KR20220170516A - Method for improving the resistance to the drought stress using pepper protein kinase CaGRAS1 in plants - Google Patents

Abstract

The present invention relates to a transcription factor CaGRAS1 gene derived from Korean dark green pepper species, a protein composed of amino acids encoded by the gene, and a method for improving dry stress resistance in plants using the gene or protein. The CaGRAS1 protein functions as a positive regulator of ABA signaling, and the effect of improving drought stress resistance was confirmed in transgenic plants overexpressing the protein. By controlling the expression of the CaGRAS1 gene, the CaGRAS1 protein can be used to improve crops which can be used by humans. In particular, it is expected that the CaGRAS1 protein is useful in improving plant productivity.

Description

CaGRAS1 gene and method for improving dry stress resistance of plants using the same {Method for improving the resistance to the drought stress using pepper protein kinase CaGRAS1 in plants}

The present invention relates to a transcription factor CaGRAS1 ( Capsicum annuum GRAS1) gene derived from a red pepper cultivar, a protein composed of amino acids encoded by the gene, and a method for enhancing plant drying stress resistance using the gene or protein.

Global warming causes extreme climate change to induce environmental stress that inhibits the normal growth and development of plants. In response, plants have evolved sophisticated defense mechanisms to survive in adverse environments such as cold, high salinity, and drought. For example, drought is caused by a water shortage environment and seriously affects the normal growth of plants, eventually resulting in a decrease in crop yield. It activates various defense mechanisms such as the synthesis and accumulation of ABA).

ABA is known to be a regulatory factor for protecting plants against abiotic stress, particularly dry stress, and plays a very important role in plant growth and development. Reportedly, plants treated with ABA in advance and subjected to stress are more resistant to stress than plants that are not, whereas mutant plants that do not produce ABA or do not respond to ABA are known to be weak against stress. Therefore, it is expected that plants with improved resistance to environmental stress can be developed by using proteins involved in the response of ABA.

ABA signals are known to regulate the expression of various stress-related genes, such as transcription factors and E3 ligase, which are involved in osmotic adaptation and regulation of root hydraulic conductivity, but the complete ABA signaling pathway has not yet been identified. It didn't work. Initiation of ABA signaling in plant cells requires the presence of ABA receptors and transmission of signals to downstream proteins. Until now, it has been known that PYR/PYL/RCARs as ABA receptors play a role in recognizing ABA. When the receptor recognizes ABA, it promotes the expression of specific genes and the activation of ion channels through phosphorylation of target proteins, which enables plants to adapt to unfavorable environments.

As desertification progresses today, water shortage is causing major problems in agriculture and the environment, and it is necessary to develop plants that can survive and live in a dry environment even with low water consumption. If this technology is developed and applied to crops, it is expected that agricultural production will greatly increase. Especially in arid regions, plants with improved drying resistance, that is, plants that can lower transpiration, will have an advantage in survival, contributing to the improvement of agricultural productivity. It can also be useful for environmental cleanup in areas where the environment is very dry.

Therefore, a method for enhancing the resistance of plants to dry stress has become a major research subject, and in this regard, studies on genes related to dry stress tolerance and growth promotion and transgenic plants are being conducted, but the situation is still incomplete. .

Korean Registered Patent Publication No. 10-2090653 (2020.03.12)

The present inventors identified CaGRAS1 corresponding to the GRAS domain in pepper while studying the relationship between the drying stress response through the regulation of the ABA signaling pathway, and the protein regulates ABA-mediated stomatal closure, thereby The present invention was completed by identifying the function as a positive regulator that enhances the drying stress resistance of plants.

Accordingly, an object of the present invention is to provide a drying stress resistant CaGRAS1 ( Capsicum annuum GRAS1) protein consisting of the amino acid sequence of SEQ ID NO: 1, which is a positive regulator for drying stress.

Another object of the present invention is to provide a CaGRAS1 gene encoding the CaGRAS1 protein.

Another object of the present invention is to provide a recombinant vector containing the CaGRAS1 gene.

Another object of the present invention is to provide a plant transformed with the recombinant vector.

Another object of the present invention is to provide a composition for enhancing the drying stress resistance of plants, comprising at least one selected from the group consisting of the CaGRAS1 protein, the CaGRAS1 gene encoding the same, and a recombinant vector containing the gene as an active ingredient. .

Another object of the present invention is to provide a method for enhancing the drying stress resistance of plants by transforming and overexpressing the CaGRAS1 gene in plants.

Another object of the present invention is to provide a transgenic plant with enhanced drying stress resistance by the above method.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned can be clearly understood by those skilled in the art from the description below. There will be.

In order to achieve the object of the present invention as described above, the present invention provides a drying stress resistant CaGRAS1 ( Capsicum annuum GRAS1) protein consisting of the amino acid sequence of SEQ ID NO: 1, which is a positive regulator for drying stress.

In addition, the present invention provides a CaGRAS1 gene encoding the CaGRAS1 protein.

In one embodiment of the present invention, the CaGRAS1 gene may consist of the nucleotide sequence of SEQ ID NO: 2, but is not limited thereto.

In another embodiment of the present invention, the CaGRAS1 gene may be isolated from pepper, but is not limited thereto.

In addition, the present invention provides a recombinant vector containing the CaGRAS1 gene.

In one embodiment of the present invention, the recombinant vector may be used to improve dry stress resistance of plants, but is not limited thereto.

In addition, the present invention provides a plant transformed with the recombinant vector.

In addition, the present invention provides a composition for enhancing the drying stress resistance of a plant comprising, as an active ingredient, at least one selected from the group consisting of the protein, the CaGRAS1 gene encoding the same, and a recombinant vector containing the gene.

In addition, the present invention provides a method for enhancing dry stress resistance of a plant, comprising the following steps.

(a) transforming a gene encoding a CaGRAS1 ( Capsicum annuum GRAS1) protein into a plant; and

(b) overexpressing the CaGRAS1 protein in the transformed plant.

In addition, the present invention provides a transgenic plant with enhanced drying stress resistance by the above method.

In addition, the present invention provides a use of a composition comprising, as an active ingredient, at least one selected from the group consisting of the protein, the CaGRAS1 gene encoding the same, and a recombinant vector containing the gene, to enhance the drying stress resistance of plants.

In addition, the present invention relates to the drying stress resistance of plants comprising the step of administering to the plant a composition comprising at least one selected from the group consisting of the protein, the CaGRAS1 gene encoding the same, and a recombinant vector containing the gene as an active ingredient. Provides a method of enhancement.

