KR101983575B1 - Novel Strain of Ceratobasidium sp. JS1289 Having Anti-Fungal and Anti- inflammatory Activity, and Uses thereof - Google Patents

Abstract

The present invention relates to a Ceratobasidium sp. strain having anti-fungal and anti-inflammatory activities and uses thereof. An endophytic strain or culture thereof according to the present invention exhibits excellent anti-inflammatory activities and anti-fungal activities through direct influence on harmful microorganisms, and thus can be used for various purposes such as a pharmaceutical composition, a cosmetic composition, a preservative for preserving food or feed.

Description

Novel strain of Ceratobasidium sp. ≪ RTI ID = 0.0 > JS1289 < / RTI > JS1289 Having Anti-Fungal and Anti- inflammatory Activity, and Uses thereof}

The present invention relates to a novel strain JS1289 of the genus Ceratobacillus, which is characterized by exhibiting antifungal and antiinflammatory activity, and an antifungal and antiinflammatory composition containing it as an active ingredient.

Some of the substances that play an important role in maintaining the homeostasis of organisms are physiologically active substances derived from various organisms. Numerous studies on physiologically active substances have been conducted so far. Among them, studies on antifungal and antiinflammatory substances are very important fields in life sciences and medicine.

All living organisms are known to produce antimicrobial substances for survival. Many studies have been conducted on microorganisms that produce antifungal substances, and microorganisms that produce antifungal and antimicrobial substances, or substances separated from them, Studies to develop have long been attempted.

Nitric oxide (NO), on the other hand, is an important intracellular and intercellular signaling molecule involved in the regulation of various physiological mechanisms in the immune system. Nitric oxide reacts with the superoxide to produce peroxynitrite ions and the resulting ions induce excessive inflammatory activity and are known to cause sepsis, ulcerative colitis, arthritis, , systemic lupus erythematosus (SLE), and Sjogren's syndrome (SS). Reactive oxygen species (ROS) and nitric oxide (NO) play an important physiological role as mediators of signal transduction. However, excessive production of endogenous and / or exogenous ROS and NO has been implicated in the pathogenesis of inflammatory diseases and cancer. In addition, NF-κB, a redox-sensitive transcription factor, is activated by inflammatory mediators such as oxidative stress, exogenous ROS and nitric oxide (NO). When NF-κB is activated, IκB is phosphorylated by the IκB kinase (IKK) complex, and IκB is ubiquitinated and degraded. Free NF-κB isolated from IκB migrates into the nucleus and transcribes genes involved in cell growth regulation, apoptosis, immune response, inflammation and cancer in the nucleus. In addition, NF-κB has been reported to play an important role in chronic inflammatory diseases and pathogenesis of various human cancers.

Therefore, searching for a substance that inhibits NO generation that induces NF-kB activity means that it can be proved to be effective in the prevention and treatment of various inflammatory diseases.

On the other hand, live bacteria in plants are microorganisms in which part of life history coexists without causing external transformation to healthy plant tissue. The symbiosis of living organisms can be defined as a symbiotic continuum in terms of symbiotic, convenient symbiotic and parasitic depending on the interrelationship with host plants, that is, the characteristics and environmental influences of host organisms and host plant partners.

Mycorrhizae may have a beneficial effect on plants such as promoting growth of host plants, increasing resistance to pest insects, increasing adaptability to environmental changes such as cold weather and drying, and promoting metabolism formation. In some cases, however, It acts as a primary decomposer of the dead plant tissue and promotes ecosystem material circulation.

In addition, live bacteria in plants are known to produce useful secondary metabolites that have activities such as anticancer or antibacterial activity. The most representative example is Taxomyces andreanae, a taxane isolated from a tree, It is an endogenous bacillus producing paclitaxel which is getting attention. Due to the commercial success of these endophytic bacteria, research and development efforts have been continuously carried out to find new live bacteria in a new plant having various physiologically active substances with various pharmacological effects.

However, despite the results of these studies, the research results related to the development of new medicines using live bacteria in the plant are still insufficient.

Under these circumstances, the present inventors have made intensive efforts to search for a new live organism having excellent pharmacological activity. As a result, the present inventors have found that, in the present invention, It has been confirmed that a new endogenous strain of the genus Ceratobacillus can effectively inhibit the growth of fungi and effectively inhibit the generation of nitrogen oxides and thus can be effectively used as an antifungal agent and an anti-inflammatory agent.

