KR101788585B1 - Novel Strain of Fusarium solani JS-169 having anti-bacterial and anti-fungal activity, and uses thereof - Google Patents
Novel Strain of Fusarium solani JS-169 having anti-bacterial and anti-fungal activity, and uses thereof Download PDFInfo
- Publication number
- KR101788585B1 KR101788585B1 KR1020150179681A KR20150179681A KR101788585B1 KR 101788585 B1 KR101788585 B1 KR 101788585B1 KR 1020150179681 A KR1020150179681 A KR 1020150179681A KR 20150179681 A KR20150179681 A KR 20150179681A KR 101788585 B1 KR101788585 B1 KR 101788585B1
- Authority
- KR
- South Korea
- Prior art keywords
- antibacterial
- antifungal
- strain
- present
- composition
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K10/00—Animal feeding-stuffs
- A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
- A23K10/16—Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
- A23L3/00—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs
- A23L3/34—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs by treatment with chemicals
- A23L3/3454—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs by treatment with chemicals in the form of liquids or solids
- A23L3/3463—Organic compounds; Microorganisms; Enzymes
- A23L3/3472—Compounds of undetermined constitution obtained from animals or plants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/06—Fungi, e.g. yeasts
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
- A61K8/9706—Algae
-
- C12R1/77—
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Polymers & Plastics (AREA)
- Wood Science & Technology (AREA)
- Food Science & Technology (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Nutrition Science (AREA)
- Alternative & Traditional Medicine (AREA)
- Medical Informatics (AREA)
- Physiology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Tropical Medicine & Parasitology (AREA)
- Animal Husbandry (AREA)
- Pharmacology & Pharmacy (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Plant Pathology (AREA)
Abstract
본 발명은 항균 및 항진균 활성을 갖는 푸사리움 솔라니 균주 및 이의 용도에 관한 것이다.
본 발명에 따른 내생균주 또는 그 배양액은 유해 미생물에 직접 영향을 미치는 것을 통해 탁월한 항균 및 항진균 활성을 나타내므로 약학적 조성물, 화장료 조성물, 식품 또는 사료 보존용 방부제 등의 용도로 유용하게 사용될 수 있다.The present invention relates to a Fusarium solanii strain having antibacterial and antifungal activity and its use.
The endogenous strain according to the present invention or the culture thereof exhibits excellent antibacterial and antifungal activity through directly influencing harmful microorganisms, and thus can be usefully used for pharmaceutical compositions, cosmetic compositions, preservatives for food or feed preservation, and the like.
Description
본 발명은 신규한 항균 및 항진균 활성을 나타내는 것을 특징으로 하는 신균주 푸사리움 솔라니 및 이를 유효성분으로 함유하는 항균 및 항진균용 조성물에 관한 것이다.The present invention relates to a novel strain, Fusarium solani, which is characterized by exhibiting novel antibacterial and antifungal activity, and a composition for an antibacterial and antifungal agent containing it as an active ingredient.
생물체의 항상성(homeostasis)을 유지하기 위한 과정에서 중요한 역할을 담당하고 있는 물질들 중 일부가 각종 생물체 유래의 생리 활성 물질이다. 지금까지 수많은 생리 활성 물질에 대해 많은 연구가 진행되고 있으며, 그 중, 항균 및 항진균 물질에 관한 연구는 생명과학 및 의학 분야에서 매우 중요한 영역이다.Some of the substances that play an important role in maintaining the homeostasis of organisms are physiologically active substances derived from various organisms. Numerous studies on physiologically active substances have been carried out so far. Among them, studies on antimicrobial and antifungal substances are very important fields in life sciences and medicine.
모든 생명체는 생존을 위하여 항균 및 항진균 물질을 생산하는 것으로 알려져 있는데, 항균 및 항진균 물질을 생산하는 미생물에 대해서 많은 연구가 이루어지고 있으며, 항균 및 항진균 물질을 생산하는 미생물 또는 이들에게서 분리된 물질을 이용해 항균제 또는 항진균제를 개발하려는 연구들이 오래전부터 시도되고 있다. All living organisms are known to produce antimicrobial and antifungal substances for survival. Many studies have been conducted on microorganisms that produce antimicrobial and antifungal substances. Using microorganisms that produce antimicrobial and antifungal substances, or materials isolated from them Studies to develop antibacterial or antifungal agents have long been attempted.
한편, 식물 내생균은 생활사의 일부가 건강한 식물 조직에 외형적 변형을 일으키지 않고 공존하는 미생물이다. 내생균의 공생은 기주식물과의 상호관계, 즉 내생균과 기주식물 파트너의 특성이나 환경적 영향에 따라 공생, 편리 공생 및 기생 등의 형태(balanced symbiotic continuum)로 정의될 수 있다. 내생균은 기주식물의 생장 촉진, 병해충 저항성 증대, 냉해나 건조 등의 환경변화에 대한 적응력 증대, 대사물질 형성 촉진 등 식물에 이로운 영향을 주기도 하나, 일부 내생균의 경우 기주식물에 잠복하여 병원균으로 작용하는 등 해로운 영향을 주기도 하고, 죽은 식물 조직의 일차 분해자로 작용하여 생태계 물질 순환을 촉진하는 역할을 하기도 한다. On the other hand, live bacteria in plants are microorganisms in which part of life history coexists without causing external transformation to healthy plant tissue. The symbiosis of living organisms can be defined as a symbiotic continuum in terms of symbiotic, convenient symbiotic and parasitic depending on the interrelationship with host plants, that is, the characteristics and environmental influences of host organisms and host plant partners. Mycorrhizae may have a beneficial effect on plants such as promoting growth of host plants, increasing resistance to pest insects, increasing adaptability to environmental changes such as cold weather and drying, and promoting metabolism formation. In some cases, however, It acts as a primary decomposer of the dead plant tissue and promotes ecosystem material circulation.
또한, 식물 내생균은 그 자체가 항암 또는 항균 등의 활성을 갖는 유용한 이차대사산물을 생산하는 것으로 알려져 있는데, 가장 대표적인 예로는 주목나무에서 분리된 탁소미세스 속 내생균(Taxomyces andreanae)으로 차세대 항암제로 주목받고 있는 택솔(paclitaxel)을 생산하는 내생균이다. 이러한 내생균의 상업적 성공으로 인해 다양한 약리적 효능을 가진 신규 생리활성 물질을 보유한 새로운 식물 내생균을 찾기 위한 연구개발 노력이 지속적으로 이루어지고 있다. In addition, live bacteria in plants are known to produce useful secondary metabolites that have activities such as anticancer or antibacterial activity. The most representative example is Taxomyces andreanae, a taxane isolated from a tree, It is an endogenous bacillus producing paclitaxel which is getting attention. Due to the commercial success of these endophytic bacteria, research and development efforts have been continuously carried out to find new live bacteria in a new plant having various physiologically active substances with various pharmacological effects.
푸사리움 솔라니는(Fusarium solani) 자낭균 문(Ascomycota), 동충하초 강(Sordariomycetes), 동충하초 목(Hypocreales), 알보리수버섯 과(Nectriaceae), 푸사리움 속(Fusarium)에 속하는 곰팡이로 토양과 식물의 잔해물에서 발견되며 여러 식물의 병원균 또는 식물 내생균으로 알려져 있다. Fusarium ( Fusarium) solani) ascus bacterium door (Ascomycota), sordariomycetes (Sordariomycetes), Cordyceps neck (Hypocreales), Al linden mushrooms and (Nectriaceae), a fungus belonging to Fusarium genus (Fusarium) is found in the debris of soil and plants of various plants It is known as pathogens or live bacteria in plants.
푸사리움 솔라니는 다양한 생물활성 물질(fusarubin, anhydro-fusarubin, javanicin, methyl ether-fusarubin, marticin, isomarticin, ethyl ether-fusarubin, solaniol, nectriafusarubinm dihydro-fusarubin lactone)을 생성하는 것으로 알려져 있으며, 항기생충(nematicidal), 식물독소(phytotoxin), 항종양(antitumor)등에 효과가 있는 것으로 보고된 바 있다. It is known that fusarium mucilage produces various biologically active substances (fusarubin, anhydro-fusarubin, javanicin, methyl ether-fusarubin, marticin, isomarticin, ethyl ether-fusarubin, solaniol and nectriafusarubinm dihydro-fusarubin lactone) nematicidal, phytotoxin, and antitumor have been reported to be effective.
그러나, 이러한 연구결과에도 불구하고 아직까지 식물 내생균을 이용한 신규 항균 및 항진균제 개발과 관련된 연구 성과는 미미한 상태이며, 항균 및 항진균 효과가 뛰어나 상용화 가능성이 높은 식물 유래 내생균을 찾아내는 것이 시급한 실정이다. However, despite the results of these studies, the research results related to the development of new antibacterial and antifungal agents using live bacteria in plants are still insufficient, and it is urgent to find the live bacteria in plant origin which are highly commercialized because of their excellent antibacterial and antifungal effect.
