjected to dry stress or ABA treatment and subjected to qRT-PCR.

Total RNA isolation was performed using RNeasy Mini kit (Qiagen, Valencia, CA, USA) and harvested from ABA or dehydrated stressed red pepper and Arabidopsis leaves. All isolated RNA samples were lysed with RNA-free DNase to remove genomic DNA and used as templates for cDNA synthesis using Transcript First Strand cDNA synthesis kit (Roche, Indianapolis, IN, USA). For qRT-PCR analysis, the cDNA synthesized by the above method was amplified using a CFX96 ™ Touch ™ Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA) with iQ ™ SYBR Green Supermix and the specific primers shown in Table 1 below. . All reactions were performed in triplicate and PCR was performed with a 45-cycle program at 95 ° C for 5 minutes, 95 ° C for 20 seconds, 60 ° C for 20 seconds, 72 ° C for 20 seconds. The relative expression level of each gene was calculated by the ΔΔCt method, and the Arabidopsis actin8 ( AtACT8 ) gene and the pepper actin 1 (Ca ACT1 ) gene were used for normalization.

Primer name Primer sequence (5'-3 ') sequence for cloning CaDILZ1 Forward: ATGGCTAGTCAAGGAATAGGAGAGA (CA06g22960) Reverse: TCAGAAATTTGAGAAGTGGTTCTGAG CaDSR1 Forward: ATGACTCGTCCACTTAGGTTTCTAC (ALF95051) Reverse: CTACGCCGGCGGTGTAAC CaDSR1  1-56 Reverse: TACAACGATGAGACCTGAGACGC CaDSR1  57-184 Forward: ATGGCTCGGTGTACTTGGCTC Sequence for RT-PCR CaDILZ1 Forward: ATGGCTAGTCAAGGAATAGGAGAGA Reverse: CTGCTGCTGCTGCATATAAAGATG CaDSR1 Forward: AACCACTAATTCCTCCACTACTTCG Reverse: GGTAAAGTCTTCAAAGCCTTCTTCT CaACT1 Forward: GACGTGACCTAACTGATAACCTGAT (CA12g08730) Reverse: CTCTCAGCACCAATGGTAATAACTT CaNCED3 Forward: TTAAGGATCTTAAGCGTGGTTATGT (CA08g03620) Reverse: AGATTAGTTCAAGAACGTGAATTGG CaRD29B Forward: ATGGAGGCACAACTGCACCGTC (CA03g17780) Reverse: GGCCCACCATGAACTTCTGCAC AtActin8 Forward: CAACTATGTTCTCAGGTATTGCAGA (At1g49240) Reverse: GTCATGGAAACGATGTCTCTTTAGT NCED3 Forward: ACATGGAAATCGGAGTTACAGATAG (At3g14440) Reverse: AGAAACAACAAACAAGAAACAGAGC RAB18 Forward: GGAAGAAGGGAATAACACAAAAGAT (At5g66400) Reverse: GCGTTACAAACCCTCATTATTTTTA RD29B Forward: GTTGAAGAGTCTCCACAATCACTTG (At5g52300) Reverse: ATACAAATCCCCAAACTGAATAACA VIGS XbaI-CaDILZ1 Forward: TCTAGAATGGCTAGTCAAGGAATAGGA XhoI-CaDILZ1 Reverse: CTCGAGCTGTTGGAATCTCATAGGC XbaI-CaDSR1 Forward: TCTAGAATGACTCGTCCACTTAGGTTTC XhoI-CaDSR1 Reverse: CTCGAGGAGTAATTGAATTTGGTAAA

1-8. Measurement of ABA amount

The amount of ABA was harvested 2 hours and 4 hours after dehydration of red pepper and Arabidopsis plants, and about 50 mg of basic tissue was used for ABA extraction. The amount of ABA in each sample was quantified using a Phytodetek-ABA kit (Agdia Inc., Elkhart, IN, USA), and the amount of ABA was expressed as tissue weight (pmol mg ^-1 ).