The present invention identified CaGRAS1 corresponding to the GRAS domain of pepper, and the CaGRAS1 protein functions as a positive regulator of ABA signaling and confirmed the drying stress resistance enhancing effect in transgenic plants overexpressing the protein. Expression of the CaGRAS1 gene Through control, it can be used to improve crops that can be used by mankind, and it is expected to be usefully used to improve plant productivity in particular.

Figure 1a shows the results of analyzing the phylogenetic tree of CaGRAS1 protein, BLAST search was performed using the estimated amino acid sequence of CaGRAS1, and the most similar sequences in each plant species were collected. A phylogenetic tree was generated using MEGA software (version 10.1.1).
Figure 1b shows the results of homology analysis of CaGRAS1 protein, Solanum pennellii (accession no. XP_015080715.1), Nicotiana tabacum (accession no. XP_016463344.1), Camellia sinensis (accession no. XP_028126203.1), Coffea eugenioides ( It shows the results of amino acid sequence analysis with accession no. XP_027171108.1), Gossypium arboreum (accession no. XP_017639076.1), and Arabidopsis thaliana (accession no. NP_001332482.1). Identical amino acid residues are highlighted in black, and the red box underlined indicates the GRAS domain.
Figure 2a shows the expression pattern of CaGRAS1 in pepper leaves after treatment with ABA, drought, H ₂ O ₂ , NaCl. CaACT1 gene was used as a control.
Figure 2b shows the intracellular localization of the CaGRAS1-GFP fusion protein in tobacco ( Nicotiana benthamiana ) epidermal cells.
Figure 2c shows the results of transactivation of GAL4-responsive promoters by CaGRAS1 in full-length and truncated forms fused to the GAL4 DNA binding domain in yeast strain AH109. SC-LW:SC-leucine-tryptophan, SC-AHLW:SC-adenine-histidine-leucine-tryptophan, BD:DNA binding domain.
Figure 3a shows the results of confirming the expression of the CaGRAS1 gene in the leaves of TRV2: CaGRAS1 and TRV2:00 pepper plants by RT-PCR analysis. The CaACT1 gene was used as an internal control.
Figure 3b shows the results of confirming the sensitivity to drought of TRV2: CaGRAS1 and TRV2:00 pepper plants.
Figure 3c shows the results of transpirational water loss of TRV2: CaGRAS1 and TRV2:00 at various time points after leaf separation.
Figure 3d shows the results of measuring stomatal opening according to ABA treatment in TRV2: CaGRAS1 and TRV2:00 pepper plants.
Figure 3e confirms the change in pore size (width/height) according to ABA treatment in TRV2: CaGRAS1 and TRV2:00 pepper plants.
Figure 3f shows the results of measuring leaf temperature according to ABA treatment in TRV2: CaGRAS1 and TRV2:00 pepper plants.
Figure 3g shows leaf temperature according to ABA treatment in TRV2: CaGRAS1 and TRV2:00 pepper plants.
Figure 3h shows the result of comparative analysis of the expression levels of stress response genes CaLOX1, CaOSM1, and CaADIP1 according to ABA treatment in TRV2: CaGRAS1 and TRV2:00 pepper plants by qRT-PCR.
Figure 4 shows the results of confirming CaGRAS1 expression in wild-type (WT) and CaGRAS1 -OX transgenic Arabidopsis plants by RT-PCR analysis.
Figure 5a shows the germination rates of CaGRAS1 -OX transgenic (#2 and #3) and wild-type (WT) plants in 0.5X MS medium supplemented with various concentrations of ABA.
Figure 5b shows the germination rates of CaGRAS1- OX transgenic (#2 and #3) and wild-type (WT) plants in 0.5X MS medium supplemented with various concentrations of ABA.
Figure 5c shows the rate of cotyledon greening of CaGRAS1 -OX transgenic (#2 and #3) and wild type (WT) plants exposed to ABA.
Figure 5d shows the degree of root elongation of CaGRAS1 -OX transgenic (#2 and #3) and wild-type (WT) plants exposed to ABA.
Figure 5e shows the degree of root elongation of CaGRAS1 -OX transgenic (#2 and #3) and wild-type (WT) plants exposed to ABA.
Figure 6a shows the drought susceptibility of CaGRAS1 -OX transgenic (#2 and #3) and wild type (WT) plants.
Figure 6b shows the survival rates of CaGRAS1 -OX transgenic (#2 and #3) and wild-type (WT) plants against drying stress.
Figure 6c shows the results of transpirational water loss in response to drying stress in CaGRAS1- OX transgenic (#2 and #3) and wild-type (WT) plants.
Figure 6d shows the results of measuring leaf temperature for ABA treatment of CaGRAS1- OX transgenic (#2 and #3) and wild-type (WT) plants.
Figure 6e shows the results of measuring stomatal opening in CaGRAS1- OX transgenic (#2 and #3) and wild-type (WT) plants treated with ABA.
Figure 6f confirms the change in stomatal size (width/height) of CaGRAS1- OX transgenic (#2 and #3) and wild-type (WT) plants with ABA treatment.

The present inventors identified the GRAS domain CaGRAS1 in pepper, and found that the protein functions as a positive regulator that enhances the drying stress resistance of plants by regulating ABA-mediated stomatal closure, thereby completing the present invention.

Accordingly, the present invention provides a drying stress resistant CaGRAS1 ( Capsicum annuum GRAS1) protein consisting of the amino acid sequence of SEQ ID NO: 1, which is a positive regulator for drying stress of the present invention, and a gene encoding the same.

CaGRAS1 , the gene of the present invention, preferably consists of the nucleotide sequence of SEQ ID NO: 2, and the peptide encoded by the CaGRAS1 gene may preferably consist of the amino acid sequence of SEQ ID NO: 1, but is not limited thereto.

The gene of the present invention, CaGRAS1 , may be isolated from red pepper, but is not limited thereto.

As used herein, "positive regulator protein" means a protein that acts in an increasing direction in regulating life phenomena. That is, when CaGRAS1 , the gene of the present invention, is overexpressed, ABA sensitivity may be increased and resistance to drying stress may be increased.

In one experimental example of the present invention, the CaGRAS1 gene was isolated and identified from pepper, and homology between the CaGRAS1 protein and GRAS proteins of other species was analyzed (see Experimental Example 1).

In another experimental example of the present invention, by measuring leaf temperature, stomatal opening, water loss, survival rate, etc. in the leaves of CaGRAS1-silenced pepper plants and normal control pepper plants under drought stress and ABA-treated conditions, CaGRAS1 gene silencing The effect of reducing ABA sensitivity was confirmed, and in fact, it was confirmed that drying stress resistance was reduced in plants in which CaGRAS1 expression was inhibited compared to the control group (see Experimental Example 3).