이러한 배경 하에서, 본 발명자들은 항균 및 항진균 활성을 갖는 신규 내생균근을 찾기 위해 예의 노력한 결과, 우리나라 전역에서 서식하고 있는 식물체인 뽕나무 잎에서 분리된 푸사리움 속 신규 내생균주가 우수한 항균 및 항진균 활성이 있어 항균제 및 항진균제로 유용하게 활용할 수 있음을 확인하고, 본 발명을 완성하게 되었다.Under these circumstances, the present inventors have made intensive efforts to find new endogenous mycorrhizae having antibacterial and antifungal activity. As a result, the new endogenous strains of fusarium genus isolated from mulberry leaves, which are inhabited throughout Korea, have excellent antibacterial and antifungal activity Antimicrobial agent, and antifungal agent, and completed the present invention.
따라서, 본 발명의 주된 목적은 항균 및 항진균 활성을 갖는 식물 내생균을 제공하는 데 있다.Therefore, a main object of the present invention is to provide live bacteria in plants having antibacterial and antifungal activity.
본 발명의 다른 목적은 상기 식물 내생균을 이용한 항균 및 항진균제 조성물을 제공하는데 있다. It is another object of the present invention to provide an antibacterial and antifungal agent composition using live bacteria in the plant.
상기 목적을 달성하기 위해, 본 발명은 항균 및 항진균 활성을 갖는 푸사리움 솔라니(Fusarium solani) 균주 JS-169(수탁번호: KACC 83006P)를 제공한다.In order to achieve the above object, the present invention provides Fusarium solani strain JS-169 (accession number: KACC 83006P) having antibacterial and antifungal activity.
본 발명의 용어 "푸사리움 솔라니(Fusarium solani) 균주 JS-169"는 국내 자생 식물인 뽕나무에서 본 발명자들에 의해 새롭게 분리 동정된 신규한 푸사리움 솔라니 균주로서, "JS-169 균주" 또는 "JS-169"와 혼용하여 사용할 수 있다. The term " Fusarium solani strain JS-169 "of the present invention is a novel Fusarium solanii strain newly isolated and identified by the present inventors in a domestic wild plant, It can be used in combination with "JS-169".
본 발명자들은 신규 항균제나 항진균제의 개발을 위해 국내에서 자생하는 여러 식물체에서 분리된 내생균의 항진균 및 항균 효과에 대해 수년간 조사 분석하였고, 그 결과 한국 자생 뽕나무에서 유래된 내생균주의 항진균 및 항균 효과를 검증하였다(도 1 내지 도 5 참조). The present inventors have investigated the antifungal and antimicrobial effects of endogenous live bacteria isolated from various plants native to Korea for the development of new antimicrobial agents and antifungal agents. As a result, they found that the antifungal and antimicrobial effects of the endogenous strains derived from Korean wild mulberry (See Figs. 1 to 5).
본 발명의 상기 푸사리움 솔라니(Fusarium solani) 균주 JS-169(수탁번호: KACC 83006P)는 서열번호 1의 ITS 유전자 서열 또는 서열번호 2의 TEF1(translational elongation factor 1) 유전자 서열을 갖는 것을 특징으로 한다.The Fusarium solani strain JS-169 (accession number: KACC 83006P) of the present invention has the ITS gene sequence of SEQ ID NO: 1 or the TEF1 (translational elongation factor 1) gene sequence of SEQ ID NO: 2 do.
본 발명자들은 상기 유전자 서열을 종래 공지된 균주들의 유전자 서열들과 비교 분석한 결과, 본 발명의 균주가 푸사리움 솔라니에 속하는 새로운 균주임을 확인하여 푸사리움 솔라니 균주 JS-169로 명명하였고, 국립농업과학원 농업유전자원정보센터에 2015년 12월 2일자로 기탁하고, 수탁번호 KACC 83006P를 부여받았다.As a result of comparing the gene sequence with the gene sequences of known strains, the present inventors confirmed that the strain of the present invention is a new strain belonging to Fusarium solanii and named it Fusarium solani strain JS-169, It was deposited on December 2, 2015 with the grant number KACC 83006P at the National Institute of Agricultural Science and Technology.
본 발명의 다른 양태에 따르면, 본 발명은 상기 푸사리움 솔라니(Fusarium solani) 균주 JS-169, 또는 그 배양액을 유효성분으로 포함하는 항균 및 항진균 조성물을 제공한다. In accordance with another aspect of the present invention, the present invention provides a method for producing the Fusarium solani solani ) strain JS-169, or a culture thereof as an active ingredient.
본 발명에서, 상기 푸사리움 솔라니 JS-169 균주 또는 그 배양액은 그 자체로 항진균 및 항균 활성을 나타내는 것을 특징으로 한다. In the present invention, the Fusarium solani JS-169 strain or a culture thereof is characterized by exhibiting antifungal activity and antibacterial activity by itself.
상기 푸사리움 솔라니 균주 JS-169 또는 그 배양액은 다양한 진균류에 대해 항진균 활성이 있으며, 구체적으로는 칸디다 속 또는 크립토코커스 속 진균에 대해 항진균 활성을 갖고, 보다 구체적으로는 칸디다 알비칸스(Candida albicans), 칸디다 글라브라타(Candida glabrata) 및 크립토코커스 네오포르만스(Cryptococcus neoformans)에 대해 항진균 활성이 있으나, 이에 한정되는 것은 아니다(도 1 내지 도 3). The Fusarium solani strain JS-169 or the culture medium are the antifungal activity against a variety of fungi, in particular has an antifungal activity against Candida or Cryptococcus genus Rhodococcus genus fungi, more specifically from Candida albicans (Candida albicans , Candida glabrata and Cryptococcus neoformans , but are not limited thereto (Figures 1 to 3).
또한, 상기 푸사리움 솔라니 속 균주 JS-169 또는 그 배양액은 다양한 균류에 대해 항균 활성이 있다. 본 발명의 균주 또는 그 배양액은 그람 양성균, 그람 음성균 및 항생제 내성 균주에 대하여 항균 활성을 갖고 있으며, 구체적으로 스타필로코커스 속 균주 또는 스트렙토코쿠스 속 균주에 대해 항균 활성을 갖고, 보다 구체적으로 스타필로코커스 아우레우스(Staphylococcus aureus), 스트렙토코쿠스 무탄스(Streptococcus mutans) 등의 세균에 대하여 항균 활성이 있으나, 이에 한정되는 것은 아니다(도 4 및 도 5).In addition, the Fusarium solanaceae strain JS-169 or the culture thereof has antibacterial activity against various fungi. The strain of the present invention or its culture has antimicrobial activity against Gram-positive bacteria, Gram-negative bacteria and antibiotic-resistant strains, and specifically has antibacterial activity against Staphylococcus spp. Or Streptococcus spp., More specifically, Staphylococcus aureus , Streptococcus mutans , and the like, but the present invention is not limited thereto (Figs. 4 and 5).
본 발명의 일 실시예에서는 본 발명에 따른 내생균 배양액의 추출물이 다양한 병원성 진균 및 병원성 세균에 대해 생장억제 효능이 있는 것을 확인하였다.In one embodiment of the present invention, it has been confirmed that the extract of the endogenous culture solution according to the present invention has a growth inhibitory effect against various pathogenic fungi and pathogenic bacteria.
본 발명의 다른 양태에 따르면, 본 발명은 상기 푸사리움 솔라니 균주 JS-169 또는 그 배양액을 유효성분으로 포함하는 항균 및 항진균용 약학적 조성물을 제공한다. 본 발명의 푸사리움 솔라니 균주 JS-169 또는 그 배양액은 유해 미생물에 직접 영향을 미치는 것을 통해 탁월한 항균 및 항진균 활성을 나타내므로 항균 및 항진균용 약학적 조성물로 유용하게 사용될 수 있다.According to another aspect of the present invention, there is provided a pharmaceutical composition for antibacterial and antifungal use comprising the Fusarium solani strain JS-169 or a culture thereof as an active ingredient. The Fusarium solani strain JS-169 of the present invention or its culture liquid exhibits excellent antibacterial and antifungal activity through direct influence on harmful microorganisms, and thus can be usefully used as a pharmaceutical composition for antibacterial and antifungal use.
한편, 본 발명의 푸사리움 솔라니 균주 배양액의 추출물은 약학적으로 허용 가능한 염의 형태로 제조될 수 있다. 구체적으로 산을 첨가함으로써 염을 형성할 수 있고, 예를 들어 무기산(예: 염산, 히드로브롬산, 인산, 질산, 황산 등), 유기 카르복실산(예: 아세트산, 트리플루오로아세트산과 같은 할로 아세트산, 프로피온산, 말레산, 숙신산, 말산, 시트르산, 타르타르산, 살리실산), 및 산성 당(글루쿠론산, 갈락투론산, 글루콘산, 아스코르브산), 산성 폴리사카리드(예: 히알우론산, 콘드로이틴 술페이트, 아르기닌산), 콘드로이틴 술페이트와 같은 술폰산 당 에스테르를 포함하는 유기 술폰산(예: 메탄, 술폰산, p-톨루엔 술폰산) 등을 첨가하여 염을 형성할 수 있다.Meanwhile, the extract of the Fusarium solani strain culture of the present invention can be prepared in the form of a pharmaceutically acceptable salt. Specifically, a salt can be formed by adding an acid, and examples thereof include salts with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid and the like, organic carboxylic acids such as acetic acid and halo such as trifluoroacetic acid (Such as acetic acid, propionic acid, maleic acid, succinic acid, malic acid, citric acid, tartaric acid, salicylic acid) and acidic sugars (glucuronic acid, galacturonic acid, gluconic acid, ascorbic acid), acidic polysaccharides (such as hyaluronic acid, chondroitin sulfate, Arginic acid), and organic sulfonic acids (e.g., methane, sulfonic acid, and p-toluenesulfonic acid) including sulfonic acid esters such as chondroitin sulfate.