Accordingly, a main object of the present invention is to provide a new endophyte in the genus Ceratobasidium having antifungal and anti-inflammatory activity.

Another object of the present invention is to provide an antifungal and anti-inflammatory composition using live bacteria in the plant.

In order to achieve the above object, the present invention provides Ceratobasidium sp. Strain JS1289 (accession number: KACC 83016BP) having antifungal and anti-inflammatory activity.

The term " Ceratobasidium genus strain JS1289 " of the present invention is a novel serratobacilli strain isolated and identified by the present inventors in the native tree of domestic plants, which is a hybrid of "JS1289 strain" or "JS1289" Can be used.

The present inventors have investigated and analyzed the antifungal and antimicrobial effects of endogenous bacteria isolated from various plants native to Korea for the development of new antimicrobial agents and antifungal agents. As a result, they found that the antifungal and antiinflammatory effects (See Figs. 1 to 3).

The Ceratobasidium genus strain JS1289 (accession number: KACC 83016BP) of the present invention is characterized by having the ITS gene sequence of SEQ ID NO: 1 or the LSU (Large subunit of ribosomal DNA) gene sequence of SEQ ID NO: 2.

As a result of comparing the gene sequence with the gene sequences of known strains, the present inventors confirmed that the strain of the present invention is a new strain belonging to the genus Ceratobacillus, named as Serratobacillus strain JS1289, It was deposited on December 11, 2017 in the original information center and was granted accession number KACC 83016BP.

According to another aspect of the present invention, there is provided an antifungal and anti-inflammatory composition comprising the above-mentioned Ceratobasidium sp. Strain JS1289, or a culture thereof as an active ingredient.

In the present invention, the strain of the genus Serratobacillus JS1289 or the culture thereof itself is characterized by exhibiting antifungal activity and anti-inflammatory activity.

The Serratobacillus sp. Strain JS1289 or a culture thereof has an antifungal activity against various fungi. More specifically, it has antifungal activity against Candida spp., More specifically, Candida albicans . , But is not limited thereto (see FIG. 1).

In addition, the above-mentioned seratobacillus sp. Strain JS1289 or its culture has antibacterial activity against various fungi. The strain or the culture thereof of the present invention has antimicrobial activity against Gram-positive bacteria, Gram-negative bacteria and antibiotic-resistant strains.

In one embodiment of the present invention, it has been confirmed that the extract of the endogenous culture solution according to the present invention has a growth inhibitory effect against various pathogenic fungi and pathogenic bacteria.

In addition, in the present invention, the anti-inflammatory activity of the strain JS1289 or its culture is characterized by inhibiting the production of nitric oxide (NO). In one embodiment of the present invention, it has been confirmed that the above-mentioned Serratobacillus genus JS1289 or a culture thereof has an excellent effect of inhibiting the production and secretion of nitric oxide (NO) which is an inflammation-inducing factor, thereby excellently treating and preventing inflammatory diseases (See Fig. 2).

In the present invention, the inflammatory disease is selected from the group consisting of edema, dermatitis, allergy, atopy, asthma, conjunctivitis, periodontitis, rhinitis, otitis, sore throat, tonsillitis, pneumonia, gastric ulcer, gastritis, Crohn's disease, colitis, hemorrhoids, Inflammatory diseases such as inflammatory bowel disease, inflammatory bowel disease, fibromyalgia, psoriatic arthritis, osteoarthritis, rheumatoid arthritis, shoulder joint inflammation, tendonitis, nephritis, myositis, hepatitis, cystitis, nephritis, sjogren's syndrome and multiple sclerosis.

According to another aspect of the present invention, there is provided an antifungal and antiinflammatory pharmaceutical composition comprising the above-mentioned Serratobacillus sp. Strain JS1289 or a culture thereof as an active ingredient. The strain of the genus Serratobacillus, JS1289, or the culture thereof exhibits excellent antifungal and anti-inflammatory activity through direct influence on harmful microorganisms, and thus can be usefully used as an antifungal and anti-inflammatory pharmaceutical composition.