In another embodiment of the present invention, transgenic Arabidopsis plants overexpressing CaGRAS1 were prepared, and the germination rate, green cotyledonization, root growth rate measurement, stress response gene of wild-type plants and CaGRAS1 overexpressing plants under conditions of drought stress and ABA treatment Through expression, etc., it was confirmed that CaGRAS1 acts as a positive regulator that enhances the drying stress resistance of plants. In fact, overexpression of the CaGRAS1 gene in Arabidopsis plants increased drying resistance through measurement of leaf temperature, stomatal opening, and water loss. (See Experimental Examples 4 to 5).

As another aspect of the present invention, a recombinant vector containing the CaGRAS1 gene is provided.

The term “recombinant” refers to a cell that replicates, expresses a heterologous nucleic acid, or expresses a peptide, a protein encoded by a heterologous peptide, or a heterologous nucleic acid. Recombinant cells can express genes or gene segments not found in the cell's native form, either in sense or antisense form. A recombinant cell may also express a gene found in the cell in its natural state, but the gene has been reintroduced into the cell by artificial means as a modified one.

The term “recombinant expression vector” refers to a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. In general, any plasmid and vector may be used provided that it is capable of replicating and stabilizing in the host. An important characteristic of the expression vector is that it has an origin of replication, a promoter, a marker gene and a translation control element.

An expression vector comprising the gene sequence and suitable transcriptional/translational control signals can be constructed by methods well known to those skilled in the art. The method includes in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombinant technology, and the like. The DNA sequence can be effectively linked to a suitable promoter in an expression vector to direct mRNA synthesis. In addition, the expression vector may include a ribosome binding site and a transcription terminator as a translation initiation site.

A preferred example of the recombinant vector of the present invention is the Ti-plasmid vector, which is capable of transferring a part of itself, the so-called T-region, into plant cells when present in a suitable host such as Agrobacterium tumefaciens. Another type of Ti-plasmid vector (see EP 0 116 718 B1) is currently used to transfer hybrid DNA sequences into plant cells, or protoplasts, from which new plants can be produced that properly integrate the hybrid DNA into the plant's genome. there is. A particularly preferred form of the Ti-plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838. Other suitable vectors that can be used to introduce DNA according to the present invention into plant hosts include viral vectors, such as those that can be derived from double-stranded plant viruses (eg, CaMV) and single-stranded viruses, gemini viruses, and the like. For example, it may be selected from incomplete plant viral vectors. The use of such vectors can be particularly advantageous when properly transforming a plant host is difficult.

Expression vectors may contain one or more selectable markers. The marker is a nucleic acid sequence having a characteristic that can be selected by a conventional chemical method, and includes all genes capable of distinguishing transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotics such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol. There is a resistance gene, but is not limited thereto.

In the recombinant vector of the present invention, the promoter may be a CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter, but is not limited thereto. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in a plant cell. A "constitutive promoter" is a promoter that is active under most environmental conditions and states of development or cell differentiation.

In the recombinant vector of the present invention, common terminators can be used, such as nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens ) of octopine (Octopine) gene terminator, etc., but is not limited thereto. Regarding the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells.

Plant transformation refers to any method of transferring DNA into a plant. Such transformation methods need not necessarily have a period of regeneration and/or tissue culture. Transformation of plant species is now common for plant species including dicotyledonous as well as monocotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA according to the present invention into suitable progenitor cells. Methods include the calcium/polyethylene glycol method for protoplasts (Krens, F.A. et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373), protoplasts of electroporation (Shillito R.D. et al., 1985 Bio/Technol. 3, 1099-1102), microinjection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185 ), particle bombardment of various plant elements (DNA or RNA-coated) (Klein T.M. et al., 1987, Nature 327, 70), Agrobacterium tumefacies by infiltration of plants or transformation of mature pollen or microspores infection by a (incomplete) virus in ens-mediated gene transfer (EP 0 301 316) and the like. Preferred methods according to the present invention include Agrobacterium mediated DNA delivery.

In the present invention, the recombinant vector is a recombinant plant expression vector.

As another aspect of the present invention, a plant transformed with the recombinant vector is provided.

As another aspect of the present invention, there is provided a composition for enhancing drying stress resistance of a plant comprising, as an active ingredient, at least one selected from the group consisting of a CaGRAS1 protein, a CaGRAS1 gene encoding the same, and a recombinant vector containing the gene.

As another aspect of the present invention, the present invention provides a method for enhancing dry stress resistance of plants, comprising the following steps.

(a) transforming a gene encoding a CaGRAS1 ( Capsicum annuum GRAS1) protein into a plant; and

(b) overexpressing the CaGRAS1 protein in the transformed plant.

As another aspect of the present invention, a transgenic plant with improved drying stress resistance is provided by the above method.

In the present invention, the plant (sieve) is a food crop including rice, wheat, barley, corn, soybean, potato, red bean, oat, and sorghum; vegetable crops including Arabidopsis, Chinese cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion, and carrot; Specialty crops including ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut, and rapeseed; fruit trees including apple trees, pear trees, jujube trees, peaches, kiwi trees, grapes, tangerines, persimmons, plums, apricots, and bananas; flowers including roses, gladioluses, gerberas, carnations, chrysanthemums, lilies and tulips; and feed distribution including ryegrass, red clover, orchard grass, alfalfa, tall fescue, and perennial ryegrass, most preferably Arabidopsis or red pepper, but is not limited thereto.

Hereinafter, preferred embodiments and experimental examples are presented to aid understanding of the present invention. However, the following Examples and Experimental Examples are only provided to more easily understand the present invention, and the content of the present invention is not limited by the following Examples and Experimental Examples.

[Example]

Example 1. Plant materials and growth conditions

Seeds of Arabidopsis thaliana (ecotype Col-0) were treated with vernalization at 4 ° C for 2 days, and then treated with 1% sucrose (Biopure, Cambridge, MA, USA) and micro agar. (Duchefa biochemie) MS medium (Murashige and Skoog medium, Duchefa biochemie, Haarlem, The Netherlands) containing 8%. Red pepper (Capsicum annuum L. cv. NocKwang) seeds were germinated in a dark place at 29 °C for 5 days. Tobacco (Nicotiana benthamiana) seeds, Arabidopsis thaliana and pepper seedlings were mixed with steam-sterilized soil [peat moss: perlite: vermiculite = 5:3:2, v/v/v], sand ), and loam soil 1: 1: 1 (v / v / v), at 24 ° C., and grown under white fluorescence (130 μmol photons m-2S-1) under conditions of 60% relative humidity.