본 발명의 푸사리움 솔라니 균주 JS-169 또는 그 배양액은 식용 가능한 뽕나무 잎에서 분리된 내생균으로 임상투여시 경구 또는 비경구로 투여가 가능하며 일반적인 의약품 제제의 형태로 사용될 수 있다.The Fusarium solani strain JS-169 of the present invention or the culture thereof is an endogenous bacterium isolated from an edible mulberry leaf and can be administered orally or parenterally when it is clinically administered and can be used in the form of a general pharmaceutical preparation.
즉, 본 발명의 신균주 JS-169 또는 그 배양액은 실제로 경구 또는 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 비경구투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁용제로는 프로필렌글리콜(Propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 리우린지, 글리세로제라틴 등이 사용될 수 있다.That is, the new strain JS-169 of the present invention or its culture can be administered by various oral or parenteral formulations. In the case of formulation, the filler, the extender, the binder, the wetting agent, the disintegrant, Diluent or excipient. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. As a suppository base, witepsol, macrogol, tween 61, cacao paper, Liu ling, glycerogelatin and the like can be used.
또한, 본 발명의 신균주 JS-169 또는 그 배양액은 생리식염수 또는 유기용매와 같이 약제로 허용된 여러 전달체(carrier)와 혼합하여 사용될 수 있고, 안정성이나 흡수성을 증가시키기 위하여 글루코스, 수크로스 또는 덱스트란과 같은 카보하이드레이트, 아스코르브 산(ascorbic acid) 또는 글루타치온과 같은 항산화제(antioxidants), 킬레이트화제(chelating agents), 저분자 단백질 또는 다른 안정화제(stabilizers)들이 약제로 사용될 수 있다.In addition, the novel strain JS-169 of the present invention or a culture thereof can be used in combination with various carriers permitted as medicaments such as physiological saline or an organic solvent, and can be used in combination with glucose, sucrose, Antioxidants such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins or other stabilizers such as carbohydrates such as tran can be used as pharmaceuticals.
본 발명의 신균주 JS-169 또는 그 배양액의 유효용량은 0.01 내지 10 ㎎/㎏이고, 바람직하게는 0.1 내지 1 ㎎/㎏ 이며, 하루 1회 내지 3회 투여될 수 있다.The effective dose of the novel strain JS-169 of the present invention or the culture thereof is 0.01 to 10 mg / kg, preferably 0.1 to 1 mg / kg, and can be administered once to three times a day.
본 발명의 약학적 조성물에서 또는 그 배양액은 총 유효량은 볼루스(bolus) 형태 혹은 상대적으로 짧은 기간 동안 주입(infusion) 등에 의해 단일 투여량(single does)으로 환자에게 투여될 수 있으며, 다중 투여량(multiple does)이 장기간 투여되는 분할 치료 방법(fractionated treatment protocol)에 의해 투여될 수 있다. 상기 농도는 약의 투여 경로 및 치료 횟수뿐만 아니라 환자의 나이 및 건강상태 등 다양한 요인들을 고려하여 환자의 유효 투여량이 결정되는 것이므로 이러한 점을 고려할 때, 이 분야의 통상적인 지식을 가진 자라면 본 발명의 신균주 JS-169 또는 그 배양액의 약학적 조성물로서의 특정한 용도에 따른 적절한 유효 투여량을 결정할 수 있을 것이다.In a pharmaceutical composition of the present invention or a culture thereof, the total effective amount may be administered to a patient in a single dose, such as by bolus injection or by infusion for a relatively short period of time, (multiple does) may be administered by a fractionated treatment protocol administered over a prolonged period of time. Since the concentration of the effective dose of the patient is determined in consideration of various factors such as the route of administration and the number of treatments as well as the age and health condition of the patient, in view of this point, Lt; RTI ID = 0.0 > JS-169 < / RTI > or its pharmaceutical composition as a pharmaceutical composition.
본 발명의 또 다른 양태에 따르면, 본 발명은 항균 및 항진균 활성을 갖는 푸사리움 솔라니(Fusarium solani) 균주 JS-169 또는 그 배양액를 유효성분으로 함유하는 항균 및 항진균용 화장료 조성물을 제공한다.According to still another aspect of the present invention, there is provided an antibacterial and antifungal cosmetic composition containing Fusarium solani strain JS-169 or a culture thereof having an antibacterial and antifungal activity as an active ingredient.
본 발명의 신균주 JS-169 또는 그 배양액은 유해 미생물에 직접 영향을 미치는 것을 통해 탁월한 항균 및 항진균 활성을 나타므로 항균 및 항진균용 화장료 조성물로 유용하게 사용될 수 있다.Since the novel strain JS-169 of the present invention or its culture liquid exhibits excellent antibacterial and antifungal activity through directly influencing harmful microorganisms, it can be effectively used as a cosmetic composition for antibacterial and antifungal use.
본 발명의 화장료 조성물은 유효성분으로 상기 신균주 JS-169 또는 그 배양액 이외에 화장료 조성물에 통상적으로 이용되는 성분들이 포함되며, 예컨대 항산화제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제, 그리고 담체를 포함한다.The cosmetic composition of the present invention contains, as an active ingredient, components commonly used in cosmetic compositions in addition to the above-mentioned new strain JS-169 or a culture thereof, and includes conventional components such as antioxidants, stabilizers, solubilizers, vitamins, Supplements, and carriers.
본 발명의 화장료 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 유연 화장수(스킨), 영양 화장수(밀크로션), 영양 크림, 맛사지 크림, 에센스, 아이크림, 클렌징 크림, 클렌징 포옴, 클렌징 워터, 팩, 스프레이 또는 파우더의 제형으로 제조될 수 있다.The cosmetic composition of the present invention can be prepared into any of the formulations conventionally produced in the art and can be used in the form of solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, , Oil, powder foundation, emulsion foundation, wax foundation and spray, but is not limited thereto. More specifically, it can be manufactured in the form of a flexible lotion (skin), a nutritional lotion (milk lotion), a nutritional cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray or a powder .
본 발명의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성 유, 식물성 유, 왁스, 파라핀, 전분, 트라가칸타, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.When the formulation of the present invention is a paste, a cream or a gel, an animal oil, vegetable oil, wax, paraffin, starch, tragacantha, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide .
본 발명의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In the case of a spray, in particular, / Propane or dimethyl ether.
본 발명의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 있다.When the formulation of the present invention is a solution or an emulsion, a solvent, a dissolving agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, , 3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan fatty acid esters.
본 발명의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소 결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라가칸타 등이 이용될 수 있다.In the case where the formulation of the present invention is a suspension, a carrier such as water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Cellulose, aluminum metahydroxide, bentonite, agar or tragacantha, etc. may be used.
본 발명의 제형이 계면-활성제 함유 클렌징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.When the formulation of the present invention is an interfacial active agent-containing cleansing, the carrier component is selected from aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters.
본 발명의 화장품의 구체예로서는 세안크림, 세안폼, 클렌징크림, 클렌징밀크, 클렌징로션, 마사지크림, 콜드크림, 모이스처크림, 유액, 화장수, 팩, 에프터세이빙크림, 썬텐방지크림, 썬텐용 오일, 비누, 보디샴푸, 헤어샴푸, 헤어린스, 헤어트리트먼트, 양모료, 육모료, 헤어크림, 헤어리퀴드, 세트로션, 헤어스프레이, 헤어브리지, 컬러린스, 컬러스프레이, 퍼머넌트웨이브액, 프레스파우더, 루스파우더, 아이섀도, 핸드크림, 립스틱 등을 들 수 있다.Specific examples of the cosmetics of the present invention include eye creams, cleansing creams, cleansing milks, cleansing lotions, massage creams, cold creams, moisturizing creams, milks, lotions, packs, after-shave creams, sunscreen- Hair shampoo, hair shampoo, hair rinse, hair treatment, hair dye, hair dye, hair cream, hair liquid, set lotion, hair spray, hair bridge, color rinse, color spray, permanent wave liquid, press powder, loose powder , Eye shadow, hand cream, lipstick, and the like.
본 발명의 또 다른 양태에 따르면, 본 발명은 항균 및 항진균 활성을 갖는 푸사리움 솔라니(Fusarium solani) 균주 JS-169 또는 그 배양액을 유효성분으로 함유하는 식품 또는 사료 보존용 조성물을 제공한다.According to still another aspect of the present invention, there is provided a food or feed preserving composition containing Fusarium solani strain JS-169 or a culture thereof having an antibacterial and antifungal activity as an active ingredient.