1-9. Subcellular localization analysis

The GFP-labeled CaDILZ1, CaDSR1, and truncated CaDSR1 were transiently expressed in the N. benthamiana plant through the introduction of the Agrobacterium strain. Agrobacterium strain GV3101 carrying each construct was mixed with the p19 strain at a ratio of 1: 1 (OD600 = 0.5), and a fully grown 5-week-old tobacco ( N. benthamiana ) The plant was infiltrated. On the third day after infiltration, the GFP signal was observed with a confocal microscope (510 UV / Vis Meta; Zeiss, Oberkochen, Germany) equipped with LSM Image Browser software.

1-10. Yeast two-hybrid assay (Y2H)

Y2H analysis was performed in a generally known manner (Lim & Lee, Plant Cell Environ 39, 1559-1575, 2016). The coding sequence of the CaDILZl or CaDSRl gene (base sequence: SEQ ID NO: 3, amino acid sequence: SEQ ID NO: 4) was subcloned into the pGBKT7 or pGADT7 vector and used as a yeast strain using the lithium acetate-regulated transfer method (Ito et al. AH109. Interaction between bait and prey was assessed by selection of transgenic candidates in SC-leucine-tryptophan and SC-adenine-histidine-leucine-tryptophan medium.

1-11. 4 Molecular Fluorescence Complementation (BiFC) Assay

BiFC assays were performed as previously described (Lim & Lee, Plant Cell Environ 39, 1559-1575, 2016). To generate BiFC constructs, CaDILZ1, the full-length DNA of CaDSR1 and the truncated, Pro35S :: VYNE and Pro35S :: CYCE vectors, and gene introduction and microscopic analysis were performed as described above.

1-12. Purification of recombinant proteins and in vitro  ubiquitination assay

GST-labeled CaDILZl and MBP-labeled recombinant CaDSRl and amino acid replacement mutants were expressed in CaDSRl ^C112S protein bacterial cells (Park et al., Plant Cell Physiol 56, 1808-1819, 2015). The DNA sequences coding for the CaDILZl and CaDSR1Δ1-56 proteins were inserted into the GEX4T-3 vector (GE Healthcare Bio-Sciences, Uppsala, Sweden) and the pMAL-c2X vector (New England Biolabs) Respectively. Recombinant GST and MBP-labeled proteins were expressed and purified according to the manufacturer's instructions.

For the in vitro ubiquitination assay, purified MBP-labeled CaDISR1 (500 ng) was incubated with recombinant human UBE1 (Boston Biochemiclas, Cambridge, Mass., USA), his-tagged recombinant Arabidopsis E2s, and sowubiquitin (Sigma-Aldrich) (50 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 0.05 mM ZnCl ₂ , 1 mM Mg-ATP, 0.2 mM DTT, 10 mM phosphocreatine, and 0.1 unit of creatine kinase (Sigma-Aldrich)] and incubated at 30 ° C for 3 hours. To confirm that CaDSR1 regulates ubiquitination of CaDILZl, GST-labeled CaDILZl fusion protein (50 ng) as a substrate was added to the ubiquitin mixture and the mixture was incubated for 2 hours. The reacted proteins were separated by SDS-PAGE and analyzed by immunoblotting with anti-Ub, anti-MBP, and anti-GST antibodies.

1-13. Cell-free degradation assay

The crude protein extract was extracted with 4-week-old pepper plants using extraction buffer [25 mM Tris-HCl (pH 7.5), 10 mM MgCl ₂ , 5 mM dithiothreitol, 0.1% Triton X-100, 10 mM ATP, and 10 mM NaCl] It was prepared from leaves. The GST-labeled CaDILZ1 fusion protein (500 ng) was incubated with the original protein extract (50 μg total protein) for 1 hour and 3 hours, and at the same time incubated for 3 hours in the presence of 50 μM of MG132. Proteolysis was measured by immunoblotting using anti-GST and anti-Ub antibodies.