Example 2. Yeast two-hybrid assay (Y2H)

For yeast library screening, cDNA fragments (CaGRAS1 protein N1:1-105, N106: 106-211 , GRAS domain:212-582) were inserted into the pGBKT7 vector according to the presence or absence of the GRAS domain of CaGRAS1 (see Fig. 2c). . This construct was introduced and transformed into yeast strain AH109 using the lithium acetate-controlled transfer method. To confirm the interaction between CaGRAS1 and the GAL4 DNA binding domain, the transformants were selected on SC-LW (SC-leucine-tryptophan) and SC-AHLW (SC-adenine-histidine-leucine-tryptophan) media as selection media. did

Example 3. Virus-induced gene silencing (VIGS)

For CaGRAS1 loss-of-function analysis, virus-induced gene silencing (VIGS) was performed in pepper plants. Briefly, as a negative control, Agrobacterium tumefaciens strain GV3101 carrying pTRV2:00 and pTRV2: CaGRAS1 was infiltrated into fully expanded cotyledons of pepper (OD600=0.2 for each strain). The plants were placed in a growth chamber at 24°C with a photoperiod of 16 hours day/8 hours night to allow growth and virus propagation.

Example 4. CaGRAS1 Production of transgenic Arabidopsis thaliana with gene overexpression

To produce CaGRAS1 overexpressed transgenic Arabidopsis plants, the full-length cDNA sequence of CaGRAS1 was cloned into the pENTR/D-TOPO vector (Invitrogen, Carlsbad, CA, USA). Pro35S: CaGRAS1 -GFP construct was generated by LR reaction. Agrobacterium-mediated transformation was used through the floral dip method. To select transformed Arabidopsis thaliana, seeds were grown on MS solid medium containing 25 μg·ml ⁻¹ phosphinothricin. Finally, transformation was attempted in Arabidopsis thaliana, and two lines (#2 and #3) in which CaGRAS1 was overexpressed were selected.

Example 5. ABA, dehydration, NaCl, H ₂ O ₂ process

To observe CaGRAS1 expression levels in pepper plants, primary leaves were removed for dehydration, and ABA 50 μM, NaCl 200 mM, and H ₂ O ₂ 100 μM were treated on six-leaf stage pepper plants. did Leaves were harvested after 0, 2, 6, 12 and 24 hours of treatment, respectively. To confirm the expression pattern of stress-related genes, 3-week-old Col-0 and CaGRAS1 overexpressing Arabidopsis thaliana plants were separated from the roots, and the leaves were harvested at 0 and 3 hours after separation.

Example 6. RNA extraction and real-time reverse transcription polymerase chain reaction (q-RT PCR)

Total RNA was extracted from pepper and Arabidopsis leaves. All samples were treated with TRI-Reagent®-RNA/DNA/Protein reagent (Molecular Research Center, USA) to remove DNA and proteins, and then treated with 2-propanol to precipitate RNA. 1 μg total RNA for the template was quantified using a Synergy HTX Multi-Mode Microplate Reader. cDNA was synthesized using iScript™ cDNA synthesis kit (Bio-Rad, Hercules, CA, USA) and Transcriptor first strand cDNA synthesis kit (Roche). For qRT-PCR analysis, the cDNA synthesized by the above method was mixed with the iQ™SYBR Green Supermix (Bio-Rad) and the specific primers listed in Table 1 below using the FX96 Touch™ Real-Time PCR detection system (Bio-Rad) was amplified using Pepper Actin1 (CaACT1) and Arabidopsis Actin8 (AtACT8) genes were used as controls for normalization.

Prime name Primer sequence (5' - 3') For cloning CaGRAS1 -CDS Forward ATGGAATCACACCATTTGTATGATA Reverse TCAGTGCCAAGCAGATGCTGAGA Forward (w/o stop codon) GTCGAATTCGCCCTTGTGCCAAGCAGATGC Reverse (w/o stop codon) GCATCTGCTTGGCACAAGGGCGAATTCGAC CaGRAS1 -VIGS Forward TCTAGATGGAATCACACCATTTGTATG Reverse CTCGAGGCGGAAATCTGGAG CaGRAS1 -fragment N1 Reverse TTACAGTAGACTGTTCTGGCGGAAA N106 Forward ATGGTTTGTTCCGGTGAAACTTC N106 Reverse TTAGTTGCCAGAAGGAATTCCCT GRAS domain Forward ATGCTAAGCAGGCTGCTTATTGC For RT-PCR CaGRAS1 Forward ACTTCCTTACTCCAGTATGCAAATCA Reverse GCCAGAAGGAATTCCCTGCAC CaACT1 Forward GACGTGACCTAACTGATAACCTGAT Reverse CTCTCAGCACCAATGGTAATAACTT CaOSR1 Forward CTCGAGCTATCAGAGCAAAGTC Reverse TCTAGAGATCCTGTGTATTGACCAT CaLOX1 Forward ACGTAATCTCTGGGAAAAATGACGAT Reverse ACGTGACATCAAAGGCTGATTCGC CaOSM1 Forward CCTCCTTGCCTTTGTGACTTACACTT Reverse ATTCAGCTAAGGTGTTTGGTGGTTTAC CaADIP1 Forward ATGGCTGGCATGTGTTGTGGTGTTA Reverse TTAGACACTCTCTTTGACGGGCTCC Actin8 Forward CAACTATGTTCTCAGGTATTGCAGA Reverse GTCATGGAAACGATGTCTCTTTAGT NCED3 Forward ACATGGAAATCGGAGTTACAGATAG Reverse AGAAACAACAAACAAGAAACAGAGC RAB18 Forward GGAAGAAGGGAATAACACAAAAAGAT Reverse GCGTTACAAACCCTCATTATTTTTA RD29B Forward GTTGAAGAGTCTCCACAATCACTTG Reverse ATTAACCCAATCTCTTTTTCACACA DREB2A Forward CTACAAAGCCTCAACTACGGAATAC Reverse AAACTCGGATAGAGAATCAACAGTC RD29A Forward CACAATCACTTGGCTCCACTGTTG Reverse ACCTAGTAGCTGGTATGGAGGAACT RD20 Forward TGGTTTCCTATCTAAAGAAGCTGTG Reverse ATACAAATCCCCAAACTGAATAACA KIN2 Forward TCTTAACTTCGTGAAGGACAAGAC Reverse ACAACAACAAGTACGATGAGTACGA RD26 Forward AGGTCTTAATCCAATTCCAGAGCTA Reverse ACCCATCAGTAACTTCACATCTCTC HAB1 Forward GACTACCTCTCAATGCTTGCTCTAC Reverse AAAAACCTGTCGAAATTAGATCCTT

Example 7. Subcellular localization

For intracellular localization, A. tumefaciens strain GV3101 carrying the construct of green fluorescent protein (GFP) -CaGRAS1 together with strain p19 was used (each strain; OD600=0.5, 1:1 ratio). After 2 days of agroinfiltration, GFP signals were observed using a confocal microscope (510 UV/Vis Meta; Zeiss, Oberkochen, Germany).