식품이나 사료의 보존제는 식품이나 사료의 변질, 부패, 변색 및 화학변화를 방지하기 위해 사용되는 첨가물로서 살균제, 산화방지제가 이에 포함되며, 세균, 곰팡이, 효모 등 미생물의 증식을 억제하여 식품, 사료, 화장품, 의약품 등에서 부패미생물의 발육저지 또는 살균작용을 하는 등의 기능성 항균제도 포함된다. 이러한 식품이나 사료의 방부제의 이상적인 조건으로는 독성이 없어야 하며, 미량으로도 효과가 있어야 한다. 본 발명의 푸사리움 솔라니(Fusarium solani) 균주 JS-169 또는 그 배양액은 유해 미생물에 직접 영향을 미치는 것을 통해 탁월한 항균 및 항진균 활성을 나타므로 상기의 식품이나 사료의 보존제, 화장품 보존제 및 의약품 보존제 등에 폭넓게 사용될 수 있다.A food or feed preservative is an additive used to prevent deterioration, decay, discoloration and chemical change of food or feed. It includes antiseptic and antioxidant, and inhibits the growth of microorganisms such as bacteria, fungi and yeast. , Cosmetics, medicines and the like, as well as functional antimicrobial agents such as inhibiting the growth of microorganisms or sterilizing them. Ideal conditions for preserving food or feed should not be toxic and should be effective in trace amounts. Fusa of the invention Solarium solani (Fusarium solani ) strain JS-169 or a culture thereof exhibits excellent antibacterial and antifungal activity through directly influencing harmful microorganisms, and thus can be widely used as preservatives, cosmetic preservatives, and drug preservatives for the above food or feed.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 푸사리움 솔라니(Fusarium solani) 균주 JS-169 또는 그 배양액을 함유하는 조성물을 치료를 필요로 하는 개체에 투여하여 병원성 세균을 사멸시키는 단계를 포함하는, 인간을 제외한 동물의 세균 또는 진균성 감염 질환을 치료하는 방법을 제공한다.According to yet another aspect of the present invention, the present invention provides a method for producing the Fusarium solani solani ) strain JS-169 or a culture thereof to an individual in need of treatment to kill the pathogenic bacteria. The present invention provides a method for treating a bacterial or fungal infectious disease in an animal other than human, do.
본 발명에 따른 상기 치료방법은 비록 인간을 제외한 동물을 치료하는 방법이나, 인간에 있어 이러한 치료방법이 효과가 없음을 의미하는 것은 아니다. 또한, 인간의 경우 있어서 본 발명에 따른 치료용 조성물의 투여에 의해 증상이 호전될 수 있는 세균 또는 진균 감염에 의한 질환을 갖는 것을 고려할 때, 인간의 치료에 있어서도 충분히 사용될 수 있다.The method of treatment according to the present invention does not mean that a method of treating an animal other than a human, but such a treatment method is ineffective in humans. In addition, in the case of humans, considering the fact that a symptom may be improved by administration of the therapeutic composition according to the present invention, a disease caused by a bacterium or a fungal infection can be sufficiently used in the treatment of humans.
본 발명에서 용어 "인간을 제외한 동물"은 본 발명에 따른 치료용 조성물의 투여에 의해 증상이 호전될 수 있는 세균 또는 진균의 감염에 의해 유발되는 질환을 갖는 인간만을 제외한 말, 양, 돼지, 염소, 낙타, 영양, 개 등의 동물을 의미한다. 본 발명에 따른 치료용 조성물을 인간을 제외한 동물에게 투여함으로써, 세균 및 진균 감염에 의한 질환을 효과적으로 예방 및 치료할 수 있다.In the present invention, the term "animal excluding human beings" refers to animals, such as horses, sheep, pigs, and goats, except for humans having a disease caused by infection with bacteria or fungi, , Camel, nutrition, and dog. By administering the therapeutic composition of the present invention to an animal other than a human, diseases caused by bacterial and fungal infections can be effectively prevented and treated.
본 발명에서 용어 "투여"는 어떠한 적절한 방법으로 동물에게 소정의 물질을 도입하는 것을 의미하며, 본 발명에 따른 치료용 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 경구 또는 비경구 투여될 수 있다. 또한, 본 발명에 따른 치료용 조성물은 유효성분이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다.The term "administering" in the present invention means introducing a predetermined substance into an animal by any appropriate method, and the administration route of the therapeutic composition according to the present invention may be administered orally, May be administered parenterally. In addition, the therapeutic composition according to the present invention may be administered by any device capable of moving the active ingredient into the target cell.
본 발명에 따른 치료용 조성물의 바람직한 투여량은 치료 대상 동물의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 그러나, 바람직한 효과를 위해서, 본 발명의 약학적 조성물은 0.01 내지 10 ㎎/㎏이고, 바람직하게는 0.1 내지 1 ㎎/㎏ 이며, 하루 1회 내지 3회 투여할 수 있다.The preferable dosage of the therapeutic composition according to the present invention varies depending on the condition and body weight of the animal to be treated, the degree of disease, the type of drug, route of administration and period of time, but can be appropriately selected by those skilled in the art. However, for the desired effect, the pharmaceutical composition of the present invention is 0.01 to 10 mg / kg, preferably 0.1 to 1 mg / kg, and can be administered once to three times a day.
본 발명의 특징 및 이점을 요약하면 다음과 같다:The features and advantages of the present invention are summarized as follows:
(ⅰ) 본 발명은 뽕나무 잎에서 유래한 푸사리움 솔라니 JS-169 균주 또는 그 배양액을 유효성분으로 포함하는 항균 및 항진균용 조성물을 제공한다.(I) The present invention provides an antibacterial and antifungal composition comprising Fusarium solani JS-169 strain derived from mulberry leaf or a culture thereof as an active ingredient.
(ⅱ) 본 발명의 푸사리움 솔라니 JS-169 균주 또는 그 배양액을 포함하는 조성물은 다양한 균들에 대해 폭넓은 항균 및 항진균 스펙트럼을 나타내고 있으며, 본 발명의 조성물은 유해세균에 의해 발생하는 다양한 세균 감염증에 적용이 가능하다. (Ii) The Fusarium solani JS-169 strain of the present invention or a composition comprising the culture thereof exhibits a broad spectrum of antimicrobial and antifungal spectrum against various fungi. The composition of the present invention is useful for various bacterial infectious diseases caused by harmful bacteria .
(ⅲ) 또한, 본 발명의 조성물은 화장료 조성물, 식품 또는 사료 보존용 첨가제 조성물 등의 다양한 분야에서 항균, 항진균 및 방부 목적으로 유용하게 이용가능하다.(Iii) Furthermore, the composition of the present invention is useful for antibacterial, antifungal and antiseptic purposes in various fields such as cosmetic composition, food or feed preservative additive composition, and the like.
도 1은 Candida albicans에 대한 Fusarium solani JS-169의 항균활성 결과를 나타낸 그래프이다.
도 2는 Candida glabrata에 대한 Fusarium solani JS-169의 항균활성 결과를 나타내는 그래프이다.
도 3은 Cryptococcus neoformans에 대한 Fusarium solani JS-169의 항균활성 결과를 나타내는 그래프이다.
도 4는 Staphylococcus aureus에 대한 Fusarium solani JS-169의 항균활성 결과를 나타내는 그래프이다.
도 5는 Streptococcus mutans에 대한 Fusarium solani JS-169의 항균활성 결과를 나타내는 그래프이다.
도 6은 Fusarium solani . JS-169의 PDA 배지상 생장모습과 포자 모양을 촬영한 사진이다.
도 7은 Fusarium solani . JS-169의 ITS 염기서열 정보를 바탕으로 시행한 계통분석 그래프이다.
도 8은 Fusarium solani . JS-169의 TEF1 염기서열 정보를 바탕으로 시행한 계통분석 그래프이다.1 is a Candida Fusarium for albicans solani < / RTI > JS-169.
2 is a Candida Fusarium for glabrata solani JS-169 < / RTI >
FIG. 3 shows that Cryptococcus Fusarium for neoformans solani < / RTI > JS-169.
Figure 4 is a graph showing the effect of Staphylococcus aureus Fusarium solani < / RTI > JS-169.
5 is Fusarium on Streptococcus mutans solani < / RTI > JS-169.
6 is a Fusarium solani . It is a picture of JS-169's PDA growth and spore shape.
FIG. 7 is a graph solani . This is a systematic analysis graph based on ITS nucleotide sequence information of JS-169.
Figure 8 shows Fusarium < solani . This is a systematic analysis graph based on the TEF1 nucleotide sequence information of JS-169.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다. Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention, and it is to be understood by those skilled in the art that the present invention is not limited thereto It will be obvious.
실시예Example
본 명세서 전체에 걸쳐, 특정 물질의 농도를 나타내기 위하여 사용되는 ““는 별도의 언급이 없는 경우, 고체/고체는 (중량/중량) %, 고체/액체는 (중량/부피) %, 그리고 액체/액체는 (부피/부피) %이다.Throughout this specification, unless otherwise noted, the term "solid / solid" (weight / weight), solid / liquid (weight / volume) / Liquid is (volume / volume)%.
실시예 1. 균주 분리Example 1 Isolation of Strain
항균 및 항진균 활성이 있는 식물 내생균을 수집하기 위해 먼저 식물 시료로 뽕나무 잎을 확보하였다. In order to collect live bacteria in plants with antibacterial and antifungal activity, mulberry leaves were first obtained as plant samples.