1-14. Statistical analysis

Statistical analysis was performed using student's t-test or ANOVA (Fisher's LSD test) to determine significant differences between genotypes. P value was less than 0.05.

Example 2. ABA, Dry, and High Salt Induced BZIP Transcription Factor Ca DILZ1  Warrior

In order to isolate new dry-induced red pepper transcription factors, RNA-seq analysis was performed using dry stressed pepper leaves and candidate factors for bZIP transcription induced by dry stress were isolated, and domain analysis and amino acid sequence Based on the results (Figures 1 and 2), the gene was named Ca DILZ1 gene. Ca DILZ1 contains 5029 amino acids including 1509 bp, including a basic region leucine zipper (BRLZ) and a delay of germination 1 (DOGl) domain that can specifically bind to the promoter region and activate the target gene (Fig. 1A). The BRLZ domain consists of 80 amino acids and is located in the central region of CaDILZ1, which is a strong feature of several plant proteins. In addition, the DOG1 domain consists of 78 amino acids and functions as a seed dormant.

To confirm that CaDILZl is constitutively expressed in red pepper tissues such as leaves, stems, roots and flowers, RT-PCR analysis was performed (Fig. 1C). CaDILZ1 was expressed in leaves, roots and flower tissues. Especially CaDILZ1 expression was highly correlated in beak tissues. In addition, in order to determine whether CaDILZ1 is induced by abiotic stress, the expression level of CaDILZ1 was analyzed in ABA, dried and high salt treated pepper leaves. ABA, a plant hormone, is already known to be a protective hormone associated with environmental stress and signaling pathways in plants. In ABA-treated pepper plants, CaDILZl transcription increased within 2 to 24 hours after treatment. The dry treatment induced a strong CaDILZ1 gene at 2 hours after inoculation and had a weak and gradual decrease in expression. According to the high salt treatment, the CaDILZ1 transcription started to accumulate at 2 hours after treatment and reached its maximum at 12 hours. As shown in Fig. 2, CaDILZ1 showed a nuclear transfer signal in the middle region, and CaDILZ1 can be expected to be located in the nucleus. To confirm the intracellular transfer of the CaDILZl protein, the full-length coding region of the CaDILZl cDNA was fused under the 35S promoter (Fig. 1e). The GFP signal of the 35S: CaDILZ1-GFP fusion protein appears to be in the nucleus within the tobacco epidermal cell, and CaDILZl appears to play a role in the nucleus.

Example 3. Ca DILZ1 Reduced dry resistance in gene silenced pepper plants

The transcription of CaDILZ1 is induced by abiotic stress. To investigate the in vivo function of CaDILZ1, VIGS analysis was used. The CaDILZ1 gene silenced pepper plants using RT-PCR analysis showed a decrease in CaDILZ1 mRNA level (Fig. 2A). ABA is induced and accumulated in leaf tissues that respond to dry stress resulting in pore closure by regulating cervical cell pressure. To determine the role of CaDILZ1 in the ABA signal, leaf temperature was monitored. The leaf temperature was measured by treating or not treating ABA as an indirect suggestion of pore opening. When ABA was not treated, the leaf temperature did not show any significant difference between the two plants. ABA treatment reduces the evaporative cooling, which increases leaf temperature. However, the average leaf temperature was lower in CaDILZ1 silenced plants than in CaDILZ1 silent plants. These increases and decreases in the vaporization cooling were controlled by pore opening and thus pore openings were observed in plants in which CaDILZ1 was not silenced and plants in which CaDILZ1 was silenced (FIGS. 3C and 3D). Leaf temperature data and pore size showed no difference between the two plants when ABA was not treated. However, when ABA was treated, the pore opening of CaDILZ1 silked pepper leaves was larger than that of silent plants.

Next, the biological function of CaDILZ1 against the dry stress was confirmed, and the result is shown in FIG. 3f. Under sufficient hydration or moisture deficiency conditions, CaDILZl did not observe the capsular difference between silent red pepper plants and non-silenced plants (left and center panel in Figure 3f). However, CaDILZl-silenced pepper plants under moisturizing conditions showed a more pronounced phenotype than the non-silenced plants (Fig. 3f, right panel). In addition, the survival rate of the two plants after rehydration was observed on the second day (FIG. 3g). Only 33.3% of the CaDILZ1-silenced pepper plants survived, but 88.9% did. The pepper plants silenced by CaDILZ1 were found to be sensitive to ABA and dry stress, and the leaf weight loss was observed for 8 hours after the leaf was removed. As a result, the loss of moisture in CaDILZ1 silenced pepper plants at 8 hours was 35 %, And 23% in non - silenced plants. Therefore, CaDILZ1 changes the ABA sensitivity, and it can be seen that moisture loss and stress phenotype increase with dry stress.

Example  4. In Arabidopsis plants Ca DILZ1 Identification of increased resistance to dryness by gene overexpression

To analyze the in vivo function of CaDILZ1 in response to the drying stress, CaDILZ1 gene overexpressing (CaDILZ1-OX) transgenic Arabidopsis thaliana was prepared. Semi-quantitative RT-PCR analysis was detected only in T3 homozygous transgenic plants in which the expression of CaDILZ1 was independent (Fig. 4b) and the transgenic plants used for phenotypic analysis in response to dry stress.

To induce dehydration stress, the roots of wild-type and CaDILZl-overexpressed plants were removed and the leaf temperature was measured (Fig. 5a, b). After dehydration, no difference in leaf temperature between the plants was detected (Fig. Similar to ABA treatment, leaf temperature did not increase in both wild-type and transgenic plants before dehydration (Fig. 5A). However, after dewatering, the CaDILZl-overexpressed plants (24.5 ° C) showed significantly higher leaf temperatures compared to wild-type plants (23.8 ° C) (Figure 5b). Thereafter, pore openings after treatment with or without ABA acting as pore closure (Fig. 5c), no noticeable differences in pore openings between CaDILZl overexpressed and wild-type plants were found before ABA treatment However, after ABA treatment, pore size decreased in CaDILZ1 overexpressed and wild type plants, and overexpressed plants showed smaller pore size than wild type plants. The results show that CaDILZl plays a major role in ABA-regulating action in pore opening and closing. The pore opening mainly regulates the rate of evaporation, and previous studies have been performed by measuring the water loss of the condensation leading to ABA sensitivity and dry tolerance. To determine whether the decrease in pore opening in the CaDILZl overexpressed plants was caused by the slow rate of evaporation, the loss of water by dehydration after dehydration of the rosette leaves was measured (Fig. 5d). The loss of fresh weight of the leaves showing water loss by the action of vaporization was lower in CaDILZ1 overexpressing plants than in wild type plants.

In other words, the rate of slower rate of uptake in CaDILZ1 overexpressing plants is due to ABA-induced pore closure. CaDILZl is induced by a dry treatment (Fig. 1d) and the CaDILZl silent pepper plants exhibit a dry-sensitive phenotype (Fig. 3). (Fig. 5E). Under the general condition, CaDILZ1 overexpressed plants did not show a changed phenotype (Fig. 5E, left panel), and dry conditions (Fig. 5E, middle panel) And in the rehydration conditions (Fig. 5E, right panel), CaDILZl overexpressing plants exhibit a less pronounced phenotype than the wild type. In addition, survival rates of CaDILZ1 line # 1 and # 2 were 81.3% and 93.7% at 5 days after rehydration, while survival rate of wild type plants was only 25.0%. That is, improved dry tolerance of CaDILZl transgenic plants is derived from ABA hypersensitivity.