Example 8. Plant phenotype analysis

For the drought stress analysis, four-leaf-stage peppers and 3-week-old Arabidopsis thaliana were used, and watering was stopped for 21 days in peppers and 14 days in Arabidopsis thaliana, and then water was re-watered for 2 days. . To measure water loss, primary and secondary leaves were separated and placed in a plastic weighing dish. The leaves were stored under favorable temperature conditions with a relative humidity of 40%. After that, a new weight was measured from 0 to 8 hours based on 1 hour.

To measure the leaf temperature, 50 μM and 100 μM ABA were sprayed on pepper and Arabidopsis thaliana. Thermal images were obtained using an infrared camera (FLIR systems; T420), and plant leaf temperature was measured using FLIR Tools+ ver 5.13 software.

For the measurement of stomata apertures, the hypocotyl epidermis of pepper and Arabidopsis leaves was isolated and incubated in stomatal opening solution (SOS; 50 mM KCl, 10 mM MES-KOH, 10 mM) for 2.5 hours at 24 °C. mM CaCl ₂ , pH 6.15). The pore-opened epidermis was transferred to SOS without or with ABA (10 and 20 μM) for 2.5 h at 24 °C. Stomata were randomly selected and photographed with a Nikon Eclipse 80i microscope.

Example 9. Confirmation of germination and seedling growth

The germination rates of CaAPIK1- OX transgenic Arabidopsis and wild-type plants were measured in 0.5X Murashige and Skoog (MS) medium supplemented with various concentrations of ABA, and the number of seeds that were famined for 7 days after seeding was measured.

The seedling growth stages of CaAPIK1- OX and wild-type plants in 0.5X MS medium supplemented with various concentrations of ABA were confirmed by taking representative pictures 5 days after seeding, and the greening of cotyledons in transgenic and wild-type plants. Quantification was performed.

The root length was confirmed by the primary root length of CaAPIK1 -OX Arabidopsis thaliana and wild-type plants in 0.5X MS medium containing 0.0, 0.5 and 0.75 μM ABA, and a representative photograph was taken on day 7 after division and quantified.

Example 10. Statistical Analysis

Statistical analysis was performed using student's t-test to determine significant differences between genotypes. Data represent the mean ± standard error of 3 independent experiments, and a P value of 0.05 or less was considered a significant difference (* P < 0.05, *** P < 0.001).

[Experimental Example]

Experimental example 1. CaGRAS1 Isolation and sequencing of genes

In order to isolate the positive regulatory genes for drought stress, RNA-seq analysis was performed on drought stress-treated pepper leaves, and CaGRAS1 having high homology with GRAS1 of other plants was identified. Amino acid sequence matching with other plants was confirmed using Lasergene MegAlign software and Genedoc software.

As shown in Figure 1a, the CaGRAS1 protein and its homologous proteins have highly conserved GRAS domains. CaGRAS1 was shown to have high homology (64.6-89.5%) with GRAS proteins of other species according to multiple sequence analysis and phylogenetic tree analysis.

As shown in Figure 1b, the CaGRAS1 cDNA consisted of a 1749 bp open reading frame encoding 582 amino acid residues with an isoelectric point of 6.36 and a molecular weight of 64.58 kDa.

Experimental Example 2. Sequence Analysis and Molecular Characteristics of CaGRAS1 Protein

To analyze the expression of CaGRAS1 in response to abiotic stress, qRT-PCR analysis was performed using pepper plants at the six-leaf stage treated with ABA, drought, H ₂ O ₂ and high salinity (NaCl). performed.

As a result, as shown in Figure 2a, the induction of CaGRAS1 was induced from 2 hours to 6 hours, and then gradually decreased. These results imply that CaGRAS1 can operate in ABA signaling and abiotic stress responses.

To confirm intracellular localization, a green fluorescent protein (GFP)-tagged CaGRAS1 fusion protein was used. The fusion protein was transiently expressed in epidermal cells of tobacco ( Nicotiana benthamiana ).

As a result, as shown in FIG. 2b, a fluorescence signal was observed in the nucleus 2 days after infiltration, confirming that CaGRAS1-GFP functions in the nucleus.

Meanwhile, the GRAS family is widely known as a transcription factor, and the transcription factor has an activation domain that activates a target gene. Activation domains of transcription factors are known to be rich in proline and glutamine, or acidic amino acids. Based on this, the transactivation effect of CaGRAS1 was confirmed.

As shown in Figure 2c, CaGRAS1 was fused to the GAL4 DNA binding domain of the pGBKT7 vector and expressed in yeast strain AH109. Yeast carrying full-length CaGRAS1 survived the selective medium, suggesting that CaGRAS1 has transactivation activity.

Additionally, CaGRAS1 was cut into 5 fragments and fused to the GAL4 DNA binding domain. Yeast cells containing fragment N1 were able to grow well in the selective medium, indicating that the N1 fragment is responsible for the transactivation activity.

These results indicate that CaGRAS1 may act as a transcription factor and that the N-terminal region of CaGRAS1 is required for transactivation.

Experimental example 3. CaGRAS1 -reduced drought tolerance and ABA sensitivity of silent pepper plants

Virus-induced gene silencing (VIGS) was used to investigate the role of CaGRAS1 in the drought stress response.

As a result, as shown in FIG. 3a, the expression level of CaGRAS1 was confirmed to be less in CaGRAS1- silenced pepper (TRV2: CaGRAS1 ) than in control pepper (TRV2:00) regardless of drought treatment.

In addition, to investigate the change in the tolerance of CaGRAS1-silenced peppers to drought treatment, CaGRAS1- silenced (TRV2: CaGRAS1 ) and control pepper (TRV2:00) plants were stopped from watering for 13 days and then re-watered for 4 days. stress was applied.

As a result, as shown in FIG. 3b, no phenotypic difference was observed between the two plants under normal growth conditions, but when drought stress was applied, CaGRAS1 -silenced pepper plants showed a more withered phenotype compared to the control group. In addition, the survival rates of the plants were confirmed to be 36.75% for the CaGRAS1 -silenced pepper plants and 70.63% for the control pepper plants.

Next, in order to determine whether the drought-sensitive phenotype of CaGRAS1- silenced pepper plants as described above is due to differences in water retention capacity, evaporative water loss was confirmed by measuring the fresh weight of leaves of CaGRAS1- silenced and control pepper plants. .

As a result, as shown in FIG. 3c, it was confirmed that evaporative water loss was significantly higher in CaGRAS1 -silenced pepper plants than in control pepper plants 9 hours after leaf separation.

To study the effect of CaGRAS1 on ABA-dependent stomatal closure, differences in leaf temperature and stomatal opening between CaGRAS1- silenced and control pepper plants were evaluated.

First, stomatal porosity according to ABA concentration was measured in CaGRAS1- seilenced and control pepper plants. As a result, as shown in Figures 3d and 3e, all stomata of CaGRAS1- seilenced pepper and control pepper plants were all opened in the absence of ABA, but when ABA was treated with 10 μM and 20 μM ABA, CaGRAS1 -seilenced pepper and control pepper plants All stomatal openings were reduced.

As a result, leaf temperature was decreased in CaGRAS1- seilenced pepper plants than in control pepper plants when ABA was treated, as shown in FIGS. 3f and 3g. Since stomatal closure in plants affects evaporative cooling with increasing leaf temperature, we hypothesized that CaGRAS1- seilenced pepper plants have lower leaf temperatures due to enhanced stomatal opening. These results suggest that CaGRAS1 works in response to ABA signaling and drought stress.

Experimental example 4. CaGRAS1 - Confirmation of increased ABA sensitivity of OX transgenic Arabidopsis

For further genetic analysis of CaGRAS1 , CaGRAS1 -OX transgenic Arabidopsis plants consistently overexpressing CaGRAS1 were used, and two T3 transgenic Arabidopsis lines ( CaGRAS1 -OX #2 and CaGRAS1- OX #3) were selected. and used for phenotypic analysis.

First, the expression level of CaGRAS1 was measured using semi-quantitative RT-PCR analysis.

As a result, as shown in Figure 4, it was confirmed that CaGRAS1 -OX Arabidopsis thaliana expressed the CaGRAS1 transcript, but not in wild-type plants.

As ABA and drought share a common signaling pathway, we confirmed how much ABA affects CaGRAS1- OX plants at the germination and seedling stages.

As shown in Figure 5a, the germination rate of wild-type plants was slightly higher than that of CaGRAS1-OX without ABA. However, the germination rate of CaGRAS1-OX plants was found to be significantly lower than that of wild-type plants.

Also, as shown in Figures 5b and 5c, germination rate and cotyledon greening showed no difference between CaGRAS1 -OX and wild-type plants in the absence of ABA. However, CaGRAS1- OX plants had significantly lower rates of germination and cotyledon greening than wild-type plants in the presence of ABA.

In addition, CaGRAS1 -OX plants in Figures 5d and 5e exhibited ABA-sensitive primary root length. That is, the root length growth of CaGRAS1- OX plants was significantly inhibited in the presence of ABA compared to wild-type plants.

These results suggest that CaGRAS1 in Arabidopsis is hypersensitive during germination and seedling stages in the presence of ABA.

Experimental Example 5. CaGRAS1 - Confirmation of drought stress resistance of OX transgenic Arabidopsis

To further investigate the effect of CaGRAS1 overexpression on Arabidopsis thaliana in response to drought stress, CaGRAS1- OX (#2 and #3) and wild-type (WT) plants were exposed to drought stress.

Arabidopsis plants were grown under well-watered conditions for 3 weeks, and at this time, as shown in Figure 6a (left panel), no other phenotypes were observed between CaGRAS1 -OX and wild-type plants. On the other hand, when watering to the plants was stopped for 14 days and the plants were exposed to drought stress and then watered again for 2 days, as shown in Fig. 6a (middle and right panels), CaGRAS1 -OX plants were significantly better than wild-type plants. It was confirmed that it wilted less.

Also, as shown in Figure 6b, the survival rate of CaGRAS1 -OX plants (47.7-71.5%) was higher than that of wild-type plants (26.6%).

Next, to measure the transpirational water loss of wild-type and CaGRAS1-OX plants, fresh leaf weight loss was measured for 9 hours.

As shown in Fig. 6c, the remaining leaf weight ratio of CaGRAS1-OX plants was higher than that of wild-type plants, which means less transpirational water loss. These results suggest that reduced susceptibility of CaGRAS1-OX plants to drought stress is affected by reduced transpiration.

Also, evaporation occurs through the stomata and lowers the temperature of the leaves. ABA is known to control stomatal opening by guard cells using the ABA signaling pathway. Thus, the leaf temperature and stomatal hole size of wild-type and CaGRAS1-OX plants were measured.

As shown in Figure 6d, there was no significant difference between wild-type and transgenic plants in the condition where ABA was not treated. However, the temperature of both wild-type and CaGRAS1-OX plants increased after ABA treatment, and the leaf temperature of CaGRAS1-OX plants tended to increase more than that of wild-type plants.

In addition, as shown in FIG. 6e, there was no significant difference in stomatal size between wild-type and CaGRAS1-OX plants under the condition in which ABA was not treated. However, stomatal openings of CaGRAS1-OX plants after treatment with 10 and 20 μM ABA were measured and found to be significantly reduced compared to wild-type plants.

These results suggest that CaGRAS1- OX plants exhibit drought resistance due to increased water retention capacity by ABA hypersensitivity.

The above description of the present invention is for illustrative purposes, and those skilled in the art can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments and experimental examples described above are illustrative in all respects and not limiting.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> Method for improving the resistance to the drought stress using pepper protein kinase CaGRAS1 in plants <130> MP21-113 <160> 26 <170> KoPatentIn 3.0 <210> 1 <211> 582 <212> PRT <213> artificial sequence <220> <223> CaGRAS1 (CA07g18600) <400> 1 Met Glu Ser His His Leu Tyr Gly Tyr Gly Val Thr Gly Ala Asn Leu 1 5 10 15 Ser Tyr Ala Tyr Ser Lys Thr Thr Thr Pro Ser Ile Pro Asn Arg Leu 20 25 30 Leu Gly Thr Leu Lys Phe Asp Ser Gly Tyr Ser Pro Asn Ser Pro Phe 35 40 45 Val Asn Tyr Phe Asp Pro Gly Thr Pro Thr Thr Leu Ser Asp Ser Leu 50 55 60 Glu Gln His Ser Ser Thr Glu Asn Ile Ser Gly Thr Ser Cys Ser Ser 65 70 75 80 Asn Ser Ser Leu Asp Tyr Ser His Tyr Phe Arg Arg Pro Ser Pro Ser 85 90 95 Pro Asp Phe Arg Gln Asn Ser Leu Leu Val Cys Ser Gly Glu Thr Ser 100 105 110 Leu Leu Gln Tyr Ala Asn His Ser His Asn Val Lys His Ala Leu Leu 115 120 125 Gln Leu Glu Thr Ala Leu Met Gly Pro Glu Glu Ala Thr Thr Ser Ser 130 135 140 Pro Ser Ala Gly Glu Ile Gln Gln Pro Gln Thr Ser Gly Gln Ser Ser 145 150 155 160 Gly Met Trp Ser Gln Asp Gly Gln Val Leu Arg Arg Ile Gly Ser Gln 165 170 175 Pro Ser Pro Val Pro Ile Phe Gly Ile Ser Gly Asn Arg Ile Gln Ser 180 185 190 Glu Lys Arg His Lys Ala Met Glu Asp Phe Pro Val Gln Gly Ile Pro 195 200 205 Ser Gly Asn Leu Lys Gln Leu Leu Ile Ala Cys Ala Arg Ala Leu Ala 210 215 220 Glu Asn Asn Leu Asn Asp Phe Glu Gln Leu Ile Ala Lys Ala Arg Asn 225 230 235 240 Ala Val Ser Ile Thr Gly Asp Pro Ile Glu Arg Leu Gly Ala Tyr Ile 245 250 255 Val Glu Gly Leu Val Ala Arg Lys Asp Gly Ser Gly Thr Asn Ile Tyr 260 265 270 Arg Ala Leu Arg Cys Lys Glu Pro Ala Gly Arg Asp Leu Leu Ser Tyr 275 280 285 Met His Ile Leu Tyr Glu Ile Cys Pro Tyr Leu Lys Phe Gly Tyr Met 290 295 300 Ala Ala Asn Gly Ala Ile Ala Glu Ala Cys Arg Asn Glu Asp Arg Ile 305 310 315 320 His Ile Ile Asp Phe Gln Ile Ala Gln Gly Thr Gln Trp Met Thr Leu 325 330 335 Leu Gln Ala Leu Ala Ala Arg Pro Ser Gly Ala Pro Tyr Val Arg Ile 340 345 350 Thr Gly Ile Asp Asp Pro Val Ser Lys Tyr Ala Arg Gly Asp Gly Leu 355 360 365 Thr Ala Val Gly Lys Arg Leu Ala Ala Ile Ser Ala Lys Phe Asn Ile 370 375 380 Pro Ile Glu Phe His Ala Val Pro Val Phe Ala Ser Glu Val Thr Arg 385 390 395 400 Asp Met Leu Asp Val Arg Pro Gly Glu Ala Leu Ala Val Asn Phe Pro 405 410 415 Leu Ala Leu His His Thr Pro Asp Glu Ser Val Asp Val Thr Asn Pro 420 425 430 Arg Asp Glu Leu Leu Arg Met Val Lys Phe Phe Ser Pro Lys Val Val 435 440 445 Thr Leu Val Glu Gln Glu Ser Asn Thr Asn Thr Ala Pro Phe Phe Pro 450 455 460 Arg Phe Leu Glu Ala Leu Asp Tyr Tyr Ser Ala Met Phe Glu Ser Ile 465 470 475 480 Asp Val Thr Leu Glu Arg Asp Arg Lys Glu Arg Ile Asn Val Glu Gln 485 490 495 His Cys Leu Ala Arg Asp Ile Val Asn Val Ile Ala Cys Glu Gly Lys 500 505 510 Glu Arg Val Glu Arg His Glu Leu Leu Gly Lys Trp Lys Leu Arg Leu 515 520 525 Thr Met Ala Gly Phe His Gln Tyr Pro Leu Ser Ser Tyr Val Asn Ser 530 535 540 Val Ile Lys Ser Leu Leu Arg Cys Tyr Ser Glu His Tyr Thr Leu Val 545 550 555 560 Glu Lys Asp Gly Ala Met Leu Leu Gly Trp Lys Glu Arg Asn Leu Ile 565 570 575 Ser Ala Ser Ala Trp His 580 <210> 2 <211> 1749 <212> DNA <213> artificial sequence <220> <223> CaGRAS1 (CA07g18600) <400> 2 atggaatcac accatttgta tggatatggt gtgactggtg caaatttgtc atacgcgtac 60 tctaagacta ctactccttc gatacctaat aggctgttgg gaacgttgaa atttgattcg 120 ggatattctc cgaattctcc atttgtaaac tattttgatc ctggtactcc aaccacttta 180 agtgatagcc tggagcagca cagctctact gaaaatattt caggaactag ttgttccagt 240 aattcctcgc tggattatag tcattatttc cgtaggccta gcccctctcc agatttccgc 300 cagaacagtc tactggtttg ttccggtgaa acttccttac tccagtatgc aaatcatagt 360 cacaacgtga aacatgcttt gctgcaattg gagactgctt taatgggtcc agaagaagct 420 acaacatcca gtccctcagc agggggaaatt cagcagccac agacatcagg tcagagttca 480 gggatgtgga gccaagatgg ccaggttttg cgtagaattg gttcacagcc atcacctgtt 540 cccatctttg gcatatcagg caatagaatt caaagtgaga agcggcacaa agcaatggag 600 gattttcccg tgcagggaat tccttctggc aacctaaagc agctgcttat tgcgtgtgcc 660 agagctcttg ctgagaataa cttaaatgat tttgagcaat tgattgccaa ggcaagaaat 720 gctgtgtcca ttactggaga tccaatcgag cgtctcggtg cttacatagt agaagggcta 780 gtagcaagaa aagatggttc cggaaccaat atttaccggg ctctaagatg taaggaacca 840 gctggcaggg acttgctttc ctacatgcat atcctatatg agatatgccc ttatctaaag 900 ttcggttaca tggctgcaaa tggtgcaata gcagaagcat gcagaaatga agatcgcatc 960 cacattatag acttccaaat tgcacaaggg actcaatgga tgactcttct tcaagctctt 1020 gctgccaggc ctagcggtgc cccttatgta cgtattacag gtattgacga tccagtttca 1080 aaatatgccc ggggagatgg attgacagca gtggggaaac gtcttgcagc aatttctgcg 1140 aaattcaaca ttccgattga gtttcatgcg gtgccagttt tcgcttctga agttaccagg 1200 gatatgcttg atgtgaggcc tggtgaggct ctggcagtaa acttcccttt ggcacttcac 1260 cacacaccgg atgagagcgt tgacgtgact aacccaaggg atgaacttct caggatggtg 1320 aaattttttt ctcccaaggt tgttactttg gtggaacaag aatcaaacac aaacacagct 1380 ccctttttcc ctcgatttct agaagctcta gactactatt ctgcaatgtt cgagtccata 1440 gatgtgacgt tagaaaggga cagaaaggag aggatcaatg tggagcagca ttgcttggca 1500 agggatatag ttaacgtcat agcatgcgag ggcaaggaaa gagtggaacg ccatgaacta 1560 ttaggcaaat ggaagctgag gttaacaatg gcagggttcc atcagtatcc tctgagctct 1620 tacgtgaatt cggtgataaa gagcctattg aggtgttact cagagcatta tacactggtg 1680 gagaaagatg gtgctatgtt gttgggatgg aaggagagga acctaatctc agcatctgct 1740 tggcactga 1749 <210> 3 <211> 25 <212> DNA <213> artificial sequence <220> <223> CaGRAS1-CDS_F <400> 3 atggaatcac accatttgta tgata 25 <210> 4 <211> 23 <212> DNA <213> artificial sequence <220> <223> CaGRAS1-CDS_R <400> 4 tcagtgccaa gcagatgctg aga 23 <210> 5 <211> 30 <212> DNA <213> artificial sequence <220> <223> CaGRAS1-CDS_Forward (w/o stop codon) <400> 5 gtcgaattcg cccttgtgcc aagcagatgc 30 <210> 6 <211> 30 <212> DNA <213> artificial sequence <220> <223> CaGRAS1-CDS_Reverse (w/o stop codon) <400> 6 gcatctgctt ggcacaaggg cgaattcgac 30 <210> 7 <211> 27 <212> DNA <213> artificial sequence <220> <223> CaGRAS1-VIGS_F <400> 7 tctagatgga atcacaccat ttgtatg 27 <210> 8 <211> 20 <212> DNA <213> artificial sequence <220> <223> CaGRAS1-VIGS_R <400> 8 ctcgaggcgg aaatctggag 20 <210> 9 <211> 25 <212> DNA <213> artificial sequence <220> <223> CaGRAS1-fragment_N1 Reverse <400> 9 ttacagtaga ctgttctggc ggaaa 25 <210> 10 <211> 23 <212> DNA <213> artificial sequence <220> <223> CaGRAS1-fragment_N106 Forward <400> 10 atggtttgtt ccggtgaaac ttc 23 <210> 11 <211> 23 <212> DNA <213> artificial sequence <220> <223> CaGRAS1-fragment_N106 Reverse <400> 11 ttagttgcca gaaggaattc cct 23 <210> 12 <211> 23 <212> DNA <213> artificial sequence <220> <223> CaGRAS1-fragment_GRAS domain Forward <400> 12 atgctaaagc agctgcttat tgc 23 <210> 13 <211> 26 <212> DNA <213> artificial sequence <220> <223> CaGRAS1_Forward <400> 13 acttccttac tccagtatgc aaatca 26 <210> 14 <211> 21 <212> DNA <213> artificial sequence <220> <223> CaGRAS1_Reverse <400> 14 gccagaagga attccctgca c 21 <210> 15 <211> 25 <212> DNA <213> artificial sequence <220> <223> CaACT1_F <400> 15 gacgtgacct aactgataac ctgat 25 <210> 16 <211> 25 <212> DNA <213> artificial sequence <220> <223> CaACT1_R <400> 16 ctctcagcac caatggtaat aactt 25 <210> 17 <211> 22 <212> DNA <213> artificial sequence <220> <223> CaOSR1_F <400> 17 ctcgagctat cagagcaaag tc 22 <210> 18 <211> 25 <212> DNA <213> artificial sequence <220> <223> CaOSR1_R <400> 18 tctagagatc ctgtgtattg accat 25 <210> 19 <211> 26 <212> DNA <213> artificial sequence <220> <223> CaLOX1_F <400> 19 acgtaatctc tgggaaaaat gacgat 26 <210> 20 <211> 24 <212> DNA <213> artificial sequence <220> <223> CaLOX1_R <400> 20 acgtgacatc aaaggctgat tcgc 24 <210> 21 <211> 26 <212> DNA <213> artificial sequence <220> <223> CaOSM1_F <400> 21 ccctccttgcc tttgtgactt acactt 26 <210> 22 <211> 27 <212> DNA <213> artificial sequence <220> <223> CaOSM1_R <400> 22 attcagctaa ggtgtttggt ggtttac 27 <210> 23 <211> 25 <212> DNA <213> artificial sequence <220> <223> CaADIP1_F <400> 23 atggctggca tgtgttgtgg tgtta 25 <210> 24 <211> 25 <212> DNA <213> artificial sequence <220> <223> CaADIP1_R <400> 24 ttagacactc tctttgacgg gctcc 25 <210> 25 <211> 25 <212> DNA <213> artificial sequence <220> <223> Actin8_F <400> 25 caactatgtt ctcaggtatt gcaga 25 <210> 26 <211> 25 <212> DNA <213> artificial sequence <220> <223> Actin8_R <400> 26 gtcatggaaa cgatgtctct ttagt 25

Claims (10)

Dry stress resistant CaGRAS1 ( Capsicum annuum GRAS1) protein consisting of the amino acid sequence of SEQ ID NO: 1.
CaGRAS1 gene encoding the CaGRAS1 protein of claim 1.
According to claim 2,
The CaGRAS1 gene is characterized in that consisting of the nucleotide sequence of SEQ ID NO: 2, CaGRAS1 gene.
According to claim 2,
The CaGRAS1 gene is characterized in that isolated from pepper, CaGRAS1 gene.
A recombinant vector comprising the CaGRAS1 gene of claim 2.
According to claim 5,
The recombinant vector is a recombinant vector, characterized in that for enhancing the drying stress resistance of plants.
A plant transformed with the recombinant vector of claim 5.
A composition for promoting drought stress resistance of plants, comprising at least one selected from the group consisting of the protein of claim 1, the CaGRAS1 gene encoding the same, and a recombinant vector containing the gene as an active ingredient.
A method for enhancing dry stress resistance of a plant, comprising the following steps:
(a) transforming a gene encoding a CaGRAS1 ( Capsicum annuum GRAS1) protein into a plant; and
(b) overexpressing the CaGRAS1 protein in the transformed plant.
A transgenic plant with enhanced drying stress resistance by the method of claim 9.

Images