[표 1] 기주식물 [Table 1] Host plants
뽕나무 잎은 충북 충주시 살미면에서 채집하였다. 채집한 식물 시료는 흐르는 수돗물로 표면에 붙은 흙먼지를 씻고 물기를 닦은 후, 내생균 분리에 사용하였다. 먼저 잎 조직은 5mm크기의 단편으로, 가지, 줄기 및 뿌리는 1 내지 2mm 폭으로 작게 조각내어 샘플을 채취한 후, 1.5% NaOCl 용액에 3분 동안 살균하고, 다시 70% 에탄올에 2분간 표면 살균하였다. 살균된 샘플 증류수에 1분간 침지한 후 멸균된 페이퍼 타올로 물기를 닦아내고, 균주 분리용 배지에 치상하였다. Mulberry leaves were collected from Salmi area, Chungju, Korea. The collected plant samples were washed with flowing tap water, and the dirt was wiped off and then used for segregation of endogenous bacteria. First, leaf tissue is 5 mm in size. Branches, stems and roots are cut into small pieces with a width of 1 to 2 mm to collect samples. Then, the samples are sterilized in a 1.5% NaOCl solution for 3 minutes and then sterilized in 70% ethanol for 2 minutes Respectively. The sterilized sample was immersed in distilled water for 1 minute, and the water was wiped with a sterilized paper towel.
배지는 50ppm 로즈 벵갈(Rose Bengal), 100ppm 카나마이신(Kanamycin), 100ppm 스트렙토마이신(Streptomycin)을 첨가한 PDA(potato dextrose agar) 배지와 MEA(malt extract agar) 배지를 사용하였다. 5 내지 10일간 배양 후 식물조직에서 자라나오는 균총의 가장자리에서 어린균사를 새로운 PDA 배지에 옮겨 순수 분리하고, 분리된 균주를 넘버링 하고, 이들의 배양액 추출물이 병원성 세균을 대상으로 생장 억제능이 있는지 시험하였다.The medium used was a PDA (potato dextrose agar) medium and a MEA (malt extract agar) medium supplemented with 50 ppm of Rose Bengal, 100 ppm of kanamycin, 100 ppm of streptomycin. After culturing for 5 to 10 days, young mycelium was transferred to a new PDA medium at the edge of the microflora growing in plant tissues, and the separated strains were numbered. The culture extracts of these strains were tested for their ability to inhibit growth by pathogenic bacteria .
실시예 2. 균주 배양 및 유효성분 추출Example 2. Culture of strains and extraction of active ingredient
PD(Potato Dextrose) 브로스(Broth) 500ml에서 상기 실시예 1의 PDA(potato dextrose agar) 배지에서 자란 균사를 잘게 잘라서 접종하고, 23℃, 120rpm으로 진탕 배양하였다. 배양 후 미라클로스(miracloth)를 이용해 균사체를 걸러내고 배양한 여액을 동결 건조하여 증류수 50ml로 현탁하였다. 추출은 2배 부피의 에틸아세테이트(Ethyl acetate)로 1시간씩 3회 진행하였다. 추출물은 감압농축하여 DMSO 용액에 용해한 후 분석에 사용하였다.PD (Potato Dextrose) In 500 ml of Broth, mycelia grown in the PDA (potato dextrose agar) medium of Example 1 were finely cut and inoculated and cultured at 23 ° C with shaking at 120 rpm. After culturing, the mycelium was filtered using miracloth, and the filtrate was freeze-dried and suspended in 50 ml of distilled water. Extraction was carried out in two volumes of ethyl acetate three times for 1 hour each. The extract was dissolved in DMSO solution after concentration under reduced pressure and used for analysis.
실시예 3. 항진균 활성 검정Example 3. Antifungal activity assay
칸디다증 및 크립토코커스증을 유발하는 병원성 진균인 칸디다 알비칸스(Candida albicans), 칸디다 글라브라타(Candida glabrata), 및 크립토코커스 네오포르만스(Cryptococcus neoformans)는 SDB(Sabouraud dexrtrose browth) 배지에서 30℃, 200rpm 조건으로 48시간 동안 배양하였다. 상기 병원성 진균을 각각 1 X 106(conidia/ml) 농도로 희석하여 96 웰 플레이트(well plate)에 접종하고, 상기 실시예 2의 방법으로 추출된 추출물을 각각 500ppm, 100ppm, 50ppm, 및 10ppm 농도로 처리하고, 30℃, 200rpm 조건에서 48시간 동안 배양하였다. 대조군으로 암포테리신 B(Amphotericin B) 10ppm을 컨트롤로 사용하였다.A pathogenic fungus that causes candidiasis, Candida albicans and Cryptococcus Caucus Certificate (Candida albicans , Candida glabrata , and Cryptococcus neoformans ) were cultured in SDB (Sabouraud dextrose broth) medium at 30 ° C and 200 rpm for 48 hours. The pathogenic fungi were each diluted to a concentration of 1 × 10 6 (conidia / ml) and inoculated into a 96-well plate. The extracts obtained by the method of Example 2 were applied at concentrations of 500 ppm, 100 ppm, 50 ppm, and 10 ppm , And cultured at 30 DEG C and 200 rpm for 48 hours. As a control group, 10 ppm of amphotericin B was used as a control.
그 결과, 상기 실시예 1에서 분리되어 JS-169로 넘버링 된 내생균의 추출물을 500ppm으로 처리한 칸디다 알비칸스(Candida albicans)는 처리하지 않은 컨트롤 대비 4% 미만의 생장이 관찰되어 우수한 항진균 효과가 있음이 관찰되었다. 이러한 항진균 효과는 100ppm으로 처리했을 때 24.2%, 50ppm으로 처리했을 때는 31.4%, 10ppm으로 처리했을 때는 80.2%의 생장율을 보여 농도 의존적인 생장 저해율을 보였다(도 1). 컨트롤로 처리된 Amphotericin B 10ppm 처리구는 2%의 생장율을 보였다.As a result, Candida albicans treated with 500 ppm of the extract of endosperm bacterium isolated in Example 1 and numbered JS-169 showed less than 4% growth compared to the untreated control, and excellent antifungal effect . The antifungal effect was 24.2% at 100 ppm, 31.4% at 50 ppm, and 80.2% at 10 ppm, indicating a concentration-dependent growth inhibition rate (FIG. 1). Amphotericin B 10ppm treated with control showed a growth rate of 2%.
또한, JS-169로 넘버링 된 내생균의 추출물을 500ppm으로 처리한 칸디다 글라브라타(Candida glabrata)는 처리하지 않은 컨트롤 대비 14% 미만의 생장이 관찰되어 우수한 항진균 효과가 있음이 관찰되었다. 이러한 항진균 효과는 100ppm으로 처리했을 때 34.5%, 50ppm으로 처리했을 때는 57.5%, 10ppm으로 처리했을 때는 82.3%의 생장율을 보여 농도 의존적인 생장 저해율을 보였다(도 2). 컨트롤로 처리된 Amphotericin B 10ppm 처리구는 1.6%의 생장율을 보였다. In addition, Candida glabrata treated with 500 ppm of the extract of endogenous bacteria numbered JS-169 showed less than 14% growth compared to the untreated control, showing excellent antifungal effect. The antifungal effect was 34.5% at 100 ppm, 57.5% at 50 ppm, and 82.3% at 10 ppm, indicating a concentration-dependent growth inhibition rate (FIG. 2). Amphotericin B 10ppm treated with control showed a growth rate of 1.6%.
마찬가지로, JS-169로 넘버링 된 내생균의 추출물을 500ppm으로 처리한 크립토코커스 네오포르만스(Cryptococcus neoformans)는 처리하지 않은 컨트롤 대비 5% 미만의 생장이 관찰되어 우수한 항진균 효과가 있음이 관찰되었다. 이러한 항진균 효과는 100ppm으로 처리했을 때 0.3%, 50ppm으로 처리했을 때는 26.5%, 10ppm으로 처리했을 때는 96.8%의 생장율을 보여 농도 의존적인 생장저해율을 보였다(도 3). 컨트롤로 처리된 Amphotericin B 10ppm 처리구는 1.7%의 생장율을 보였다.Likewise, Cryptococcus neoformans treated with 500 ppm of the extract of endogenous bacteria numbered JS-169 showed less than 5% growth compared to the untreated control, indicating excellent antifungal effect. This antifungal effect was 0.3% when treated with 100 ppm, 26.5% when treated with 50 ppm, and 96.8% when treated with 10 ppm (FIG. 3). Amphotericin B 10ppm treated with control showed a growth rate of 1.7%.
실시예 4. 항균 활성 검정Example 4. Antibacterial activity assay
대표적인 병원성 균주인 스타필로코커스 아우레우스(Staphylococcus aureus, KCTC1621)와 스트렙토코쿠스 무탄스(Streptococcus mutans, KCTC3065)를 각각 뉴트리언트 브로쓰(Nutrient broth) 배지와 브레인 하트 인퓨젼(Brain heart infustion) 배지에 접종하여 37℃, 200rpm의 조건으로 48시간 동안 배양하였다. 상기 배양된 병원성 균주를 1 X 107CFU/ml 농도로 희석하여 96 웰 플레이트(well plate)에 접종하였다. 상기 실시예 2의 방법으로 추출된 추출물들을 각각 500ppm, 100ppm, 50ppm, 및 10ppm 농도로 처리하고, 37℃, 200rpm의 조건으로 24시간 동안 배양하고, 600nm에서 흡광도를 측정하여 균의 생장을 확인하였다. 대조군으로는 카나마이신(Kanamycin) 50ppm을 사용하였다. Staphylococcus aureus (KCTC1621) and Streptococcus mutans (KCTC3065), representative pathogenic strains, were cultured in Nutrient broth medium and Brain heart infusion medium And cultured at 37 DEG C and 200 rpm for 48 hours. The cultured pathogenic strain was diluted to a concentration of 1 × 10 7 CFU / ml and inoculated into a 96-well plate. The extracts obtained by the method of Example 2 were treated at concentrations of 500 ppm, 100 ppm, 50 ppm and 10 ppm, respectively, cultured at 37 ° C and 200 rpm for 24 hours, and the growth of the bacteria was confirmed by measuring the absorbance at 600 nm . As the control group, 50 ppm of kanamycin was used.