Example 5. Confirmation of interactions between CaDIZL1 and CaDSRl in the pepper Ring finger E3 ligase

To identify CaDILZ1 interacting with CaDILZ1 degradation protein, Y2H screening was performed using CaDILZ1 protein as a bait and prey as a cDNA library prepared from dehydrated pepper leaves. Analysis of the partners interacting with CaDILZ1 (Fig. 6) revealed CaDSR1 (Capsicum annuum Drought Sensitive RING finger protein 1), one of the ring type E3 ligases. To confirm if CaDSRl interacts with CaDILZl, one-by-one Y2H analysis was performed (Fig. 6b) and bimolecular fluorescence complementarity analysis was performed (Fig. 6c). Coexpression of CaDSR1-CYCE and CaDILZ1-VYNE resulted in pronounced yellow fluorescence in the nucleus. The base sequence of CaDSR1 is SEQ ID NO: 3, and the amino acid sequence is SEQ ID NO: 4.

In Fig. 7, the interaction of CaDILZ1 and CaDSR1 in the nucleus was confirmed using the BiFC assay. VYNE :: CaDILZ1 was coexpressed with CYCE :: CaDSR1C112S, CYCE :: CaDSR1 1-56, and CYCE :: CaDSR1 57-184 in leaves of tobacco plants using agroinfiltration, and CYCE :: empty as a control Respectively. For nuclear localization, the cells were stained with 4 ', 6-diamidino-2-phenylindole (DAPI) and the yellow fluorescent signal indicates the interaction between the partner proteins (white bar = 20 μm).

That is, it was confirmed that CaDILZ1 interacted with CaDSR1 (Capsicum annuum Drought Sensitive RING finger protein 1), which is a protein that affects degradation.

Example 6. Identification of CaDSR1 function in the ubiquitination of E3 ligase activity and CaDILZ1

In vivo ubiquitination analysis was carried out using purified CaDSR1-MBP fusion protein to confirm that CaDSR1 functions as an E3 ligase, since the proteins including the ring finger domain have E3 ubiquitin ligase activity. In addition, a mutant fusion protein (mCaDSR1-MBP) with point mutation of the major residue Cystein to Serine in the RING domain was prepared. These fusion proteins were UBE1 (E1), UBCH5b (E2) and ubiquitin, respectively, cultured. The reaction mixture was analyzed by immunoblot analysis using anti-MBP and anti-ubiquitin antibodies (FIG. 8A). The formation of the polymer smearing band was confirmed in lanes of CaDSR1-MBP but not in mCaDSR1-MBP, so CaDSR1 is able to function as E3 ubiquitin ligase, and the RING domain is essential for ligase activity to be.

The interaction between CaDILZ1 and CaDSR1 indicates that CaDSR1 is a substrate for CaDILZ1, and CaDSR1 is able to act as an E3 ligase using CaDILZ1 as a substrate. Glutathione S-transferase-tagged CaDILZl (GST-CaDILZl) was expressed in E. coli and used for ubiquitination analysis (Fig. 8b). As a result, CaDILZ1 was found to be polyubiquitinated by CaDSR1 in the presence of UBE1 (E1) and UBCH5b (E2), indicating that CaDSR1 is an upper signal of CaDILZ1.

In the present invention, it was confirmed that the new pepper bZIP transcription factor CaDILZl acts as a positive regulator in the dry stress response. In addition, CaDSR1 directly ubiquitinates CaDILZ1 and subsequently leads to protein degradation of CaDILZ1. In addition, CaDILZ1 silenced pepper plants exhibit a dry-sensitive phenotype with lower ABA levels, whereas overexpressed plants can accumulate higher amounts of ABA associated with the dry tolerance phenotype. On the other hand, the CaDSR1 mutation showed the opposite phenotype for the CaDILZ1 mutation. In addition, CaDSR1 can ubiquitinate CaDILZ1 when using in vitro ubiquitination assays.

In addition, it is known that the expression level of ABA-dependent stress related to the stress-related gene is related to the dry stress tolerance, and the present invention can confirm the change of the stress-related gene including the NCED3 gene. Under water-poor conditions, NCED3 functions predominantly in ABA biosynthesis, which plays an important role in adapting to plant dry stress. Abiotic stress conditions, such as drying and high salinity, increase the cellular level of ABA levels through the induction of ABA biosynthetic genes, including NCEDs. Upregulation of NCED3 gene expression and ABA levels in CaDILZl overexpressing plants induces ABA and contributes to dry tolerance.

That is, the function of CaDILZ1 is thought to be related to the expression by two mechanisms by induction of ABA and amplification of ABA signal. The results of the present invention provide a valuable insight into the defensive response acting during the dry stress signal and may enable selective adaptation to the drying stress. That is, the present invention can suggest a new method of controlling the dry stress response by CaDILZ1 in plants.

It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit or scope of the invention. There will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> Method for improving the resistance to the drought stress using          pepper transcription factor CaDILZ1 in plants <130> MP16-450 <160> 4 <170> KoPatentin 3.0 <210> 1 <211> 1509 <212> DNA <213> Capsicum annuum Drought-Induced Leucine Zipper 1_CaDILZ1 <400> 1 atggctagtc aaggaatagg agagactggt ttgacagact ctggaccatc atcacattca 60 caccataacc acaatatgcc atatgctgtt tataggggga taaatcctgc tagcacaagt 120 ttcattaatc aagaaagttc tggttttgat tttggagagc tagaagaagc ttttgtacta 180 caaggattta agattagtaa tgatgaagct aaagcatctt tatatgcagc agcagcagcc 240 acagggaaac ctgctgcaac tctggagatg ttcccttctt ggcctatgag attccaacag 300 accccaagag agaagtcaaa atcaagagaa gagagtactg attctggttc actttcaagt 360 agagttcaac cccatttaga gccagaatca cccatcagta gaaaggcatc ttcagaccat 420 caacaaaatc aacttcacat aacacacaaa tctcaagaac agcaacagca actccaaaat 480 atggcaagta ataatccaag aacaggaggt ttacaaactg aactagcagc ttccaaatcc 540 aacagtgaaa agaaaaaggg tgctgcttca acttcagaga gggtacttga tccaaagaca 600 ttgagacgtt tagctcaaaa tagagaagca gcaaagaaaa gcaggataag aaaaaaagct 660 tatgtacaac agcttgaaac aagtaggatg agactttctc agctagaaca agaacttcaa 720 agggctagct ctcaggggat tttcttggga ggtggtacta ctgctggttc caatatcagc 780 tcaggtgctg caatatttga catggaatat tcaaggtggt tggatgatga tcaaaggcac 840 atgtccgaac ttcgaactgc attacaagca catttatcag atggtgatct tagactaata 900 gttgatggat acattgctca ttacgacgaa attttctgcc tgaaaggagt ggcagcaaaa 960 tctgatgtat ttcatttaat tactggaatg tggacaactc cagctgaacg ttgcttcctt 1020 tggatgggtg gttttaggcc ttctgagctg atcaagatgt tgataggaca attggaccct 1080 ttaacagagc aacaagtagt tggaatatac agcctccagc aatcttctca acaggcagag 1140 gatgcacttt cacagggatt ggaacaacta caacaatctt taattgatac tattgccact 1200 gcttctctac atgatggcat gcatcatatg gctcttgctt taggcaagct ctccaatctt 1260 gaaggatttg ttcgtcaggc tgataatttg agacaacaaa cattgcatca gttacacaga 1320 atattgacag ttaggcaagc agccagatgt ttcttggtga ttggagaata ctatggtcga 1380 ctacgagctc taagttctct atggttatct cgtccacgag agacattgat cgtggatgat 1440 aattcatgtc aaacaataac ggggttacaa atggtacaat cttctcagaa ccacttctca 1500 aatttctga 1509 <210> 2 <211> 502 <212> PRT <213> Capsicum annuum Drought-Induced Leucine Zipper 1_CaDILZ1 <400> 2 Met Ala Ser Gln Gly Ile Gly Glu Thr Gly Leu Thr Asp Ser Gly Pro   1 5 10 15 Ser Ser His Ser His His Asn His Asn Met Pro Tyr Ala Val Tyr Arg              20 25 30 Gly Ile Asn Pro Ala Ser Thr Ser Phe Ile Asn Gln Glu Ser Ser Gly          35 40 45 Phe Asp Phe Gly Glu Leu Glu Glu Ala Phe Val Leu Gln Gly Phe Lys      50 55 60 Ile Ser Asn Asp Glu Ala Ala  65 70 75 80 Thr Gly Lys Pro Ala Ala Thr Leu Glu Met Phe Pro Ser Trp Pro Met                  85 90 95 Arg Phe Gln Gln Thr Pro Arg Glu Lys Ser Lys Ser Arg Glu Glu Ser             100 105 110 Thr Asp Ser Gly Ser Leu Ser Ser Arg Val Gln Pro His Leu Glu Pro         115 120 125 Glu Ser Pro Ile Ser Arg Lys Ala Ser Ser Asp His Gln Gln Asn Gln     130 135 140 Leu His Ile Thr His Lys Ser Gln Glu Gln Gln Gln Gln Leu Gln Asn 145 150 155 160 Met Ala Ser Asn Asn Pro Arg Thr Gly Gly Leu Gln Thr Glu Leu Ala                 165 170 175 Ala Ser Lys Ser Asn Ser Glu Lys Lys Lys Gly Ala Ala Ser Thr Ser             180 185 190 Glu Arg Val Leu Asp Pro Lys Thr Leu Arg Arg Leu Ala Gln Asn Arg         195 200 205 Glu Ala Ala Lys Lys Ser Arg Ile Arg Lys Lys Ala Tyr Val Gln Gln     210 215 220 Leu Glu Thr Ser Arg Met Arg Leu Ser Gln Leu Glu Gln Glu Leu Gln 225 230 235 240 Arg Ala Ser Ser Gln Gly Ile Phe Leu Gly Gly Gly Thr Thr Ala Gly                 245 250 255 Ser Asn Ile Ser Ser Gly Ala Ala Ile Phe Asp Met Glu Tyr Ser Arg             260 265 270 Trp Leu Asp Asp Asp Gln Arg His Met Ser Glu Leu Arg Thr Ala Leu         275 280 285 Gln Ala His Leu Ser Asp Gly Asp Leu Arg Leu Ile Val Asp Gly Tyr     290 295 300 Ile Ala His Tyr Asp Glu Ile Phe Cys Leu Lys Gly Val Ala Ala Lys 305 310 315 320 Ser Asp Val Phe His Leu Ile Thr Gly Met Trp Thr Thr Pro Ala Glu                 325 330 335 Arg Cys Phe Leu Trp Met Gly Gly Phe Arg Pro Ser Glu Leu Ile Lys             340 345 350 Met Leu Ile Gly Gln Leu Asp Pro Leu Thr Glu Gln Gln Val Val Gly         355 360 365 Ile Tyr Ser Leu Gln Gln Ser Ser Gln Gln Ala Glu Asp Ala Leu Ser     370 375 380 Gln Gly Leu Glu Gln Leu Gln Gln Ser Leu Ile Asp Thr Ile Ala Thr 385 390 395 400 Ala Ser Leu His Asp Gly Met His His Met Ala Leu Ala Leu Gly Lys                 405 410 415 Leu Ser Asn Leu Glu Gly Phe Val Arg Gln Ala Asp Asn Leu Arg Gln             420 425 430 Gln Thr Leu His Gln Leu His Arg Ile Leu Thr Val Arg Gln Ala Ala         435 440 445 Arg Cys Phe Leu Val Ile Gly Glu Tyr Tyr Gly Arg Leu Arg Ala Leu     450 455 460 Ser Ser Leu Trp Leu Ser Arg Pro Glu Thr Leu Ile Val Asp Asp 465 470 475 480 Asn Ser Cys Gln Thr Ile Thr Gly Leu Gln Met Val Gln Ser Ser Gln                 485 490 495 Asn His Phe Ser Asn Phe             500 <210> 3 <211> 555 <212> DNA <213> Capsicum annuum Drought Sensitive RING finger protein 1_CaDSR1 <400> 3 atgactcgtc cacttaggtt tctactaacc actaattcct ccactacctc gccgccgtcg 60 atggcaacgg cggagccacc gtcagtcgcg gcagcagaat ccgacttcgt cgtcattctc 120 tcggtgtag tggctccggc gagactcgcc ggaaaatgca cagccgccgg taaaaatcaa aggcttaaag 240 aagaaggctt tgaagacttt accaaaattc aattactctc ccggcaccgg tggtaccgac 300 ggcgacggtg acggtgacgg cgagtgtgca atttgtcttg tggaatatgt tgaaggagat 360 gaaattcgag tgttgccaaa ttgtggccat cggttccacg tattgtgtgt cgacacgtgg 420 cttttatcga actcgtcatg tccgtcgtgt cgacggacac tcgtcgttgc tcgtgctcgg 480 tgccggaagt gcggcgaagt tccggcaatc tccggcgagt cttctgacgg atgtccggtt 540 acaccgccgg cgtag 555 <210> 4 <211> 184 <212> PRT <213> Capsicum annuum Drought Sensitive RING finger protein 1_CaDSR1 <400> 4 Met Thr Arg Pro Leu Arg Phe Leu Leu Thr Thr Asn Ser Ser Thr Thr   1 5 10 15 Ser Pro Pro Ser Met Ala Thr Ala Glu Pro Pro Ser Val Ala Ala Ala              20 25 30 Glu Ser Asp Phe Val Ile Leu Ala Ala Leu Leu Cys Ala Val Ile          35 40 45 Cys Val Ser Gly Leu Ile Val Val Ala Arg Cys Thr Trp Leu Arg Arg      50 55 60 Asp Ser Pro Glu Asn Ala Gln Pro Pro Val Lys Ile Lys Gly Leu Lys  65 70 75 80 Lys Lys Ala Leu Lys Thr Leu Pro Lys Phe Asn Tyr Ser Pro Gly Thr                  85 90 95 Gly Gly Thr Asp Gly Asp Gly Asp Gly Asp Gly GIy Cys Ala Ile Cys             100 105 110 Leu Val Glu Tyr Val Glu Gly Asp Glu Ile Arg Val Leu Pro Asn Cys         115 120 125 Gly His Arg Phe His Val Leu Cys Val Asp Thr Trp Leu Leu Ser Asn     130 135 140 Ser Ser Cys Pro Ser Cys Arg Arg Thr Leu Val Val Ala Arg Ala Arg 145 150 155 160 Cys Arg Lys Cys Gly Glu Val Pro Ala Ile Ser Gly Glu Ser Ser Asp                 165 170 175 Gly Cys Pro Val Thr Pro Pro Ala             180

Claims (5)

1. A composition for promoting dry resistance of a plant, comprising a gene encoding CaDILZ1 ( Capsicum annuum Drought-Induced Leucine Zipper 1) comprising the nucleotide sequence of SEQ ID NO: 1 as an active ingredient, encoding a protein that promotes resistance to dry stress.
A composition for enhancing the dry stress resistance of a plant comprising CaDILZ1 ( Capsicum annuum Drought-Induced Leucine Zipper 1) protein consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient.
A method for enhancing dry stress resistance of a plant comprising the steps of:
(a) CaDILZl ( Capsicum annuum Transforming a gene of SEQ ID NO: 1 encoding a Drought-Induced Leucine Zipper 1) protein into a plant; And
(b) overexpressing the CaDILZl protein in the transformed plant.
The method of claim 3,
Wherein the CaDILZl protein comprises the amino acid sequence of SEQ ID NO: 2.
A transgenic plant having increased dry stress resistance by the method of claim 3.

Images