The extract of the culture broth of the genus Ceratobacillus of the present invention may be prepared in the form of a pharmaceutically acceptable salt. Specifically, an acid may be added to form a salt, for example, an inorganic acid such as hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid and the like, an organic carboxylic acid such as acetic acid, a halo such as trifluoroacetic acid (Such as acetic acid, propionic acid, maleic acid, succinic acid, malic acid, citric acid, tartaric acid, salicylic acid) and acidic saccharides (glucuronic acid, galacturonic acid, gluconic acid, ascorbic acid), acidic polysaccharides (such as hyaluronic acid, chondroitin sulfate, arginine (E.g., methane, sulfonic acid, and p-toluenesulfonic acid) including sulfonic acid ester such as chondroitin sulfate, and the like can be added to form a salt.

The strain of the genus Serratobacillus JS1289 or its culture is an endogenous live organism isolated from edible seeds of a tree, and can be administered orally or parenterally upon clinical administration and can be used in the form of a general pharmaceutical preparation.

That is, the new strain JS1289 of the present invention or its culture can be administered in various oral or parenteral formulations. In the case of formulation, a diluent such as a filler, an extender, a binder, a wetting agent, a disintegrant, Is prepared using an excipient. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. As a suppository base, witepsol, macrogol, tween 61, cacao paper, Liu ling, glycerogelatin and the like can be used.

In addition, the new strain of the present invention, JS1289 or a culture thereof, can be used in combination with various carriers permitted as medicaments such as physiological saline or an organic solvent, and can be used as glucose, sucrose or dextran Antioxidants such as carbon hydrate, ascorbic acid or glutathione, chelating agents, low molecular weight proteins or other stabilizers may be used as pharmaceuticals.

The effective dose of the novel strain JS1289 or the culture medium of the present invention is 0.01 to 10 mg / kg, preferably 0.1 to 1 mg / kg, and can be administered once to three times a day.

In a pharmaceutical composition of the present invention or a culture thereof, the total effective amount may be administered to a patient in a single dose, such as by bolus injection or by infusion for a relatively short period of time, (multiple does) may be administered by a fractionated treatment protocol administered over a prolonged period of time. Since the concentration of the effective dose of the patient is determined in consideration of various factors such as the route of administration and the number of treatments as well as the age and health condition of the patient, in view of this point, Lt; RTI ID = 0.0 > JS1289 < / RTI > or its pharmaceutical composition as a pharmaceutical composition.

According to still another aspect of the present invention, there is provided an antifungal and anti-inflammatory cosmetic composition comprising, as an active ingredient, a strain of Ceratobasidium sp. JS1289 or a culture thereof having an antifungal and anti-inflammatory activity.

The novel strain JS1289 or the culture thereof of the present invention exhibits excellent antifungal and anti-inflammatory activity through direct influence on harmful microorganisms, and thus can be usefully used as an antifungal and anti-inflammatory cosmetic composition.

The cosmetic composition of the present invention contains, as an active ingredient, components commonly used in cosmetic compositions in addition to the above-mentioned new strain JS1289 or a culture thereof, and may contain conventional auxiliaries such as antioxidants, stabilizers, solubilizers, vitamins, And a carrier.

The cosmetic composition of the present invention can be prepared into any of the formulations conventionally produced in the art and can be used in the form of solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, , Oil, powder foundation, emulsion foundation, wax foundation and spray, but is not limited thereto. More specifically, it can be manufactured in the form of a flexible lotion (skin), a nutritional lotion (milk lotion), a nutritional cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray or a powder .

When the formulation of the present invention is a paste, a cream or a gel, an animal oil, vegetable oil, wax, paraffin, starch, tragacantha, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide .

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In the case of a spray, in particular, chlorofluorohydrocarbons, propane / Propane or dimethyl ether.

When the formulation of the present invention is a solution or an emulsion, a solvent, a dissolving agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, , 3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan fatty acid esters.

In the case where the formulation of the present invention is a suspension, a carrier such as water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Cellulose, aluminum metahydroxide, bentonite, agar or tragacantha, etc. may be used.

When the formulation of the present invention is an interfacial active agent-containing cleansing, the carrier component is selected from aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters.

Specific examples of the cosmetics of the present invention include eye creams, cleansing creams, cleansing milks, cleansing lotions, massage creams, cold creams, moisturizing creams, milks, lotions, packs, after-shave creams, sunscreen- Hair shampoo, hair shampoo, hair rinse, hair treatment, hair dye, hair dye, hair cream, hair liquid, set lotion, hair spray, hair bridge, color rinse, color spray, permanent wave liquid, press powder, loose powder , Eye shadow, hand cream, lipstick, and the like.

According to another aspect of the present invention, there is provided a food or feed preserving composition containing, as an active ingredient, a strain of Ceratobasidium sp. JS1289 or a culture thereof having antifungal and anti-inflammatory activity.

A food or feed preservative is an additive used to prevent deterioration, decay, discoloration and chemical change of food or feed. It includes antiseptic and antioxidant, and inhibits the growth of microorganisms such as bacteria, fungi and yeast. , Cosmetics, medicines and the like, as well as functional antimicrobial agents such as inhibiting the growth of microorganisms or sterilizing the microorganisms. Ideal conditions for preserving food or feed should not be toxic and should be effective in trace amounts. Since the Ceratobasidium genus strain JS1289 of the present invention or its culture has an excellent antifungal activity and anti-inflammatory activity through directly influencing harmful microorganisms, it can be widely used for preservatives, cosmetic preservatives, .

According to another aspect of the present invention, the present invention provides a method for treating a human, comprising administering to a subject in need of treatment a composition containing the above-mentioned Ceratobasidium sp. Strain JS1289 or a culture thereof to kill pathogenic bacteria Lt; RTI ID = 0.0 > bacterial < / RTI > or fungal infectious disease.

According to still another aspect of the present invention, the present invention includes a method for treating or preventing an inflammatory disease by administering a composition containing the above-mentioned Ceratobasidium sp. Strain JS1289 or a culture thereof to an individual in need of treatment A method for treating an inflammatory disease of an animal other than human.

The method of treatment according to the present invention does not mean that a method of treating an animal other than a human, but such a treatment method is ineffective in humans. Further, in the case of humans, it can be sufficiently used in the treatment of humans, considering that the administration of the therapeutic composition according to the present invention can improve symptoms of bacterial or fungal infections or inflammatory diseases.

The term " inflammatory disease " in the present invention means a disease in which inflammation is the main lesion, and includes, but is not limited to, edema, dermatitis, allergy, atopy, asthma, conjunctivitis, periodontitis, rhinitis, otitis, Rheumatoid arthritis, osteoarthritis, rheumatoid arthritis, shoulder inflammation, tendonitis, nephritis, myositis, hepatitis, osteoarthritis, osteoarthritis, osteoarthritis, Cystitis, nephritis, sjogren's syndrome or multiple sclerosis.

The term " animal excluding human being " in the present invention refers to an animal, such as a horse, a sheep, an animal, a mammal, or a mammal other than a human having an inflammatory disease or a disease caused by infection with a bacterium or a fungus, Pig, goat, camel, nutrition, and dog. By administering the therapeutic composition according to the present invention to an animal other than a human, diseases and inflammatory diseases caused by bacteria and fungal infections can be effectively prevented and treated.

The term " administering " in the present invention means introducing a predetermined substance into an animal by any appropriate method, and the administration route of the therapeutic composition according to the present invention may be administered orally, May be administered parenterally. In addition, the therapeutic composition according to the present invention may be administered by any device capable of moving the active ingredient into the target cell.

The preferable dosage of the therapeutic composition according to the present invention varies depending on the condition and body weight of the animal to be treated, the degree of disease, the type of drug, route of administration and period of time, but can be appropriately selected by those skilled in the art. However, for the desired effect, the pharmaceutical composition of the present invention is 0.01 to 10 mg / kg, preferably 0.1 to 1 mg / kg, and can be administered once to three times a day.

The features and advantages of the present invention are summarized as follows:

(I) The present invention provides an antifungal and anti-inflammatory composition comprising a strain of JS1289 of the genus Ceratobasidium originating from a conifer tree leaf or a culture thereof as an active ingredient.

(Ii) The composition of the present invention, comprising the Serratobacidium JS1289 strain or a culture thereof, can be applied to various bacterial infectious diseases caused by harmful bacteria and can be effectively applied to inflammatory diseases by effectively inhibiting the secretion of nitric oxide.

(Iii) Further, the composition of the present invention can be usefully used for antifungal and anti-inflammatory purposes in various fields such as cosmetic composition, food or feed preservative additive composition, and the like.

1 is a Candida FIG. 2 is a graph showing the antibacterial activity test results of the strain JS1289 of the genus Ceratobasidium on albicans .
FIG. 2 is a graph showing that a culture solution of a strain JS1289 of the genus Ceratobasidium shows anti-inflammatory activity through inhibition of nitric oxide (NO) production.
FIG. 3 is a graph showing the cytotoxicity test results of a culture solution of the strain JS1289 of the genus Ceratobacillus.
FIG. 4 is a photograph of a strain of the genus Ceratobasidium JS1289 growing on a potato sugar agar medium.
FIG. 5 is a photograph showing the growth of the strain JS1289 of the genus Ceratobasidium under various medium conditions.
6 is a systematic analysis graph based on ITS nucleotide sequence information of the genus Serratobacillus JS1289.
7 is a systematic analysis graph based on LSU nucleotide sequence information of the genus Serratobacillus JS1289.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention, and it is to be understood by those skilled in the art that the present invention is not limited thereto It will be obvious.

Example 1 Isolation of Strain

To collect live bacteria in plants with antifungal and antiinflammatory activity, conifer trees were first obtained as plant samples.

The trees were collected from Jirisan area in Muju - gun, Jeollanam - do and Halla mountain area in Cheju island. The collected plant samples were washed with flowing tap water, and the dirt was wiped off and then used for segregation of endogenous bacteria. First, the leaf tissues were 5 mm × 5 mm pieces, and the branches, stems and roots were cut into small pieces with a width of 1 to 2 mm. Samples were collected, sterilized in a 1.5% NaOCl solution for 3 minutes, Lt; / RTI > The sterilized sample was immersed in distilled water for 1 minute, wiped off with a sterilized paper towel, and wound on a culture medium for strain isolation.

The medium used was a PDA (potato dextrose agar) medium and a MEA (malt extract agar) medium supplemented with 50 ppm of Rose Bengal, 100 ppm of kanamycin, 100 ppm of streptomycin. After culturing for 5 to 10 days, young mycelium was transferred to a new PDA medium at the edge of the microflora growing on the plant tissue, and the microorganism was separated purely, and the isolated strains were numbered.

Example 2. Culture of strains and extraction of active ingredient

The agar slices containing mycelium grown in the PDA (potato dextrose agar) medium of Example 1 were finely cut into 250 ml of potato dextrose broth (PDB) at about 1 mm ² and inoculated at 24 ° C and 180 rpm And cultured for 3 weeks with shaking.

After culturing, the mycelium was filtered using miracloth, and the filtrate was extracted with ethyl acetate solvent. The extraction was carried out twice in 20-minute intervals with the same volume of ethyl acetate as the culture filtrate. The extracts were concentrated under reduced pressure, dried and quantitated, redissolved in DMSO solution and used for activity analysis.

Example 3. Antifungal activity assay

The standard assay method using microplates was used to test the antifungal activity of live bacteria in plants (Serrone PD and Nicoletti M, 2013).

Candida albicans , a pathogenic fungus inducing candidiasis, was cultured in SDB (Sabouraud dextrose broth) medium at 30 ° C and 200 rpm for 24 hours. The pathogenic fungus was diluted to a concentration of 1 × 10 ⁵ (conidia / ml), inoculated into a 96-well plate, the extract extracted with the method of Example 2 was treated at a concentration of 50 ppm, For 24 hours. As a control group, 10 ppm of amphotericin B was used as a positive control.

To measure the antimicrobial activity, the OD value was measured at 600 nm using a microplate reader, and the growth rate of the fungi was calculated in comparison with the negative control group without sample treatment. Each experiment was repeated three times. The strain growth rate was calculated using the following formula.

Relative growth rate (%) = [(Control _{Abs Abs} ) / Control _Abs ] x 100

As a result, it was observed that the experimental group treated with 50 ppm of the extract of endogenous bacteria isolated in Example 1 and numbered JS1289 grew to 6.34 ± 0.25% as compared with the untreated group and had excellent antifungal effect. This antifungal effect was confirmed to be similar to the antifungal activity of the 10 ppm amphotericin B treatment group (see FIG. 1).

Example 4. Anti-inflammatory activity assay

The anti-inflammatory activity of plant extracts was determined by measuring the inflammatory response of mouse microglia (BV-2 Microglial) activated by Lipopolysaccharide to relative nitric oxide (NO) production (relative extracellular NO level) Respectively. NO produced in cells treated with LPS and cells treated with LPS were measured and compared with the degree of NO production reduced by the extract, anti-inflammatory activity was confirmed. After the anti - inflammatory activity test, the cytotoxicity of the extract was confirmed using MTS (sigma).

Specifically, BV-2 cells were cultured in DMEM (Dulbecco's Modified Eagle's Medium) medium containing 10% FBS at 37 ° C in a CO ₂ incubator. The cells were inoculated at a cell concentration of 5 x 10 ⁴ / 200ul per well of a 96-well plate and cultured for 24 hours.

The medium was removed and the extracts were replaced with DMEM medium containing 0.5% FBS treated with the appropriate concentration. After 3 hours, LPS treatment induced inflammation. After 24 hours of reaction, 50 μl of the medium was transferred to a new plate, and 50 μl of Griess reagent (Enzo) was added, wrapped in foil to block light, stored at room temperature for 5 minutes and absorbance at 540 nm Respectively.

In addition, to test cytotoxicity, all of the plates of the NO production-confirmed plate were removed, and 120ul of the solution containing 20ul of MTS and 100ul of the medium was treated. The mixed solution was incubated at 37 ° C for 1 hour and 30 minutes in a CO ₂ incubator, and the absorbance (490 nm) was measured to confirm cytotoxicity. For the antiinflammatory activity test, the degree of inflammation was determined as the relative NO production amount by using the experimental group not treated with LPS and the extract of the present invention, and the experimental group treated with LPS and the extract of the present invention as a control group.

As a result, when the relative NO production of the LPS-untreated control group was considered to be 100%, 3,331 ± 75.1% of the nitric oxide was produced in the LPS-treated positive control group, Respectively.

On the other hand, in the experimental group treated with 50 ppm of the extract of Ceratobasidium genus JS1289 of the present invention, the level of nitric oxide production was 1,100 ± 12.1% in the experimental group in which inflammation was caused by LPS, and compared with the group treated with LPS alone, The production amount decreased to about 31% level and statistically significant difference was shown.

These anti-inflammatory activities were observed in a concentration-dependent manner, and it was confirmed that the anti-inflammatory activity was reduced as the concentration of the extract decreased (see FIG. 2).

On the other hand, the survival rate of cells was 88.88 ± 2.81% when the cell viability of the negative control of LPS was 100%, when the JS1289 extract of Ceratobasidium of the present invention was treated at a concentration of 50 ppm , And when treated at a concentration of 10 ppm, it was 84.59 ± 2.24%, which is a clinically acceptable range (see FIG. 3).

Example 5. Verification of growth characteristics according to carbon source

In order to investigate the growth characteristics of Ceratobasidium JS1289 strain, growth characteristics of carbon sources were examined by treating carbon source differently with CDA (Czapek Dox Agar) medium. The carbon source is 2% each of Fructose, Glucose, Inositol, Mannitol, Mannose, Sorbitol, Sucrose, and Xylose, Lt; / RTI > In addition, we compared them with the three kinds of nutrient media: PDA, V8, and Oatmeal.

In the experiment, 5 ml of each medium was added to a 6-well plate, and then JS1289 in Ceratobasidium was inoculated and cultured for 1 week to 4 weeks.

As a result, it was observed that the medium prepared by adding 8 carbon sources to the CDA medium had similar growth rates and no change in growth pattern, hyphae and medium color even though the carbon source was different.

On the other hand, PDA, V8, and oatmeal media, which are nutrient media, showed faster and richer growth compared to CDA media. Especially, hyphae of PDA and oatmeal media were characterized as white aerial mycelia . On the other hand, in the V8 medium, the mycelium adhered to the medium and the growth rate was the same as that of the PDA and oatmeal medium, but the morphology was clearly different (see FIG. 5).

Example 6 Identification of Endogenous Strains by Sequence Analysis

In the above Examples 3 and 4, the growth of JS1289 strain on the solid medium of PDA confirmed the antifungal and anti-inflammatory effect was confirmed. The conidia were not formed in the PDA medium, and when observed with a microscope, they showed a characteristic mycelial form of a strain of the genus Ceratobasidium branching at a right angle.

(ITS1F (CTTGGTCATTTAGAGGAAGTAA) primer of SEQ ID NO: 3 and LR5 (ATCCTGAGGGAAACTTC) primer of SEQ ID NO: 4 were used as a template, and a part of ITS (Internal Transcribed Spacer) and LSU (Large subunit of ribosomal DNA) Primers were obtained using primers ITS1F, ITS3, ITS4, LR0R, and LR5 as the PRISM 3730 XL analyzer (Macrogen) platform (Gardes and Bruns, 1993; White et al., 1990). The primer sequences used for PCR amplification and sequencing are shown in Table 1 below.

primer The sequence (5'-3 ') Remarks ITS1F CTT GGT CAT TTA GAG GAA GTAA PCR amplification, sequencing ITS3 GCATCGATGAAGAACGCAGC Sequencing ITS4 TCC TCC GCT TAT TGA TAT GC Sequencing LR0R GTA CCC GCT GAA CTT AAG C Sequencing LR5 ATC CTG AGG GAA ACT TC PCR amplification, sequencing

Gene amplification (PCR) was performed on ITS and LSU rDNA regions using genomic DNA extracted from JS1289 strain as a template. The PCR conditions were as follows. Gene amplification was repeated 30 cycles of (1) 95 ° C for 5 minutes, (2) 90 ° C for 1 minute, (3) 50 ° C for 1 minute, (4) 72 ° C for 2 minutes, and (5) The program was carried out at 72 ° C for 10 minutes. The PCR product was electrophoresed on 1.3% agarose gel, and the result was confirmed by gel-dication (Bio-Rad). The amplified fragment was purified using a PCR purification kit (K-3034, Bioneer).

The obtained sequences were extracted and assembled by using the Sequencher program to identify the consensus sequence, and the homology was searched using the BLASTn algorithm for ntDB of NCBI.

The ITS region (between ITS1F-ITS4) and the sequence of LSU region (between LR0R and LR5) were divided, and multiple alignments were made with the sequence of the relatives from the homology search result, . Multiple alignment was performed using the ClustalW program, and the number of trees was created using the neighbor-joining method of MEGA version 6.06 (Tamura et al., 2011) (Saitou and Nei, 1987).

As a result, the size of the fragment amplified using the ITS1 and LR5 primers was found to be about 1,500 bp. The nucleotide sequences obtained by using the five primers were made into a contiguous sequence from the ITS region to the LSU region using a SEQUENCHER ^™ (GeneCodes Corporation) program, and the sequence was divided into regions.

The resultant sequence of the ITS region was represented by the 681 bp sequence of SEQ ID NO: 1, and the sequence of the LSU region was represented by the 921 bp sequence of SEQ ID NO: 2.

As a result of homology search using the ITS sequence of the JS1289 strain, the genus Ceratobasidium (Basidiomycota; Agaricomycotina; Agaricomycetes River; Cantharellales Neck; Ceratobasidiaceae] showed the highest homology with the ITS sequence.

The ITS sequence and phylogenetic tree of the relatives were shown to be in phase with the strains of Ceratobasidium genus (see FIG. 6). In addition, homology search using LSU sequence showed the highest homology with Ceratobasidium sp. Strains, and it showed a single lineage with them (see Fig. 7).

Based on these results, it was confirmed that the JS1289 strain belongs to the genus Ceratobasidium . The present inventors named the strain of the present invention having excellent antifungal and antiinflammatory activity in the genus Ceratobasidium JS1289 and deposited it with the accession number (KACC 83016BP) of the National Institute of Agricultural Science and Technology, National Institute of Agricultural Science and Technology.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Agricultural Biotechnology Research Institute KACC83016BP 20171211

<110> National Institute of Biological Resources <120> Novel Strain of Ceratobasidium sp. JS1289 Having Anti-Fungal and          Anti-inflammatory Activity, and Uses thereof <130> PN20170058AN <160> 4 <170> KoPatentin 3.0 <210> 1 <211> 681 <212> DNA <213> Unknown <220> <223> Ceratobasidium sp. <400> 1 agtaaaagtc gtaacaaggt ttccgtaggt gaacctgcgg aaggatcatt atcgaatgaa 60 gcctgtcg cacacacacc tgtgcacttg tgagacggat ccgaccctct cgggggaacg gtccgtctat 180 tatacataaa ctccaataat ataaatctga atgtaatttg atgtaacaca tctttaaact 240 aagtttcaac aacggatctc ttggctctcg catcgatgaa gaacgcagcg aaatgcgata 300 agtaatgtga attgcagaat tcagtgaatc atcgaatctt tgaacgcacc ttgcgctcct 360 tggtattcct cggagcatgc ctgtttgagt atcatgaaat cctcaaaata aatcttttgt 420 tcattcgatt gatttttatt ttggacttgg aggtctgcag attcacgtct gctcctctta 480 aatttattag ctggatctcc gtgaactcgg ttccactcgg cgtgataagt atcactcgct 540 gaggacactg taaaaaggtg gccggggtcg tggaagaacc gcttccaata gtccattgac 600 ttggacaata aattatttat gatctgatct caaatcaggt aggactaccc gctgaactta 660 agcatatcaa taagcggagg a 681 <210> 2 <211> 921 <212> DNA <213> Unknown <220> <223> Ceratobasidium sp. <400> 2 ctacccgctg aacttaagca tatcaataag cggaggaaaa gaaactaaca aggattcccc 60 tagtaacggc gagtgaagcg ggaagagctc aaatttaaaa tctggcggtc gcaccgtccg 120 agttgtagtc tagagaagca tcatctacgc tggaccatgt acaagtctct tggaacagag 180 cgtcatagag ggtgagaatc ccgtccttga catggactcc cagtgttctg tgttgtgctc 240 tcaacgagtc gagttgtttg ggaatgcagc tcaaaatggg tggtaaattc catctaaagc 300 taaatattgg cgagagaccg atagcgaaca agtaccgtga gggaaagatg aaaagcactt 360 tggagagaga gttaaacagt acgtgaaatt gttgaaatgg aaacgcttga agtcagtcgc 420 gttctctggg attcagcctt gcttttgctt ggtgcatttc ctagtctacg ggccagcatg 480 gatttcgacc gttggaaaag ggctggggga atgtggcacc ttcgggtgtg ttatagcccc 540 ctgtcgcatg catcggttgg gatcgaggac ctcagtgcac gcttcggttg tgctttgatg 600 ctggcgtaat ggctttaaac gacccgtctt gaaacacgga ccaaggagtc taacatgtct 660 gcgagtgttt gggtgaaaaa ctcggacgcg caatgaaagt gatagttggg aacctttcac 720 gaggggcacc gacgcccgga ccagaccttc tgtgacggat ccgaggtaga gcatatatgt 780 tgggacccga aagatggtga actatgcctg catagggtga agccagagga aactctggtg 840 gaggctcgta gcgattctga cgtgcaaatc gatcgtcaaa tgtgggtata ggggcgaaag 900 actaatcgaa ccatctagta c 921 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ITS1F primer <400> 3 cttggtcatt tagaggaagt aa 22 <210> 4 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> LR5 primer <400> 4 atcctgaggg aaacttc 17

Claims (9)

Has antifungal activity against Candida albicans ,
It has anti-inflammatory activity through inhibition of nitric oxide (NO) production against nitric oxide (NO) mediated inflammatory diseases.
Ceratobasidium genus strain JS1289 (accession number: KACC 83016BP). The method according to claim 1,
Wherein said strain has an ITS gene sequence of SEQ ID NO: 1 or a large subunit of ribosomal DNA (LSU) gene sequence of SEQ ID NO: 2. Ceratobasidium genus strain JS1289 (accession number: KACC 83016BP). A method for producing a microorganism which comprises the strain of claim 1 or a culture thereof as an active ingredient,
It has antifungal activity against Candida albicans ,
It has anti-inflammatory activity through inhibition of nitric oxide (NO) production against nitric oxide (NO) mediated inflammatory diseases.
Antifungal and antiinflammatory composition. delete delete 10. A method for treating Candida albicans , comprising administering to said subject an antifungal and anti-inflammatory composition according to claim 3 for the treatment of Candida albicans .
A method for treating Candida albicans fungal infectious disease in an animal other than human. delete The use of an antifungal and antiinflammatory composition of claim 3 in a subject in need of treatment to treat or prevent a nitric oxide (NO) mediated inflammatory disease, NO) mediated inflammatory disease. delete

Images