그 결과, 상기 실시예 1에서 분리되어 JS-169로 넘버링 된 내생균의 추출물을 500ppm으로 처리한 스타필로코커스 아우레우스(Staphylococcus aureus)는 처리하지 않은 컨트롤 대비 6% 미만의 생장이 관찰되어 우수한 항균 효과가 있음이 관찰되었다. 이러한 항균 효과는 100ppm으로 처리했을 때 23.3%, 50ppm으로 처리했을 때는 10.2%, 10ppm으로 처리했을 때는 39%의 생장율을 보여 농도 의존적인 생장 저해율을 보였다(도 4). 컨트롤로 처리된 Kanamycin 50ppm 처리구는 3.1%의 생장율을 보였다.As a result, Staphylococcus aureus treated with 500 ppm of the extract of endosperm bacteria isolated in Example 1 and numbered JS-169 showed less than 6% growth compared to the untreated control, Antimicrobial effect was observed. The antimicrobial effect was 23.3% at 100 ppm, 10.2% at 50 ppm, and 39% when treated at 10 ppm, indicating a concentration-dependent growth inhibition rate (FIG. 4). The control treated Kanamycin 50ppm showed a growth rate of 3.1%.
또한, 상기 JS-169로 넘버링 된 내생균의 추출물을 500ppm으로 처리한 스트렙토코쿠스 무탄스(Streptococcus mutans)는 처리하지 않은 컨트롤 대비 1% 미만의 생장이 관찰되어 우수한 항균 효과가 있음이 관찰되었다. 이러한 항균 효과는 100ppm으로 처리했을 때 41.7%, 50ppm으로 처리했을 때는 46.9%, 10ppm으로 처리했을 때는 96.8%의 생장율을 보여 농도 의존적인 생장 저해율을 보였다(도 5). 컨트롤로 처리된 Kanamycin 50ppm 처리구는 19.9%의 생장율을 보였다.In addition, Streptococcus mutans treated with 500 ppm of the extract of the endogenous bacteria numbered JS-169 showed less than 1% growth relative to the untreated control, and thus it was observed that the antimicrobial effect was excellent. The antimicrobial effect was 41.7% at 100 ppm, 46.9% at 50 ppm, and 96.8% at 10 ppm, indicating a concentration-dependent growth inhibition (FIG. 5). The control treated Kanamycin 50ppm showed a growth rate of 19.9%.
실시예 5. 내생균주의 염기서열 분석을 통한 동정Example 5 Identification of Endogenous Strains by Sequence Analysis
상기 실시예 3 및 4에서 항균 및 항진균 효과가 검증된 JS-169 균주의 PDA 고체배지 상에서의 생장모습과 CLA(carnation leaf agar)에서의 포자형성 모습을 확인하고(도 6 참조), 균체로부터 DNA를 분리하였다. 분리된 DNA를 서열번호 3의 ITS1F(CTTGGTCATTTAGAGGAAGTAA) 프라이머와 서열번호 4의 LR5(ATCCTGAGGGAAACTTC) 프라이머를 이용하여 ITS(Internal Transcribed Spacer)와 LSU 영역을 증폭하였고, ITS(ITS-LSU) 염기서열을 확보하였다(Gardes and Bruns, 1993; White et al., 1990). 또한, TEF1 영역은 서열번호 5의 EF-1(ATGGGTAAGGAGGACAAGAC) 프라이머와 서열번호 6의 EF-2(GGAAGTACCAGTGATCATGTT) 프라이머 세트를 이용하여 증폭하여(O'Donnell et al., 1998), 염기서열을 확보하였다. 확보된 염기서열은 서열분석(Sequencher) 프로그램을 이용하여 고품질 영역을 확보하고 조립하여 컨센서스 서열(consensus sequence)을 확정하고, NCBI의 뉴클레오타이드 데이터베이스를 대상으로 BLAST 검색을 수행하였다. 다중정렬 및 계통유연관계 분석은 MEGA 프로그램을 이용하였다.The growth of JS-169 strain on the solid medium of PDA and the formation of sporangia on CLA (carnation leaf agar) of the strains tested for antibacterial and antifungal effects in Examples 3 and 4 (see FIG. 6) . The isolated DNA was amplified with ITS1F (CTTGGTCATTTAGAGGAAGTAA) primer of SEQ ID NO: 3 and LR5 (ATCCTGAGGGAAACTTC) primer of SEQ ID NO: 4 to amplify the internal transcribed spacer (ITS) and LSU region to obtain ITS (ITS-LSU) (Gardes and Bruns, 1993; White et al., 1990). In addition, the TEF1 region was amplified using the EF-1 (ATGGGTAAGGAGGACAAGAC) primer of SEQ ID NO: 5 and the EF-2 (GGAAGTACCAGTGATCATGTT) primer set of SEQ ID NO: 6 (O'Donnell et al., 1998) . The obtained nucleotide sequences were sequenced using a Sequencher program to assure high-quality regions and to assemble a consensus sequence, and BLAST searches were performed on NCBI's nucleotide database. Multiple alignment and phylogenetic relationships were analyzed using the MEGA program.
ITS(ITS-LSU) 염기서열 정보를 바탕으로 수행한 NCBI Blast 검색에서는 푸사리움 솔라니(Fusarium solani)가 가장 높은 상동성을 나타내었다(표2). Fusarium solani showed the highest homology in the NCBI Blast search based on ITS (ITS-LSU) nucleotide sequence information (Table 2).
또한, TEF1 염기서열 정보를 바탕으로 수행한 NCBI Blast 검색에서도 푸사리움 솔라니(Fusarium solani)가 가장 높은 상동성을 나타내었다 (표3).In addition, Fusarium solani showed the highest homology in the NCBI Blast search based on the TEF1 nucleotide sequence information (Table 3).
[표 2] ITS(ITS-LSU) 염기서열 정보를 바탕으로 한 NCBI Blast 검색 결과[Table 2] NCBI Blast search results based on ITS (ITS-LSU) nucleotide sequence information
[표 3] TEF1 염기서열 정보를 바탕으로 한 NCBI Blast 검색 결과[Table 3] NCBI Blast search results based on TEF1 nucleotide sequence information
이를 바탕으로 JS-169 균주의 ITS 서열과 NCBI Gene Bank에 있는 기존 푸사리움 속의 ITS 서열의 계통수를 그려본 결과 JS-169 균주가 푸사리움 속에 속한다는 것을 확인할 수 있었다(도 7). Based on these results, it was confirmed that the JS-169 strain belongs to the genus Fusarium (FIG. 7) by plotting the ITS sequence of the JS-169 strain and the ITS sequence of the genus Fusarium in the NCBI Gene Bank.
이에, 푸사리움 속의 종동정에 사용되는 TEF1 서열을 확보하여 NCBI Gene Bank에 있는 기존 푸사리움 속의 TEF1 서열과 계통수를 그려본 결과, 푸사리움 솔리니(Fusarium solani)와 단계통을 이룬다는 것을 확인하였다(도 8). 따라서, 본 발명자들은 우수한 항균 및 항진균 활성을 갖는 본 발명의 균주를 푸사리움 솔리니(Fusarium solani) JS-169로 명명하고, 국립농업과학원 농업유전자원정보센터에 기탁번호(KACC 83006P)로 기탁하였다. Thus, it was confirmed that the TEF1 sequence used in identification of the fusarium species was obtained and the TEF1 sequence and phylogenetic tree of the genus Fusarium in the NCBI Gene Bank were obtained and found to form a step with Fusarium solani (Fig. 8). Thus, the present inventors shall Fusarium brush the strain of the present invention has excellent antibacterial and antifungal activities (Fusarium solani ) JS-169, and deposited with the National Institute of Agricultural Science and Technology, National Institute of Agricultural Science and Technology, Information Center, KACC 83006P.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.
