KR101788585B1 - Novel Strain of Fusarium solani JS-169 having anti-bacterial and anti-fungal activity, and uses thereof - Google Patents

Abstract

The present invention relates to a Fusarium solanii strain having antibacterial and antifungal activity and its use.
The endogenous strain according to the present invention or the culture thereof exhibits excellent antibacterial and antifungal activity through directly influencing harmful microorganisms, and thus can be usefully used for pharmaceutical compositions, cosmetic compositions, preservatives for food or feed preservation, and the like.

Description

Fusarium solani JS-169 having novel antibacterial and antifungal activity and use thereof <br> <br> Patents Register Register |

The present invention relates to a novel strain, Fusarium solani, which is characterized by exhibiting novel antibacterial and antifungal activity, and a composition for an antibacterial and antifungal agent containing it as an active ingredient.

Some of the substances that play an important role in maintaining the homeostasis of organisms are physiologically active substances derived from various organisms. Numerous studies on physiologically active substances have been carried out so far. Among them, studies on antimicrobial and antifungal substances are very important fields in life sciences and medicine.

All living organisms are known to produce antimicrobial and antifungal substances for survival. Many studies have been conducted on microorganisms that produce antimicrobial and antifungal substances. Using microorganisms that produce antimicrobial and antifungal substances, or materials isolated from them Studies to develop antibacterial or antifungal agents have long been attempted.

On the other hand, live bacteria in plants are microorganisms in which part of life history coexists without causing external transformation to healthy plant tissue. The symbiosis of living organisms can be defined as a symbiotic continuum in terms of symbiotic, convenient symbiotic and parasitic depending on the interrelationship with host plants, that is, the characteristics and environmental influences of host organisms and host plant partners. Mycorrhizae may have a beneficial effect on plants such as promoting growth of host plants, increasing resistance to pest insects, increasing adaptability to environmental changes such as cold weather and drying, and promoting metabolism formation. In some cases, however, It acts as a primary decomposer of the dead plant tissue and promotes ecosystem material circulation.

In addition, live bacteria in plants are known to produce useful secondary metabolites that have activities such as anticancer or antibacterial activity. The most representative example is Taxomyces andreanae, a taxane isolated from a tree, It is an endogenous bacillus producing paclitaxel which is getting attention. Due to the commercial success of these endophytic bacteria, research and development efforts have been continuously carried out to find new live bacteria in a new plant having various physiologically active substances with various pharmacological effects.

Fusarium ( Fusarium) solani) ascus bacterium door (Ascomycota), sordariomycetes (Sordariomycetes), Cordyceps neck (Hypocreales), Al linden mushrooms and (Nectriaceae), a fungus belonging to Fusarium genus (Fusarium) is found in the debris of soil and plants of various plants It is known as pathogens or live bacteria in plants.

It is known that fusarium mucilage produces various biologically active substances (fusarubin, anhydro-fusarubin, javanicin, methyl ether-fusarubin, marticin, isomarticin, ethyl ether-fusarubin, solaniol and nectriafusarubinm dihydro-fusarubin lactone) nematicidal, phytotoxin, and antitumor have been reported to be effective.

However, despite the results of these studies, the research results related to the development of new antibacterial and antifungal agents using live bacteria in plants are still insufficient, and it is urgent to find the live bacteria in plant origin which are highly commercialized because of their excellent antibacterial and antifungal effect.

Under these circumstances, the present inventors have made intensive efforts to find new endogenous mycorrhizae having antibacterial and antifungal activity. As a result, the new endogenous strains of fusarium genus isolated from mulberry leaves, which are inhabited throughout Korea, have excellent antibacterial and antifungal activity Antimicrobial agent, and antifungal agent, and completed the present invention.

Therefore, a main object of the present invention is to provide live bacteria in plants having antibacterial and antifungal activity.

It is another object of the present invention to provide an antibacterial and antifungal agent composition using live bacteria in the plant.

In order to achieve the above object, the present invention provides Fusarium solani strain JS-169 (accession number: KACC 83006P) having antibacterial and antifungal activity.

The term " Fusarium solani strain JS-169 "of the present invention is a novel Fusarium solanii strain newly isolated and identified by the present inventors in a domestic wild plant, It can be used in combination with "JS-169".

The present inventors have investigated the antifungal and antimicrobial effects of endogenous live bacteria isolated from various plants native to Korea for the development of new antimicrobial agents and antifungal agents. As a result, they found that the antifungal and antimicrobial effects of the endogenous strains derived from Korean wild mulberry (See Figs. 1 to 5).

The Fusarium solani strain JS-169 (accession number: KACC 83006P) of the present invention has the ITS gene sequence of SEQ ID NO: 1 or the TEF1 (translational elongation factor 1) gene sequence of SEQ ID NO: 2 do.

As a result of comparing the gene sequence with the gene sequences of known strains, the present inventors confirmed that the strain of the present invention is a new strain belonging to Fusarium solanii and named it Fusarium solani strain JS-169, It was deposited on December 2, 2015 with the grant number KACC 83006P at the National Institute of Agricultural Science and Technology.

In accordance with another aspect of the present invention, the present invention provides a method for producing the Fusarium solani solani ) strain JS-169, or a culture thereof as an active ingredient.

In the present invention, the Fusarium solani JS-169 strain or a culture thereof is characterized by exhibiting antifungal activity and antibacterial activity by itself.

The Fusarium solani strain JS-169 or the culture medium are the antifungal activity against a variety of fungi, in particular has an antifungal activity against Candida or Cryptococcus genus Rhodococcus genus fungi, more specifically from Candida albicans (Candida albicans , Candida glabrata and Cryptococcus neoformans , but are not limited thereto (Figures 1 to 3).

In addition, the Fusarium solanaceae strain JS-169 or the culture thereof has antibacterial activity against various fungi. The strain of the present invention or its culture has antimicrobial activity against Gram-positive bacteria, Gram-negative bacteria and antibiotic-resistant strains, and specifically has antibacterial activity against Staphylococcus spp. Or Streptococcus spp., More specifically, Staphylococcus aureus , Streptococcus mutans , and the like, but the present invention is not limited thereto (Figs. 4 and 5).

In one embodiment of the present invention, it has been confirmed that the extract of the endogenous culture solution according to the present invention has a growth inhibitory effect against various pathogenic fungi and pathogenic bacteria.

According to another aspect of the present invention, there is provided a pharmaceutical composition for antibacterial and antifungal use comprising the Fusarium solani strain JS-169 or a culture thereof as an active ingredient. The Fusarium solani strain JS-169 of the present invention or its culture liquid exhibits excellent antibacterial and antifungal activity through direct influence on harmful microorganisms, and thus can be usefully used as a pharmaceutical composition for antibacterial and antifungal use.

Meanwhile, the extract of the Fusarium solani strain culture of the present invention can be prepared in the form of a pharmaceutically acceptable salt. Specifically, a salt can be formed by adding an acid, and examples thereof include salts with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid and the like, organic carboxylic acids such as acetic acid and halo such as trifluoroacetic acid (Such as acetic acid, propionic acid, maleic acid, succinic acid, malic acid, citric acid, tartaric acid, salicylic acid) and acidic sugars (glucuronic acid, galacturonic acid, gluconic acid, ascorbic acid), acidic polysaccharides (such as hyaluronic acid, chondroitin sulfate, Arginic acid), and organic sulfonic acids (e.g., methane, sulfonic acid, and p-toluenesulfonic acid) including sulfonic acid esters such as chondroitin sulfate.

The Fusarium solani strain JS-169 of the present invention or the culture thereof is an endogenous bacterium isolated from an edible mulberry leaf and can be administered orally or parenterally when it is clinically administered and can be used in the form of a general pharmaceutical preparation.

That is, the new strain JS-169 of the present invention or its culture can be administered by various oral or parenteral formulations. In the case of formulation, the filler, the extender, the binder, the wetting agent, the disintegrant, Diluent or excipient. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. As a suppository base, witepsol, macrogol, tween 61, cacao paper, Liu ling, glycerogelatin and the like can be used.

In addition, the novel strain JS-169 of the present invention or a culture thereof can be used in combination with various carriers permitted as medicaments such as physiological saline or an organic solvent, and can be used in combination with glucose, sucrose, Antioxidants such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins or other stabilizers such as carbohydrates such as tran can be used as pharmaceuticals.

The effective dose of the novel strain JS-169 of the present invention or the culture thereof is 0.01 to 10 mg / kg, preferably 0.1 to 1 mg / kg, and can be administered once to three times a day.

In a pharmaceutical composition of the present invention or a culture thereof, the total effective amount may be administered to a patient in a single dose, such as by bolus injection or by infusion for a relatively short period of time, (multiple does) may be administered by a fractionated treatment protocol administered over a prolonged period of time. Since the concentration of the effective dose of the patient is determined in consideration of various factors such as the route of administration and the number of treatments as well as the age and health condition of the patient, in view of this point, Lt; RTI ID = 0.0 &gt; JS-169 &lt; / RTI &gt; or its pharmaceutical composition as a pharmaceutical composition.

According to still another aspect of the present invention, there is provided an antibacterial and antifungal cosmetic composition containing Fusarium solani strain JS-169 or a culture thereof having an antibacterial and antifungal activity as an active ingredient.

Since the novel strain JS-169 of the present invention or its culture liquid exhibits excellent antibacterial and antifungal activity through directly influencing harmful microorganisms, it can be effectively used as a cosmetic composition for antibacterial and antifungal use.

The cosmetic composition of the present invention contains, as an active ingredient, components commonly used in cosmetic compositions in addition to the above-mentioned new strain JS-169 or a culture thereof, and includes conventional components such as antioxidants, stabilizers, solubilizers, vitamins, Supplements, and carriers.

The cosmetic composition of the present invention can be prepared into any of the formulations conventionally produced in the art and can be used in the form of solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, , Oil, powder foundation, emulsion foundation, wax foundation and spray, but is not limited thereto. More specifically, it can be manufactured in the form of a flexible lotion (skin), a nutritional lotion (milk lotion), a nutritional cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray or a powder .

When the formulation of the present invention is a paste, a cream or a gel, an animal oil, vegetable oil, wax, paraffin, starch, tragacantha, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide .

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In the case of a spray, in particular, / Propane or dimethyl ether.

When the formulation of the present invention is a solution or an emulsion, a solvent, a dissolving agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, , 3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan fatty acid esters.

In the case where the formulation of the present invention is a suspension, a carrier such as water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Cellulose, aluminum metahydroxide, bentonite, agar or tragacantha, etc. may be used.

When the formulation of the present invention is an interfacial active agent-containing cleansing, the carrier component is selected from aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters.

Specific examples of the cosmetics of the present invention include eye creams, cleansing creams, cleansing milks, cleansing lotions, massage creams, cold creams, moisturizing creams, milks, lotions, packs, after-shave creams, sunscreen- Hair shampoo, hair shampoo, hair rinse, hair treatment, hair dye, hair dye, hair cream, hair liquid, set lotion, hair spray, hair bridge, color rinse, color spray, permanent wave liquid, press powder, loose powder , Eye shadow, hand cream, lipstick, and the like.

According to still another aspect of the present invention, there is provided a food or feed preserving composition containing Fusarium solani strain JS-169 or a culture thereof having an antibacterial and antifungal activity as an active ingredient.

A food or feed preservative is an additive used to prevent deterioration, decay, discoloration and chemical change of food or feed. It includes antiseptic and antioxidant, and inhibits the growth of microorganisms such as bacteria, fungi and yeast. , Cosmetics, medicines and the like, as well as functional antimicrobial agents such as inhibiting the growth of microorganisms or sterilizing them. Ideal conditions for preserving food or feed should not be toxic and should be effective in trace amounts. Fusa of the invention Solarium solani (Fusarium solani ) strain JS-169 or a culture thereof exhibits excellent antibacterial and antifungal activity through directly influencing harmful microorganisms, and thus can be widely used as preservatives, cosmetic preservatives, and drug preservatives for the above food or feed.

According to yet another aspect of the present invention, the present invention provides a method for producing the Fusarium solani solani ) strain JS-169 or a culture thereof to an individual in need of treatment to kill the pathogenic bacteria. The present invention provides a method for treating a bacterial or fungal infectious disease in an animal other than human, do.

The method of treatment according to the present invention does not mean that a method of treating an animal other than a human, but such a treatment method is ineffective in humans. In addition, in the case of humans, considering the fact that a symptom may be improved by administration of the therapeutic composition according to the present invention, a disease caused by a bacterium or a fungal infection can be sufficiently used in the treatment of humans.

In the present invention, the term "animal excluding human beings" refers to animals, such as horses, sheep, pigs, and goats, except for humans having a disease caused by infection with bacteria or fungi, , Camel, nutrition, and dog. By administering the therapeutic composition of the present invention to an animal other than a human, diseases caused by bacterial and fungal infections can be effectively prevented and treated.

The term "administering" in the present invention means introducing a predetermined substance into an animal by any appropriate method, and the administration route of the therapeutic composition according to the present invention may be administered orally, May be administered parenterally. In addition, the therapeutic composition according to the present invention may be administered by any device capable of moving the active ingredient into the target cell.

The preferable dosage of the therapeutic composition according to the present invention varies depending on the condition and body weight of the animal to be treated, the degree of disease, the type of drug, route of administration and period of time, but can be appropriately selected by those skilled in the art. However, for the desired effect, the pharmaceutical composition of the present invention is 0.01 to 10 mg / kg, preferably 0.1 to 1 mg / kg, and can be administered once to three times a day.

The features and advantages of the present invention are summarized as follows:

(I) The present invention provides an antibacterial and antifungal composition comprising Fusarium solani JS-169 strain derived from mulberry leaf or a culture thereof as an active ingredient.

(Ii) The Fusarium solani JS-169 strain of the present invention or a composition comprising the culture thereof exhibits a broad spectrum of antimicrobial and antifungal spectrum against various fungi. The composition of the present invention is useful for various bacterial infectious diseases caused by harmful bacteria .

(Iii) Furthermore, the composition of the present invention is useful for antibacterial, antifungal and antiseptic purposes in various fields such as cosmetic composition, food or feed preservative additive composition, and the like.

1 is a Candida Fusarium for albicans solani &lt; / RTI &gt; JS-169.
2 is a Candida Fusarium for glabrata solani JS-169 &lt; / RTI &gt;
FIG. 3 shows that Cryptococcus Fusarium for neoformans solani &lt; / RTI &gt; JS-169.
Figure 4 is a graph showing the effect of Staphylococcus aureus Fusarium solani &lt; / RTI &gt; JS-169.
5 is Fusarium on Streptococcus mutans solani &lt; / RTI &gt; JS-169.
6 is a Fusarium solani . It is a picture of JS-169's PDA growth and spore shape.
FIG. 7 is a graph solani . This is a systematic analysis graph based on ITS nucleotide sequence information of JS-169.
Figure 8 shows Fusarium &lt; solani . This is a systematic analysis graph based on the TEF1 nucleotide sequence information of JS-169.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention, and it is to be understood by those skilled in the art that the present invention is not limited thereto It will be obvious.

Example

Throughout this specification, unless otherwise noted, the term "solid / solid" (weight / weight), solid / liquid (weight / volume) / Liquid is (volume / volume)%.

Example 1 Isolation of Strain

In order to collect live bacteria in plants with antibacterial and antifungal activity, mulberry leaves were first obtained as plant samples.

[Table 1] Host plants

Mulberry leaves were collected from Salmi area, Chungju, Korea. The collected plant samples were washed with flowing tap water, and the dirt was wiped off and then used for segregation of endogenous bacteria. First, leaf tissue is 5 mm in size. Branches, stems and roots are cut into small pieces with a width of 1 to 2 mm to collect samples. Then, the samples are sterilized in a 1.5% NaOCl solution for 3 minutes and then sterilized in 70% ethanol for 2 minutes Respectively. The sterilized sample was immersed in distilled water for 1 minute, and the water was wiped with a sterilized paper towel.

The medium used was a PDA (potato dextrose agar) medium and a MEA (malt extract agar) medium supplemented with 50 ppm of Rose Bengal, 100 ppm of kanamycin, 100 ppm of streptomycin. After culturing for 5 to 10 days, young mycelium was transferred to a new PDA medium at the edge of the microflora growing in plant tissues, and the separated strains were numbered. The culture extracts of these strains were tested for their ability to inhibit growth by pathogenic bacteria .

Example 2. Culture of strains and extraction of active ingredient

PD (Potato Dextrose) In 500 ml of Broth, mycelia grown in the PDA (potato dextrose agar) medium of Example 1 were finely cut and inoculated and cultured at 23 ° C with shaking at 120 rpm. After culturing, the mycelium was filtered using miracloth, and the filtrate was freeze-dried and suspended in 50 ml of distilled water. Extraction was carried out in two volumes of ethyl acetate three times for 1 hour each. The extract was dissolved in DMSO solution after concentration under reduced pressure and used for analysis.

Example 3. Antifungal activity assay

A pathogenic fungus that causes candidiasis, Candida albicans and Cryptococcus Caucus Certificate (Candida albicans , Candida glabrata , and Cryptococcus neoformans ) were cultured in SDB (Sabouraud dextrose broth) medium at 30 ° C and 200 rpm for 48 hours. The pathogenic fungi were each diluted to a concentration of 1 × 10 ⁶ (conidia / ml) and inoculated into a 96-well plate. The extracts obtained by the method of Example 2 were applied at concentrations of 500 ppm, 100 ppm, 50 ppm, and 10 ppm , And cultured at 30 DEG C and 200 rpm for 48 hours. As a control group, 10 ppm of amphotericin B was used as a control.

As a result, Candida albicans treated with 500 ppm of the extract of endosperm bacterium isolated in Example 1 and numbered JS-169 showed less than 4% growth compared to the untreated control, and excellent antifungal effect . The antifungal effect was 24.2% at 100 ppm, 31.4% at 50 ppm, and 80.2% at 10 ppm, indicating a concentration-dependent growth inhibition rate (FIG. 1). Amphotericin B 10ppm treated with control showed a growth rate of 2%.

In addition, Candida glabrata treated with 500 ppm of the extract of endogenous bacteria numbered JS-169 showed less than 14% growth compared to the untreated control, showing excellent antifungal effect. The antifungal effect was 34.5% at 100 ppm, 57.5% at 50 ppm, and 82.3% at 10 ppm, indicating a concentration-dependent growth inhibition rate (FIG. 2). Amphotericin B 10ppm treated with control showed a growth rate of 1.6%.

Likewise, Cryptococcus neoformans treated with 500 ppm of the extract of endogenous bacteria numbered JS-169 showed less than 5% growth compared to the untreated control, indicating excellent antifungal effect. This antifungal effect was 0.3% when treated with 100 ppm, 26.5% when treated with 50 ppm, and 96.8% when treated with 10 ppm (FIG. 3). Amphotericin B 10ppm treated with control showed a growth rate of 1.7%.

Example 4. Antibacterial activity assay

Staphylococcus aureus (KCTC1621) and Streptococcus mutans (KCTC3065), representative pathogenic strains, were cultured in Nutrient broth medium and Brain heart infusion medium And cultured at 37 DEG C and 200 rpm for 48 hours. The cultured pathogenic strain was diluted to a concentration of 1 × 10 ⁷ CFU / ml and inoculated into a 96-well plate. The extracts obtained by the method of Example 2 were treated at concentrations of 500 ppm, 100 ppm, 50 ppm and 10 ppm, respectively, cultured at 37 ° C and 200 rpm for 24 hours, and the growth of the bacteria was confirmed by measuring the absorbance at 600 nm . As the control group, 50 ppm of kanamycin was used.

As a result, Staphylococcus aureus treated with 500 ppm of the extract of endosperm bacteria isolated in Example 1 and numbered JS-169 showed less than 6% growth compared to the untreated control, Antimicrobial effect was observed. The antimicrobial effect was 23.3% at 100 ppm, 10.2% at 50 ppm, and 39% when treated at 10 ppm, indicating a concentration-dependent growth inhibition rate (FIG. 4). The control treated Kanamycin 50ppm showed a growth rate of 3.1%.

In addition, Streptococcus mutans treated with 500 ppm of the extract of the endogenous bacteria numbered JS-169 showed less than 1% growth relative to the untreated control, and thus it was observed that the antimicrobial effect was excellent. The antimicrobial effect was 41.7% at 100 ppm, 46.9% at 50 ppm, and 96.8% at 10 ppm, indicating a concentration-dependent growth inhibition (FIG. 5). The control treated Kanamycin 50ppm showed a growth rate of 19.9%.

Example 5 Identification of Endogenous Strains by Sequence Analysis

The growth of JS-169 strain on the solid medium of PDA and the formation of sporangia on CLA (carnation leaf agar) of the strains tested for antibacterial and antifungal effects in Examples 3 and 4 (see FIG. 6) . The isolated DNA was amplified with ITS1F (CTTGGTCATTTAGAGGAAGTAA) primer of SEQ ID NO: 3 and LR5 (ATCCTGAGGGAAACTTC) primer of SEQ ID NO: 4 to amplify the internal transcribed spacer (ITS) and LSU region to obtain ITS (ITS-LSU) (Gardes and Bruns, 1993; White et al., 1990). In addition, the TEF1 region was amplified using the EF-1 (ATGGGTAAGGAGGACAAGAC) primer of SEQ ID NO: 5 and the EF-2 (GGAAGTACCAGTGATCATGTT) primer set of SEQ ID NO: 6 (O'Donnell et al., 1998) . The obtained nucleotide sequences were sequenced using a Sequencher program to assure high-quality regions and to assemble a consensus sequence, and BLAST searches were performed on NCBI's nucleotide database. Multiple alignment and phylogenetic relationships were analyzed using the MEGA program.

Fusarium solani showed the highest homology in the NCBI Blast search based on ITS (ITS-LSU) nucleotide sequence information (Table 2).

In addition, Fusarium solani showed the highest homology in the NCBI Blast search based on the TEF1 nucleotide sequence information (Table 3).

[Table 2] NCBI Blast search results based on ITS (ITS-LSU) nucleotide sequence information

[Table 3] NCBI Blast search results based on TEF1 nucleotide sequence information

Based on these results, it was confirmed that the JS-169 strain belongs to the genus Fusarium (FIG. 7) by plotting the ITS sequence of the JS-169 strain and the ITS sequence of the genus Fusarium in the NCBI Gene Bank.

Thus, it was confirmed that the TEF1 sequence used in identification of the fusarium species was obtained and the TEF1 sequence and phylogenetic tree of the genus Fusarium in the NCBI Gene Bank were obtained and found to form a step with Fusarium solani (Fig. 8). Thus, the present inventors shall Fusarium brush the strain of the present invention has excellent antibacterial and antifungal activities (Fusarium solani ) JS-169, and deposited with the National Institute of Agricultural Science and Technology, National Institute of Agricultural Science and Technology, Information Center, KACC 83006P.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

National Institute of Agricultural Science and Technology KACC83006P 20151202

<110> National Institute of Biological Resources <120> Novel Strain of Fusarium solani JS-169 having anti-bacterial and          anti-fungal activity, and uses thereof <130> PN20150113 <160> 6 <170> KoPatentin 3.0 <210> 1 <211> 1419 <212> DNA <213> Fusarium sp. <400> 1 gaggaagtaa aagtcgtaac aaggtctccg ttggtgaacc agcggaggga tcattaccga 60 gttatacaac tcatcaaccc tgtgaacata cccaaacgtt gcttcggcgg gaacagacgg 120 ccccgtgaaa cgggccgccc ccgccagagg acccccaact ctgtttctat aatgtttctt 180 ctgagtaaaa caagcaaata aattaaaact ttcaacaacg gatctcttgg ctctggcatc 240 gatgaagaac gcagcgaaat gcgataagta atgtgaattg cagaattcag tgaatcatcg 300 aatctttgaa cgcacattgc gcccgccagt attctggcgg gcatgcctgt tcgagcgtca 360 ttacaaccct caggcccccc cggggcctgg cgttggggat cggcggagcc ccccgcgggc 420 acacgccgtc ccccaaatac agtggcggtc ccgccgcagc ttccatcgcg tagtagctaa 480 cacctcgcga ctggagagcg gcgcggccac gccgtaaaac acccaactct tctgaagttg 540 acctcgaatc aggtaggaat acccgctgaa cttaagcata tcaataagcg gaggaaaaga 600 aaccaacagg gattgcccca gtaacggcga gtgaagcggc aacagctcaa atttgaaatc 660 tggctctcgg gcccgagttg taatttgtag aggatgcttt tggtgaggtg ccttccgagt 720 tccctggaac gggacgccat agagggtgag agccccgtct ggttggacgc cgaacctctg 780 taaagctcct tcgacgagtc gagtagtttg ggaatgctgc tctaaatggg aggtatatgt 840 cttctaaagc taaataccgg ccagagaccg atagcgcaca agtagagtga tcgaaagatg 900 aaaagaactt tgaaaagaga gttaaacagt acgtgaaatt gttgaaaggg aagcgcttgt 960 gaccagactt gggcttggtt gatcatccgg ggttctcccc ggtgcactct tccggcccag 1020 gccagcatca gttcgccctg ggggacaaag gcatcgggaa cgtggctctc tccggggagt 1080 gttatagccc gttgcgtaat accctgcggc ggactgaggt tcgcgcattc gcaaggatgc 1140 tggcgtaatg gtcatcagtg acccgtcttg aaacacggac caaggagtcg tcttcgtatg 1200 cgagtgttcg ggtgtcaaac ccctacgcga aatgaaagtg aacgcaggtg agagcttcgg 1260 cgcatcatcg accgatcctg atgttatcgg atggatttga gtaagagcat acggggccgg 1320 acccgaaaga aggtgaacta tgcctgtgta gggtgaagcc agaggaaact ctggtggagg 1380 ctcgcagcgg ttctgacgtg caaatcgatc gtcaaacat 1419 <210> 2 <211> 1568 <212> DNA <213> Fusarium sp. <400> 2 tatcgacaag cgaaccatcg agaagttcga gaaggttggt gacatctccc tcgatcgcgc 60 cttgctatcc cacatcgaat tccccgtcga attccctcct ccgcgacacg ctctgcgccc 120 gcttctcccg agtcacaaaa attttgcggt tcgaccgtaa tttttttttg gtggggcatt 180 taccccgcca ctcgggcgac gttggacaaa gccctgatcc ctgcacacaa aaacaccaaa 240 ccctcttggc gcgcatcacg tggctcacaa cagacactga ctggttcaac aataggaagc 300 cgctgagctc ggtaagggtt ccttcaagta cgcctgggtc cttgacaagc tcaaggccga 360 gcgtgagcgt ggtatcacca tcgatattgc tctctggaag ttcgagactc cccgctacta 420 tgtcaccgtc attggtatgt cgccgtcatc tctctcactc atgtctcatc actaacaatc 480 aagaacgcc cccggccacc gtgatttcat caagaacatg atcactggta cttcccaggc 540 cgactgcgcc attctcatca ttgccgccgg tactggtgag ttcgaggctg gtatctccaa 600 ggatggccag acccgtgagc acgccctgct cgcctacacc ctcggtgtca agaacctcat 660 tgttgccatc aacaagatgg acaccaccaa gtggtccgag tctcgattcc aggagatcat 720 caaggagacc tccaacttca tcaagaaggt cggctacaac cccaaggctg ttgctttcgt 780 ccccatctcc ggcttcaacg gcgacaacat gcttactccc tccaccaact gcccctggta 840 caagggctgg gagcgtgaga tcaagtccgg caagctcact ggcaagaccc tcctcgaggc 900 cattgactcc attgagcccc ccaagcgccc cgtcgacaag cccctccgtc ttcccctcca 960 ggatgtctac aagatcggtg gtattggcac ggttcccgtc ggccgtatcg agactggtgt 1020 catcaagccc ggtatggtcg ttaccttcgc cccctccaac gtcaccactg aagtcaagtc 1080 cgtcgagatg caccacgagc agctcactga gggtcttccc ggtgacaacg tcggcttcaa 1140 cgtgaagaac gtctccgtca aggagatccg acgtggcaac gtcgctggtg actccaagaa 1200 cgacccccct ctgggtgccg cctctttcac cgcccaggtc attgtcctca accaccctgg 1260 ccaggtcggt gccggttacg cccccgttct ggattgccac actgcccata ttgcctgcaa 1320 gttcgccgag atccaggaga agatcgaccg ccgaactggt aaggctgttg agtccgcccc 1380 caagttcatc aagtctggtg actccgccat cgtcaagatg gttccctcca agcccatgtg 1440 cgttgaggct ttcactgact acccccctct gggccgtttc gctgtccgtg acatgcgaca 1500 gaccgttgct gtcggtgtca tcaaggccgt cgagaaggct gctgctggct ccggcaaggt 1560 caccaagt 1568 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ITS1F primer <400> 3 cttggtcatt tagaggaagt aa 22 <210> 4 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> LR5 primer <400> 4 atcctgaggg aaacttc 17 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EF-1 primer <400> 5 atgggtaagg aggacaagac 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> EF-2 primer <400> 6 ggaagtacca gtgatcatgt t 21

Claims (11)

Has antibacterial activity against Staphylococcus aureus or Streptococcus mutans, and has antibacterial activity against Candida albicans, Candida glabrata, and Cryptococcus neoform Fusarium solani strain JS-169 (accession number: KACC 83006P) having antifungal activity against at least one selected from Cryptococcus neoformans. The method according to claim 1,
The Fusarium solani strain JS-169 (accession number: KACC 83006P) has an internal transcribed spacer gene sequence of SEQ ID NO: 1 or a translational elongation factor 1 (TEF1) gene sequence of SEQ ID NO: 2 Fusarium solani strain JS-169 (accession number: KACC 83006P). A method for producing a microorganism, which comprises the strain of claim 1 or 2, or a culture thereof as an active ingredient,
Has antibacterial activity against Staphylococcus aureus or Streptococcus mutans, and has antibacterial activity against Candida albicans, Candida glabrata, and Cryptococcus neoform Having antifungal activity against at least one selected from Cryptococcus neoformans,
Antimicrobial and antifungal composition. delete delete delete delete A pharmaceutical composition comprising the antibacterial and antifungal composition of claim 3 as an active ingredient,
Staphylococcus aureus or Streptococcus mutans bacterial infectious disease, or
A pharmaceutical composition for the treatment of one or more fungal infectious diseases selected from Candida albicans, Candida glabrata, and Cryptococcus neoformans. A cosmetic composition comprising the antibacterial and antifungal composition of claim 3 as an active ingredient. A preservative composition for food or food preservation containing the antibacterial and antifungal composition of claim 3 as an active ingredient. A method of treating a bacterial or fungal infection disease in an animal other than a human, comprising the step of administering the antibacterial and antifungal composition of claim 3 to a subject in need of treatment to kill pathogenic bacteria.

Images