<110> National Institute of Biological Resources <120> Novel Strain of Fusarium solani JS-169 having anti-bacterial and anti-fungal activity, and uses thereof <130> PN20150113 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 1419 <212> DNA <213> Fusarium sp. <400> 1 gaggaagtaa aagtcgtaac aaggtctccg ttggtgaacc agcggaggga tcattaccga 60 gttatacaac tcatcaaccc tgtgaacata cccaaacgtt gcttcggcgg gaacagacgg 120 ccccgtgaaa cgggccgccc ccgccagagg acccccaact ctgtttctat aatgtttctt 180 ctgagtaaaa caagcaaata aattaaaact ttcaacaacg gatctcttgg ctctggcatc 240 gatgaagaac gcagcgaaat gcgataagta atgtgaattg cagaattcag tgaatcatcg 300 aatctttgaa cgcacattgc gcccgccagt attctggcgg gcatgcctgt tcgagcgtca 360 ttacaaccct caggcccccc cggggcctgg cgttggggat cggcggagcc ccccgcgggc 420 acacgccgtc ccccaaatac agtggcggtc ccgccgcagc ttccatcgcg tagtagctaa 480 cacctcgcga ctggagagcg gcgcggccac gccgtaaaac acccaactct tctgaagttg 540 acctcgaatc aggtaggaat acccgctgaa cttaagcata tcaataagcg gaggaaaaga 600 aaccaacagg gattgcccca gtaacggcga gtgaagcggc aacagctcaa atttgaaatc 660 tggctctcgg gcccgagttg taatttgtag aggatgcttt tggtgaggtg ccttccgagt 720 tccctggaac gggacgccat agagggtgag agccccgtct ggttggacgc cgaacctctg 780 taaagctcct tcgacgagtc gagtagtttg ggaatgctgc tctaaatggg aggtatatgt 840 cttctaaagc taaataccgg ccagagaccg atagcgcaca agtagagtga tcgaaagatg 900 aaaagaactt tgaaaagaga gttaaacagt acgtgaaatt gttgaaaggg aagcgcttgt 960 gaccagactt gggcttggtt gatcatccgg ggttctcccc ggtgcactct tccggcccag 1020 gccagcatca gttcgccctg ggggacaaag gcatcgggaa cgtggctctc tccggggagt 1080 gttatagccc gttgcgtaat accctgcggc ggactgaggt tcgcgcattc gcaaggatgc 1140 tggcgtaatg gtcatcagtg acccgtcttg aaacacggac caaggagtcg tcttcgtatg 1200 cgagtgttcg ggtgtcaaac ccctacgcga aatgaaagtg aacgcaggtg agagcttcgg 1260 cgcatcatcg accgatcctg atgttatcgg atggatttga gtaagagcat acggggccgg 1320 acccgaaaga aggtgaacta tgcctgtgta gggtgaagcc agaggaaact ctggtggagg 1380 ctcgcagcgg ttctgacgtg caaatcgatc gtcaaacat 1419 <210> 2 <211> 1568 <212> DNA <213> Fusarium sp. <400> 2 tatcgacaag cgaaccatcg agaagttcga gaaggttggt gacatctccc tcgatcgcgc 60 cttgctatcc cacatcgaat tccccgtcga attccctcct ccgcgacacg ctctgcgccc 120 gcttctcccg agtcacaaaa attttgcggt tcgaccgtaa tttttttttg gtggggcatt 180 taccccgcca ctcgggcgac gttggacaaa gccctgatcc ctgcacacaa aaacaccaaa 240 ccctcttggc gcgcatcacg tggctcacaa cagacactga ctggttcaac aataggaagc 300 cgctgagctc ggtaagggtt ccttcaagta cgcctgggtc cttgacaagc tcaaggccga 360 gcgtgagcgt ggtatcacca tcgatattgc tctctggaag ttcgagactc cccgctacta 420 tgtcaccgtc attggtatgt cgccgtcatc tctctcactc atgtctcatc actaacaatc 480 aacagacgcc cccggccacc gtgatttcat caagaacatg atcactggta cttcccaggc 540 cgactgcgcc attctcatca ttgccgccgg tactggtgag ttcgaggctg gtatctccaa 600 ggatggccag acccgtgagc acgccctgct cgcctacacc ctcggtgtca agaacctcat 660 tgttgccatc aacaagatgg acaccaccaa gtggtccgag tctcgattcc aggagatcat 720 caaggagacc tccaacttca tcaagaaggt cggctacaac cccaaggctg ttgctttcgt 780 ccccatctcc ggcttcaacg gcgacaacat gcttactccc tccaccaact gcccctggta 840 caagggctgg gagcgtgaga tcaagtccgg caagctcact ggcaagaccc tcctcgaggc 900 cattgactcc attgagcccc ccaagcgccc cgtcgacaag cccctccgtc ttcccctcca 960 ggatgtctac aagatcggtg gtattggcac ggttcccgtc ggccgtatcg agactggtgt 1020 catcaagccc ggtatggtcg ttaccttcgc cccctccaac gtcaccactg aagtcaagtc 1080 cgtcgagatg caccacgagc agctcactga gggtcttccc ggtgacaacg tcggcttcaa 1140 cgtgaagaac gtctccgtca aggagatccg acgtggcaac gtcgctggtg actccaagaa 1200 cgacccccct ctgggtgccg cctctttcac cgcccaggtc attgtcctca accaccctgg 1260 ccaggtcggt gccggttacg cccccgttct ggattgccac actgcccata ttgcctgcaa 1320 gttcgccgag atccaggaga agatcgaccg ccgaactggt aaggctgttg agtccgcccc 1380 caagttcatc aagtctggtg actccgccat cgtcaagatg gttccctcca agcccatgtg 1440 cgttgaggct ttcactgact acccccctct gggccgtttc gctgtccgtg acatgcgaca 1500 gaccgttgct gtcggtgtca tcaaggccgt cgagaaggct gctgctggct ccggcaaggt 1560 caccaagt 1568 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ITS1F primer <400> 3 cttggtcatt tagaggaagt aa 22 <210> 4 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> LR5 primer <400> 4 atcctgaggg aaacttc 17 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EF-1 primer <400> 5 atgggtaagg aggacaagac 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> EF-2 primer <400> 6 ggaagtacca gtgatcatgt t 21 <110> National Institute of Biological Resources <120> Novel Strain of Fusarium solani JS-169 having anti-bacterial and anti-fungal activity, and uses thereof <130> PN20150113 <160> 6 <170> KoPatentin 3.0 <210> 1 <211> 1419 <212> DNA <213> Fusarium sp. <400> 1 gaggaagtaa aagtcgtaac aaggtctccg ttggtgaacc agcggaggga tcattaccga 60 gttatacaac tcatcaaccc tgtgaacata cccaaacgtt gcttcggcgg gaacagacgg 120 ccccgtgaaa cgggccgccc ccgccagagg acccccaact ctgtttctat aatgtttctt 180 ctgagtaaaa caagcaaata aattaaaact ttcaacaacg gatctcttgg ctctggcatc 240 gatgaagaac gcagcgaaat gcgataagta atgtgaattg cagaattcag tgaatcatcg 300 aatctttgaa cgcacattgc gcccgccagt attctggcgg gcatgcctgt tcgagcgtca 360 ttacaaccct caggcccccc cggggcctgg cgttggggat cggcggagcc ccccgcgggc 420 acacgccgtc ccccaaatac agtggcggtc ccgccgcagc ttccatcgcg tagtagctaa 480 cacctcgcga ctggagagcg gcgcggccac gccgtaaaac acccaactct tctgaagttg 540 acctcgaatc aggtaggaat acccgctgaa cttaagcata tcaataagcg gaggaaaaga 600 aaccaacagg gattgcccca gtaacggcga gtgaagcggc aacagctcaa atttgaaatc 660 tggctctcgg gcccgagttg taatttgtag aggatgcttt tggtgaggtg ccttccgagt 720 tccctggaac gggacgccat agagggtgag agccccgtct ggttggacgc cgaacctctg 780 taaagctcct tcgacgagtc gagtagtttg ggaatgctgc tctaaatggg aggtatatgt 840 cttctaaagc taaataccgg ccagagaccg atagcgcaca agtagagtga tcgaaagatg 900 aaaagaactt tgaaaagaga gttaaacagt acgtgaaatt gttgaaaggg aagcgcttgt 960 gaccagactt gggcttggtt gatcatccgg ggttctcccc ggtgcactct tccggcccag 1020 gccagcatca gttcgccctg ggggacaaag gcatcgggaa cgtggctctc tccggggagt 1080 gttatagccc gttgcgtaat accctgcggc ggactgaggt tcgcgcattc gcaaggatgc 1140 tggcgtaatg gtcatcagtg acccgtcttg aaacacggac caaggagtcg tcttcgtatg 1200 cgagtgttcg ggtgtcaaac ccctacgcga aatgaaagtg aacgcaggtg agagcttcgg 1260 cgcatcatcg accgatcctg atgttatcgg atggatttga gtaagagcat acggggccgg 1320 acccgaaaga aggtgaacta tgcctgtgta gggtgaagcc agaggaaact ctggtggagg 1380 ctcgcagcgg ttctgacgtg caaatcgatc gtcaaacat 1419 <210> 2 <211> 1568 <212> DNA <213> Fusarium sp. <400> 2 tatcgacaag cgaaccatcg agaagttcga gaaggttggt gacatctccc tcgatcgcgc 60 cttgctatcc cacatcgaat tccccgtcga attccctcct ccgcgacacg ctctgcgccc 120 gcttctcccg agtcacaaaa attttgcggt tcgaccgtaa tttttttttg gtggggcatt 180 taccccgcca ctcgggcgac gttggacaaa gccctgatcc ctgcacacaa aaacaccaaa 240 ccctcttggc gcgcatcacg tggctcacaa cagacactga ctggttcaac aataggaagc 300 cgctgagctc ggtaagggtt ccttcaagta cgcctgggtc cttgacaagc tcaaggccga 360 gcgtgagcgt ggtatcacca tcgatattgc tctctggaag ttcgagactc cccgctacta 420 tgtcaccgtc attggtatgt cgccgtcatc tctctcactc atgtctcatc actaacaatc 480 aagaacgcc cccggccacc gtgatttcat caagaacatg atcactggta cttcccaggc 540 cgactgcgcc attctcatca ttgccgccgg tactggtgag ttcgaggctg gtatctccaa 600 ggatggccag acccgtgagc acgccctgct cgcctacacc ctcggtgtca agaacctcat 660 tgttgccatc aacaagatgg acaccaccaa gtggtccgag tctcgattcc aggagatcat 720 caaggagacc tccaacttca tcaagaaggt cggctacaac cccaaggctg ttgctttcgt 780 ccccatctcc ggcttcaacg gcgacaacat gcttactccc tccaccaact gcccctggta 840 caagggctgg gagcgtgaga tcaagtccgg caagctcact ggcaagaccc tcctcgaggc 900 cattgactcc attgagcccc ccaagcgccc cgtcgacaag cccctccgtc ttcccctcca 960 ggatgtctac aagatcggtg gtattggcac ggttcccgtc ggccgtatcg agactggtgt 1020 catcaagccc ggtatggtcg ttaccttcgc cccctccaac gtcaccactg aagtcaagtc 1080 cgtcgagatg caccacgagc agctcactga gggtcttccc ggtgacaacg tcggcttcaa 1140 cgtgaagaac gtctccgtca aggagatccg acgtggcaac gtcgctggtg actccaagaa 1200 cgacccccct ctgggtgccg cctctttcac cgcccaggtc attgtcctca accaccctgg 1260 ccaggtcggt gccggttacg cccccgttct ggattgccac actgcccata ttgcctgcaa 1320 gttcgccgag atccaggaga agatcgaccg ccgaactggt aaggctgttg agtccgcccc 1380 caagttcatc aagtctggtg actccgccat cgtcaagatg gttccctcca agcccatgtg 1440 cgttgaggct ttcactgact acccccctct gggccgtttc gctgtccgtg acatgcgaca 1500 gaccgttgct gtcggtgtca tcaaggccgt cgagaaggct gctgctggct ccggcaaggt 1560 caccaagt 1568 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ITS1F primer <400> 3 cttggtcatt tagaggaagt aa 22 <210> 4 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> LR5 primer <400> 4 atcctgaggg aaacttc 17 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EF-1 primer <400> 5 atgggtaagg aggacaagac 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> EF-2 primer <400> 6 ggaagtacca gtgatcatgt t 21
Claims (11)
상기 푸사리움 솔라니(Fusarium solani) 균주 JS-169(수탁번호: KACC 83006P)는 서열번호 1의 ITS(Internal transcribed spacer) 유전자 서열 또는 서열번호 2의 TEF1(translational elongation factor 1) 유전자 서열을 갖는 것을 특징으로 하는 푸사리움 솔라니(Fusarium solani) 균주 JS-169(수탁번호: KACC 83006P).The method according to claim 1,
The Fusarium solani strain JS-169 (accession number: KACC 83006P) has an internal transcribed spacer gene sequence of SEQ ID NO: 1 or a translational elongation factor 1 (TEF1) gene sequence of SEQ ID NO: 2 Fusarium solani strain JS-169 (accession number: KACC 83006P).
스타필로코커스 아우레우스(Staphylococcus aureus) 또는 스트렙토코쿠스 무탄스(Streptococcus mutans)에 대한 항균활성을 갖고, 칸디다 알비칸스(Candida albicans), 칸디다 글라브라타(Candida glabrata), 및 크립토코커스 네오포르만스(Cryptococcus neoformans)에서 선택된 하나 이상에 대해 항진균 활성을 갖는,
항균 및 항진균 조성물.A method for producing a microorganism, which comprises the strain of claim 1 or 2, or a culture thereof as an active ingredient,
Has antibacterial activity against Staphylococcus aureus or Streptococcus mutans, and has antibacterial activity against Candida albicans, Candida glabrata, and Cryptococcus neoform Having antifungal activity against at least one selected from Cryptococcus neoformans,
Antimicrobial and antifungal composition.
스타필로코커스 아우레우스(Staphylococcus aureus) 또는 스트렙토코쿠스 무탄스(Streptococcus mutans) 세균 감염 질환, 또는
칸디다 알비칸스(Candida albicans), 칸디다 글라브라타(Candida glabrata), 및 크립토코커스 네오포르만스(Cryptococcus neoformans)에서 선택된 하나 이상의 진균 감염 질환의 치료용 약학적 조성물. A pharmaceutical composition comprising the antibacterial and antifungal composition of claim 3 as an active ingredient,
Staphylococcus aureus or Streptococcus mutans bacterial infectious disease, or
A pharmaceutical composition for the treatment of one or more fungal infectious diseases selected from Candida albicans, Candida glabrata, and Cryptococcus neoformans.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020150179681A KR101788585B1 (en) | 2015-12-16 | 2015-12-16 | Novel Strain of Fusarium solani JS-169 having anti-bacterial and anti-fungal activity, and uses thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020150179681A KR101788585B1 (en) | 2015-12-16 | 2015-12-16 | Novel Strain of Fusarium solani JS-169 having anti-bacterial and anti-fungal activity, and uses thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20170072372A KR20170072372A (en) | 2017-06-27 |
KR101788585B1 true KR101788585B1 (en) | 2017-10-27 |
Family
ID=59514617
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020150179681A KR101788585B1 (en) | 2015-12-16 | 2015-12-16 | Novel Strain of Fusarium solani JS-169 having anti-bacterial and anti-fungal activity, and uses thereof |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101788585B1 (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2005015399A (en) | 2003-06-26 | 2005-01-20 | Alps Yakuhin Kogyo Kk | Functional material, cosmetic material containing the same, cosmetic, functional food, and fish feed |
-
2015
- 2015-12-16 KR KR1020150179681A patent/KR101788585B1/en active IP Right Grant
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2005015399A (en) | 2003-06-26 | 2005-01-20 | Alps Yakuhin Kogyo Kk | Functional material, cosmetic material containing the same, cosmetic, functional food, and fish feed |
Also Published As
Publication number | Publication date |
---|---|
KR20170072372A (en) | 2017-06-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP6672441B2 (en) | Novel Bacillus beresensis CJBV and antibacterial composition containing the same | |
KR102149973B1 (en) | Antimicrobial and Antifungal Composition Comprising Eugenol and Gallic Acid as Active Ingredient | |
KR102171948B1 (en) | Antimicrobial and Antifungal Composition Composition Comprising Mixture of Herb Essential Oil as Active Ingredient | |
KR102059392B1 (en) | Antimicrobial and Antifungal Composition Containing Clove, Hibiscus, and Coconut Extract Complex as Active Ingredient | |
KR102422611B1 (en) | Antimicrobial composition comprising a novel Bacillus Velezensis strains or compounds isolated therefrom | |
KR101392808B1 (en) | Antibacterial compositions containing plant extracts or fractions | |
KR101430084B1 (en) | Novel antibiotic peptide against Propionibacterium acnes and use therof | |
KR102154252B1 (en) | Composition for Antimicrobial and Antifungal Comprising Baicalein and Wogonin as Active Ingredient | |
KR20140055959A (en) | Antibiotic composition containing antibiotic microbial fermented extracts | |
KR102163969B1 (en) | Cosmetic Compositions Containing Fermented Extracts of Vernicia fordii | |
KR101788585B1 (en) | Novel Strain of Fusarium solani JS-169 having anti-bacterial and anti-fungal activity, and uses thereof | |
KR102068470B1 (en) | Novel Strain of Arthrinium sp. JS0567 Having Anti-Fungal and Anti- inflammatory Activity, and Uses thereof | |
KR102408301B1 (en) | Novel Strain of Streptomyces sp. SBC-4 Having Anti-bacterial Activity, and Uses thereof | |
KR102155716B1 (en) | A carrot fermentation method using lactobacillus plantarum ami-1103 strain | |
KR20190050357A (en) | Composition for improving microbial flora containing extract of Rosae Multiflorae fructus | |
KR101983575B1 (en) | Novel Strain of Ceratobasidium sp. JS1289 Having Anti-Fungal and Anti- inflammatory Activity, and Uses thereof | |
KR101151878B1 (en) | Fatty Acid Tripeptide Salt and Antimicrobial Composition Containing the Same | |
KR102461715B1 (en) | Novel Strain of Penicillium bissettii with Anti-bacterial and Anti-fungal Activity and Uses thereof | |
KR101392810B1 (en) | Antibacterial compositions containing plant extracts or fractions | |
KR20140099223A (en) | Antimicrobial Composition Using an Plant Extract | |
CN109674806B (en) | Application of kasugamycin in preparation of antibacterial drugs | |
KR102695442B1 (en) | Antibacterial and antifungal composition containing Rosa damascena oil | |
KR102708790B1 (en) | Selective antimicrobial use of Micrococcus porci | |
KR102364548B1 (en) | Strain of Polyporus ulleungus having anti-bacterial and dye-decolorizing activity, and uses thereof | |
KR20180059296A (en) | Composition Containing Terminalia Chebula Extract and Artemisia Extract for Controlling Skin Bacterial Flora Growth, or Enhancing Skin Immunity |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |