KR101983575B1 - Novel Strain of Ceratobasidium sp. JS1289 Having Anti-Fungal and Anti- inflammatory Activity, and Uses thereof - Google Patents
Novel Strain of Ceratobasidium sp. JS1289 Having Anti-Fungal and Anti- inflammatory Activity, and Uses thereof Download PDFInfo
- Publication number
- KR101983575B1 KR101983575B1 KR1020170176935A KR20170176935A KR101983575B1 KR 101983575 B1 KR101983575 B1 KR 101983575B1 KR 1020170176935 A KR1020170176935 A KR 1020170176935A KR 20170176935 A KR20170176935 A KR 20170176935A KR 101983575 B1 KR101983575 B1 KR 101983575B1
- Authority
- KR
- South Korea
- Prior art keywords
- strain
- present
- antifungal
- ceratobasidium
- inflammatory
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/06—Fungi, e.g. yeasts
- A61K36/07—Basidiomycota, e.g. Cryptococcus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/10—Antimycotics
-
- C12R1/645—
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
Abstract
Description
본 발명은 항진균 및 항염증 활성을 나타내는 것을 특징으로 하는 세라토바시디움 속 신균주 JS1289 및 이를 유효성분으로 함유하는 항진균 및 항염증 조성물에 관한 것이다.The present invention relates to a novel strain JS1289 of the genus Ceratobacillus, which is characterized by exhibiting antifungal and antiinflammatory activity, and an antifungal and antiinflammatory composition containing it as an active ingredient.
생물체의 항상성(homeostasis)을 유지하기 위한 과정에서 중요한 역할을 담당하고 있는 물질들 중 일부가 각종 생물체 유래의 생리 활성 물질이다. 지금까지 수많은 생리 활성 물질에 대해 많은 연구가 진행되고 있으며, 그 중, 항진균 및 항염증 물질에 관한 연구는 생명과학 및 의학 분야에서 매우 중요한 영역이다.Some of the substances that play an important role in maintaining the homeostasis of organisms are physiologically active substances derived from various organisms. Numerous studies on physiologically active substances have been conducted so far. Among them, studies on antifungal and antiinflammatory substances are very important fields in life sciences and medicine.
모든 생명체는 생존을 위하여 항균 물질을 생산하는 것으로 알려져 있는데, 항진균 물질을 생산하는 미생물에 대해서 많은 연구가 이루어지고 있으며, 항진균 및 항균 물질을 생산하는 미생물 또는 이들에게서 분리된 물질을 이용해 항균제 또는 항진균제를 개발하려는 연구들이 오래전부터 시도되고 있다. All living organisms are known to produce antimicrobial substances for survival. Many studies have been conducted on microorganisms that produce antifungal substances, and microorganisms that produce antifungal and antimicrobial substances, or substances separated from them, Studies to develop have long been attempted.
한편, 산화질소(NO, Nitric oxide)는 면역시스템에서 다양한 생리학적 메커니즘을 조절하는데 관여하는 중요한 세포내 및 세포간 신호전달 분자이다. 산화질소는 수퍼옥사이드와 반응하여 퍼옥시나이트라이트(peroxynitrite) 이온을 생성하고, 생성된 이온은 과도한 염증 활성을 유도하며, 패혈증(sepsis), 궤양성 대장염(ulcerative colitis), 관절염(arthritis), 루푸스(systemic lupus erythematosus, SLE) 및 쇼그렌증후군(Sjogren's syndrome, SS) 등의 질환을 발생시키는 것으로 알려져 있다. 활성산소종(Reactive oxygen species, ROS) 및 산화질소(nitric oxide, NO)는 신호전달과정의 중간 매개자로서 매우 중요한 생리학적 역할을 담당한다. 그러나, 내인성 및/또는 외인성 ROS 및 NO의 과도한 생성은 염증성 질환 및 암의 발병에 관련되어 있다. 또한, 산화환원-민감성 전사인자인 NF-κB는 산화스트레스, 외인성 ROS와 산화질소(NO, Nitric oxide) 등과 같은 염증성 매개자에 의해 활성화된다. NF-κB가 활성화되면, IκB는 IκB 키나아제(IKK) 복합체에 의해 인산화되고, IκB는 유비퀴틴화(ubiquitinated)되어 분해된다. IκB로부터 분리된 자유 NF-κB는 핵 속으로 이동하고, 핵 내에서 세포 성장조절, 에이팝토시스, 면역반응, 염증 및 암에 관련된 유전자를 전사시킨다. 또한, NF-κB는 만성염증성질환 및 다양한 인간 암의 발병기전에 중요한 역할을 한다고 보고되었다. Nitric oxide (NO), on the other hand, is an important intracellular and intercellular signaling molecule involved in the regulation of various physiological mechanisms in the immune system. Nitric oxide reacts with the superoxide to produce peroxynitrite ions and the resulting ions induce excessive inflammatory activity and are known to cause sepsis, ulcerative colitis, arthritis, , systemic lupus erythematosus (SLE), and Sjogren's syndrome (SS). Reactive oxygen species (ROS) and nitric oxide (NO) play an important physiological role as mediators of signal transduction. However, excessive production of endogenous and / or exogenous ROS and NO has been implicated in the pathogenesis of inflammatory diseases and cancer. In addition, NF-κB, a redox-sensitive transcription factor, is activated by inflammatory mediators such as oxidative stress, exogenous ROS and nitric oxide (NO). When NF-κB is activated, IκB is phosphorylated by the IκB kinase (IKK) complex, and IκB is ubiquitinated and degraded. Free NF-κB isolated from IκB migrates into the nucleus and transcribes genes involved in cell growth regulation, apoptosis, immune response, inflammation and cancer in the nucleus. In addition, NF-κB has been reported to play an important role in chronic inflammatory diseases and pathogenesis of various human cancers.
따라서, NF-κB 활성을 유발하는 NO 발생을 억제하는 물질을 탐색하면, 다양한 염증성 질환의 예방 및 치료에 효과적인 물질로 판명할 수 있다는 것을 의미한다. Therefore, searching for a substance that inhibits NO generation that induces NF-kB activity means that it can be proved to be effective in the prevention and treatment of various inflammatory diseases.
한편, 식물 내생균은 생활사의 일부가 건강한 식물 조직에 외형적 변형을 일으키지 않고 공존하는 미생물이다. 내생균의 공생은 기주식물과의 상호관계, 즉 내생균과 기주식물 파트너의 특성이나 환경적 영향에 따라 공생, 편리 공생 및 기생 등의 형태(balanced symbiotic continuum)로 정의될 수 있다. On the other hand, live bacteria in plants are microorganisms in which part of life history coexists without causing external transformation to healthy plant tissue. The symbiosis of living organisms can be defined as a symbiotic continuum in terms of symbiotic, convenient symbiotic and parasitic depending on the interrelationship with host plants, that is, the characteristics and environmental influences of host organisms and host plant partners.
내생균은 기주식물의 생장 촉진, 병해충 저항성 증대, 냉해나 건조 등의 환경변화에 대한 적응력 증대, 대사물질 형성 촉진 등 식물에 이로운 영향을 주기도 하나, 일부 내생균의 경우 기주식물에 잠복하여 병원균으로 작용하는 등 해로운 영향을 주기도 하고, 죽은 식물 조직의 일차 분해자로 작용하여 생태계 물질 순환을 촉진하는 역할을 하기도 한다. Mycorrhizae may have a beneficial effect on plants such as promoting growth of host plants, increasing resistance to pest insects, increasing adaptability to environmental changes such as cold weather and drying, and promoting metabolism formation. In some cases, however, It acts as a primary decomposer of the dead plant tissue and promotes ecosystem material circulation.
또한, 식물 내생균은 그 자체가 항암 또는 항균 등의 활성을 갖는 유용한 이차대사산물을 생산하는 것으로 알려져 있는데, 가장 대표적인 예로는 주목나무에서 분리된 탁소미세스 속 내생균(Taxomyces andreanae)으로 차세대 항암제로 주목받고 있는 택솔(paclitaxel)을 생산하는 내생균이다. 이러한 내생균의 상업적 성공으로 인해 다양한 약리적 효능을 가진 신규 생리활성 물질을 보유한 새로운 식물 내생균을 찾기 위한 연구개발 노력이 지속적으로 이루어지고 있다. In addition, live bacteria in plants are known to produce useful secondary metabolites that have activities such as anticancer or antibacterial activity. The most representative example is Taxomyces andreanae, a taxane isolated from a tree, It is an endogenous bacillus producing paclitaxel which is getting attention. Due to the commercial success of these endophytic bacteria, research and development efforts have been continuously carried out to find new live bacteria in a new plant having various physiologically active substances with various pharmacological effects.
그러나, 이러한 연구결과에도 불구하고 아직까지 식물 내생균을 이용한 신규 약제 개발과 관련된 연구 성과는 미미한 상태이다. However, despite the results of these studies, the research results related to the development of new medicines using live bacteria in the plant are still insufficient.
이러한 배경 하에서, 본 발명자들은 우수한 약리 활성을 갖는 신규 내생균을 찾기 위해 예의 노력한 결과, 우리나라 고유종으로 현재 지리산, 한라산 등 해발 1,000미터 이상의 고산지대에서만 소규모로 서식하고 있는 식물인 구상나무 잎에서 분리된 세라토바시디움 속 신규 내생균주가 진균의 성장을 효과적으로 억제하고, 산화질소의 발생을 효과적으로 억제하여, 항진균제 및 항염증제로 유용하게 활용될 수 있음을 확인하고, 본 발명을 완성하게 되었다.Under these circumstances, the present inventors have made intensive efforts to search for a new live organism having excellent pharmacological activity. As a result, the present inventors have found that, in the present invention, It has been confirmed that a new endogenous strain of the genus Ceratobacillus can effectively inhibit the growth of fungi and effectively inhibit the generation of nitrogen oxides and thus can be effectively used as an antifungal agent and an anti-inflammatory agent.
따라서, 본 발명의 주된 목적은 항진균 및 항염증 활성을 갖는 세라토바시디움(Ceratobasidium) 속 신규 내생균을 제공하는 데 있다.Accordingly, a main object of the present invention is to provide a new endophyte in the genus Ceratobasidium having antifungal and anti-inflammatory activity.
본 발명의 다른 목적은 상기 식물 내생균을 이용한 항진균 및 항염증 조성물을 제공하는데 있다.Another object of the present invention is to provide an antifungal and anti-inflammatory composition using live bacteria in the plant.
상기 목적을 달성하기 위해, 본 발명은 항진균 및 항염증 활성을 갖는 세라토바시디움(Ceratobasidium) 속 균주 JS1289(수탁번호: KACC 83016BP)를 제공한다.In order to achieve the above object, the present invention provides Ceratobasidium sp. Strain JS1289 (accession number: KACC 83016BP) having antifungal and anti-inflammatory activity.
본 발명의 용어 "세라토바시디움(Ceratobasidium) 속 균주 JS1289"는 국내 자생 식물인 구상나무에서 본 발명자들에 의해 새롭게 분리 동정된 신규한 세라토바시디움 균주로서, "JS1289 균주" 또는 "JS1289"와 혼용하여 사용할 수 있다. The term " Ceratobasidium genus strain JS1289 " of the present invention is a novel serratobacilli strain isolated and identified by the present inventors in the native tree of domestic plants, which is a hybrid of "JS1289 strain" or "JS1289" Can be used.
본 발명자들은 신규 항균제나 항진균제의 개발을 위해 국내에서 자생하는 여러 식물체에서 분리된 내생균의 항진균 및 항균 효과에 대해 수년간 조사 분석하였고, 그 결과 한국 자생 구상나무에서 유래된 내생균주의 항진균 및 항염증 효과를 검증하였다(도 1 내지 도 3 참조). The present inventors have investigated and analyzed the antifungal and antimicrobial effects of endogenous bacteria isolated from various plants native to Korea for the development of new antimicrobial agents and antifungal agents. As a result, they found that the antifungal and antiinflammatory effects (See Figs. 1 to 3).
본 발명의 상기 세라토바시디움(Ceratobasidium) 속 균주 JS1289(수탁번호: KACC 83016BP)는 서열번호 1의 ITS 유전자 서열 또는 서열번호 2의 LSU(Large subunit of ribosomal DNA) 유전자 서열을 갖는 것을 특징으로 한다.The Ceratobasidium genus strain JS1289 (accession number: KACC 83016BP) of the present invention is characterized by having the ITS gene sequence of SEQ ID NO: 1 or the LSU (Large subunit of ribosomal DNA) gene sequence of SEQ ID NO: 2.
본 발명자들은 상기 유전자 서열을 종래 공지된 균주들의 유전자 서열들과 비교 분석한 결과, 본 발명의 균주가 세라토바시디움 속에 속하는 새로운 균주임을 확인하여 세라토바시디움 균주 JS1289로 명명하였고, 국립농업과학원 농업유전자원정보센터에 2017년 12월 11일자로 기탁하고, 수탁번호 KACC 83016BP를 부여받았다.As a result of comparing the gene sequence with the gene sequences of known strains, the present inventors confirmed that the strain of the present invention is a new strain belonging to the genus Ceratobacillus, named as Serratobacillus strain JS1289, It was deposited on December 11, 2017 in the original information center and was granted accession number KACC 83016BP.
본 발명의 다른 양태에 따르면, 본 발명은 상기 세라토바시디움(Ceratobasidium) 속 균주 JS1289, 또는 그 배양액을 유효성분으로 포함하는 항진균 및 항염증 조성물을 제공한다. According to another aspect of the present invention, there is provided an antifungal and anti-inflammatory composition comprising the above-mentioned Ceratobasidium sp. Strain JS1289, or a culture thereof as an active ingredient.
본 발명에서, 상기 세라토바시디움 속 JS1289 균주 또는 그 배양액은 그 자체로 항진균 및 항염증 활성을 나타내는 것을 특징으로 한다. In the present invention, the strain of the genus Serratobacillus JS1289 or the culture thereof itself is characterized by exhibiting antifungal activity and anti-inflammatory activity.
상기 세라토바시디움 속 균주 JS1289 또는 그 배양액은 다양한 진균류에 대해 항진균 활성이 있으며, 구체적으로는 칸디다 속 진균에 대해 항진균 활성을 갖고, 보다 구체적으로는 칸디다 알비칸스(Candida albicans)에 대해 항진균 활성이 있으나, 이에 한정되는 것은 아니다(도 1 참조). The Serratobacillus sp. Strain JS1289 or a culture thereof has an antifungal activity against various fungi. More specifically, it has antifungal activity against Candida spp., More specifically, Candida albicans . , But is not limited thereto (see FIG. 1).
또한, 상기 세라토바시디움 속 균주 JS1289 또는 그 배양액은 다양한 균류에 대해 항균 활성이 있다. 본 발명의 균주 또는 그 배양액은 그람 양성균, 그람 음성균 및 항생제 내성 균주에 대하여 항균 활성을 갖고 있다.In addition, the above-mentioned seratobacillus sp. Strain JS1289 or its culture has antibacterial activity against various fungi. The strain or the culture thereof of the present invention has antimicrobial activity against Gram-positive bacteria, Gram-negative bacteria and antibiotic-resistant strains.
본 발명의 일 실시예에서는 본 발명에 따른 내생균 배양액의 추출물이 다양한 병원성 진균 및 병원성 세균에 대해 생장억제 효능이 있는 것을 확인하였다.In one embodiment of the present invention, it has been confirmed that the extract of the endogenous culture solution according to the present invention has a growth inhibitory effect against various pathogenic fungi and pathogenic bacteria.
또한, 본 발명에서, 상기 세라토바시디움 속 JS1289 균주 또는 그 배양액의 항염증 활성은 산화질소(Nitric oxide, NO)의 생성 억제를 통해 이루어지는 것을 특징으로 한다. 본 발명의 일 실시예에서는 상기 세라토바시디움 속 JS1289 균주 또는 그 배양액이 염증 유발 인자인 산화질소(NO)의 생산 및 분비를 억제하는 효과가 우수함을 확인함으로써, 염증성 질환의 치료 및 예방 효과가 우수함을 확인할 수 있었다(도 2 참조).In addition, in the present invention, the anti-inflammatory activity of the strain JS1289 or its culture is characterized by inhibiting the production of nitric oxide (NO). In one embodiment of the present invention, it has been confirmed that the above-mentioned Serratobacillus genus JS1289 or a culture thereof has an excellent effect of inhibiting the production and secretion of nitric oxide (NO) which is an inflammation-inducing factor, thereby excellently treating and preventing inflammatory diseases (See Fig. 2).
본 발명에서, 상기 염증성 질환은 부종, 피부염, 알레르기, 아토피, 천식, 결막염, 치주염, 비염, 중이염, 인후염, 편도염, 폐렴, 위궤양, 위염, 크론병, 대장염, 치질, 통풍, 강직성 척추염, 류마티스 열, 루프스, 섬유근통(fibromyalgia), 건선관절염, 골관절염, 류마티스관절염, 견관절주위염, 건염, 건초염, 근육염, 간염, 방광염, 신장염, 쇼그렌 증후군(sjogren's syndrom), 다발성 경화증 등의 염증성 질환일 수 있다. In the present invention, the inflammatory disease is selected from the group consisting of edema, dermatitis, allergy, atopy, asthma, conjunctivitis, periodontitis, rhinitis, otitis, sore throat, tonsillitis, pneumonia, gastric ulcer, gastritis, Crohn's disease, colitis, hemorrhoids, Inflammatory diseases such as inflammatory bowel disease, inflammatory bowel disease, fibromyalgia, psoriatic arthritis, osteoarthritis, rheumatoid arthritis, shoulder joint inflammation, tendonitis, nephritis, myositis, hepatitis, cystitis, nephritis, sjogren's syndrome and multiple sclerosis.
본 발명의 다른 양태에 따르면, 본 발명은 상기 세라토바시디움 속 균주 JS1289 또는 그 배양액을 유효성분으로 포함하는 항진균 및 항염증 약학적 조성물을 제공한다. 본 발명의 세라토바시디움 속 균주 JS1289 또는 그 배양액은 유해 미생물에 직접 영향을 미치는 것을 통해 탁월한 항진균 및 항염증 활성을 나타내므로 항진균 및 항염증 약학적 조성물로 유용하게 사용될 수 있다.According to another aspect of the present invention, there is provided an antifungal and antiinflammatory pharmaceutical composition comprising the above-mentioned Serratobacillus sp. Strain JS1289 or a culture thereof as an active ingredient. The strain of the genus Serratobacillus, JS1289, or the culture thereof exhibits excellent antifungal and anti-inflammatory activity through direct influence on harmful microorganisms, and thus can be usefully used as an antifungal and anti-inflammatory pharmaceutical composition.
한편, 본 발명의 세라토바시디움 속 균주 배양액의 추출물은 약학적으로 허용 가능한 염의 형태로 제조될 수 있다. 구체적으로 산을 첨가함으로써 염을 형성할 수 있고, 예를 들어 무기산(예: 염산, 하이드로브롬산, 인산, 질산, 황산 등), 유기 카르복실산(예: 아세트산, 트리플루오로아세트산과 같은 할로 아세트산, 프로피온산, 말레산, 숙신산, 말산, 시트르산, 타르타르산, 살리실산), 및 산성 당(글루쿠론산, 갈락투론산, 글루콘산, 아스코르브산), 산성 폴리사카리드(예: 히알우론산, 콘드로이틴 설페이트, 아르기닌산), 콘드로이틴 설페이트와 같은 술폰산 당 에스테르를 포함하는 유기 술폰산(예: 메탄, 술폰산, p-톨루엔 술폰산) 등을 첨가하여 염을 형성할 수 있다.The extract of the culture broth of the genus Ceratobacillus of the present invention may be prepared in the form of a pharmaceutically acceptable salt. Specifically, an acid may be added to form a salt, for example, an inorganic acid such as hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid and the like, an organic carboxylic acid such as acetic acid, a halo such as trifluoroacetic acid (Such as acetic acid, propionic acid, maleic acid, succinic acid, malic acid, citric acid, tartaric acid, salicylic acid) and acidic saccharides (glucuronic acid, galacturonic acid, gluconic acid, ascorbic acid), acidic polysaccharides (such as hyaluronic acid, chondroitin sulfate, arginine (E.g., methane, sulfonic acid, and p-toluenesulfonic acid) including sulfonic acid ester such as chondroitin sulfate, and the like can be added to form a salt.
본 발명의 세라토바시디움 속 균주 JS1289 또는 그 배양액은 식용 가능한 구상나무 잎에서 분리된 내생균으로 임상 투여시 경구 또는 비경구로 투여가 가능하며 일반적인 의약품 제제의 형태로 사용될 수 있다.The strain of the genus Serratobacillus JS1289 or its culture is an endogenous live organism isolated from edible seeds of a tree, and can be administered orally or parenterally upon clinical administration and can be used in the form of a general pharmaceutical preparation.
즉, 본 발명의 신균주 JS1289 또는 그 배양액은 실제로 경구 또는 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 비경구투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁용제로는 프로필렌글리콜(Propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 리우린지, 글리세로제라틴 등이 사용될 수 있다.That is, the new strain JS1289 of the present invention or its culture can be administered in various oral or parenteral formulations. In the case of formulation, a diluent such as a filler, an extender, a binder, a wetting agent, a disintegrant, Is prepared using an excipient. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. As a suppository base, witepsol, macrogol, tween 61, cacao paper, Liu ling, glycerogelatin and the like can be used.
또한, 본 발명의 신균주 JS1289 또는 그 배양액은 생리식염수 또는 유기용매와 같이 약제로 허용된 여러 전달체(carrier)와 혼합하여 사용될 수 있고, 안정성이나 흡수성을 증가시키기 위하여 글루코오스, 수크로오스 또는 덱스트란과 같은 카본하이드레이트, 아스코르브 산(ascorbic acid) 또는 글루타치온과 같은 항산화제(anti-oxidants), 킬레이트화제(chelating agents), 저분자 단백질 또는 다른 안정화제(stabilizers)들이 약제로 사용될 수 있다.In addition, the new strain of the present invention, JS1289 or a culture thereof, can be used in combination with various carriers permitted as medicaments such as physiological saline or an organic solvent, and can be used as glucose, sucrose or dextran Antioxidants such as carbon hydrate, ascorbic acid or glutathione, chelating agents, low molecular weight proteins or other stabilizers may be used as pharmaceuticals.
본 발명의 신균주 JS1289 또는 그 배양액의 유효용량은 0.01 내지 10 ㎎/㎏이고, 바람직하게는 0.1 내지 1 ㎎/㎏ 이며, 하루 1회 내지 3회 투여될 수 있다.The effective dose of the novel strain JS1289 or the culture medium of the present invention is 0.01 to 10 mg / kg, preferably 0.1 to 1 mg / kg, and can be administered once to three times a day.
본 발명의 약학적 조성물에서 또는 그 배양액은 총 유효량은 볼루스(bolus) 형태 혹은 상대적으로 짧은 기간 동안 주입(infusion) 등에 의해 단일 투여량(single does)으로 환자에게 투여될 수 있으며, 다중 투여량(multiple does)이 장기간 투여되는 분할 치료 방법(fractionated treatment protocol)에 의해 투여될 수 있다. 상기 농도는 약의 투여 경로 및 치료 횟수뿐만 아니라 환자의 나이 및 건강상태 등 다양한 요인들을 고려하여 환자의 유효 투여량이 결정되는 것이므로 이러한 점을 고려할 때, 이 분야의 통상적인 지식을 가진 자라면 본 발명의 신균주 JS1289 또는 그 배양액의 약학적 조성물로서의 특정한 용도에 따른 적절한 유효 투여량을 결정할 수 있을 것이다.In a pharmaceutical composition of the present invention or a culture thereof, the total effective amount may be administered to a patient in a single dose, such as by bolus injection or by infusion for a relatively short period of time, (multiple does) may be administered by a fractionated treatment protocol administered over a prolonged period of time. Since the concentration of the effective dose of the patient is determined in consideration of various factors such as the route of administration and the number of treatments as well as the age and health condition of the patient, in view of this point, Lt; RTI ID = 0.0 > JS1289 < / RTI > or its pharmaceutical composition as a pharmaceutical composition.
본 발명의 또 다른 양태에 따르면, 본 발명은 항진균 및 항염증 활성을 갖는 세라토바시디움(Ceratobasidium) 속 균주 JS1289 또는 그 배양액을 유효성분으로 함유하는 항진균 및 항염증 화장료 조성물을 제공한다.According to still another aspect of the present invention, there is provided an antifungal and anti-inflammatory cosmetic composition comprising, as an active ingredient, a strain of Ceratobasidium sp. JS1289 or a culture thereof having an antifungal and anti-inflammatory activity.
본 발명의 신균주 JS1289 또는 그 배양액은 유해 미생물에 직접 영향을 미치는 것을 통해 탁월한 항진균 및 항염증 활성을 나타므로 항진균 및 항염증 화장료 조성물로 유용하게 사용될 수 있다.The novel strain JS1289 or the culture thereof of the present invention exhibits excellent antifungal and anti-inflammatory activity through direct influence on harmful microorganisms, and thus can be usefully used as an antifungal and anti-inflammatory cosmetic composition.
본 발명의 화장료 조성물은 유효성분으로 상기 신균주 JS1289 또는 그 배양액 이외에 화장료 조성물에 통상적으로 이용되는 성분들이 포함되며, 예컨대 항산화제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제, 그리고 담체를 포함한다.The cosmetic composition of the present invention contains, as an active ingredient, components commonly used in cosmetic compositions in addition to the above-mentioned new strain JS1289 or a culture thereof, and may contain conventional auxiliaries such as antioxidants, stabilizers, solubilizers, vitamins, And a carrier.
본 발명의 화장료 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화 될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 유연 화장수(스킨), 영양 화장수(밀크로션), 영양 크림, 마사지 크림, 에센스, 아이크림, 클렌징크림, 클렌징폼, 클렌징 워터, 팩, 스프레이 또는 파우더의 제형으로 제조될 수 있다.The cosmetic composition of the present invention can be prepared into any of the formulations conventionally produced in the art and can be used in the form of solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, , Oil, powder foundation, emulsion foundation, wax foundation and spray, but is not limited thereto. More specifically, it can be manufactured in the form of a flexible lotion (skin), a nutritional lotion (milk lotion), a nutritional cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray or a powder .
본 발명의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성 유, 식물성 유, 왁스, 파라핀, 전분, 트라가칸타, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.When the formulation of the present invention is a paste, a cream or a gel, an animal oil, vegetable oil, wax, paraffin, starch, tragacantha, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide .
본 발명의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토오스, 탈크, 실리카, 알루미늄 하이드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로하이드로카본, 프로판/부탄 또는 디메틸에테르와 같은 추진체를 포함할 수 있다.When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In the case of a spray, in particular, chlorofluorohydrocarbons, propane / Propane or dimethyl ether.
본 발명의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌글리콜 또는 소르비탄의 지방산 에스테르가 있다.When the formulation of the present invention is a solution or an emulsion, a solvent, a dissolving agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, , 3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan fatty acid esters.
본 발명의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소 결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라가칸타 등이 이용될 수 있다.In the case where the formulation of the present invention is a suspension, a carrier such as water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Cellulose, aluminum metahydroxide, bentonite, agar or tragacantha, etc. may be used.
본 발명의 제형이 계면-활성제 함유 클렌징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 오일, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.When the formulation of the present invention is an interfacial active agent-containing cleansing, the carrier component is selected from aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters.
본 발명의 화장품의 구체예로서는 세안크림, 세안폼, 클렌징크림, 클렌징밀크, 클렌징로션, 마사지크림, 콜드크림, 모이스처크림, 유액, 화장수, 팩, 에프터세이빙크림, 썬텐방지크림, 썬텐용 오일, 비누, 보디샴푸, 헤어샴푸, 헤어린스, 헤어트리트먼트, 양모료, 육모료, 헤어크림, 헤어리퀴드, 세트로션, 헤어스프레이, 헤어브리지, 컬러린스, 컬러스프레이, 퍼머넌트웨이브액, 프레스파우더, 루스파우더, 아이섀도, 핸드크림, 립스틱 등을 들 수 있다.Specific examples of the cosmetics of the present invention include eye creams, cleansing creams, cleansing milks, cleansing lotions, massage creams, cold creams, moisturizing creams, milks, lotions, packs, after-shave creams, sunscreen- Hair shampoo, hair shampoo, hair rinse, hair treatment, hair dye, hair dye, hair cream, hair liquid, set lotion, hair spray, hair bridge, color rinse, color spray, permanent wave liquid, press powder, loose powder , Eye shadow, hand cream, lipstick, and the like.
본 발명의 또 다른 양태에 따르면, 본 발명은 항진균 및 항염증 활성을 갖는 세라토바시디움(Ceratobasidium) 속 균주 JS1289 또는 그 배양액을 유효성분으로 함유하는 식품 또는 사료 보존용 조성물을 제공한다.According to another aspect of the present invention, there is provided a food or feed preserving composition containing, as an active ingredient, a strain of Ceratobasidium sp. JS1289 or a culture thereof having antifungal and anti-inflammatory activity.
식품이나 사료의 보존제는 식품이나 사료의 변질, 부패, 변색 및 화학변화를 방지하기 위해 사용되는 첨가물로서 살균제, 산화방지제가 이에 포함되며, 세균, 곰팡이, 효모 등 미생물의 증식을 억제하여 식품, 사료, 화장품, 의약품 등에서 부패미생물의 발육저지 또는 살균작용을 하는 등의 기능성 항균제도 포함된다. 이러한 식품이나 사료의 방부제의 이상적인 조건으로는 독성이 없어야 하며, 미량으로도 효과가 있어야 한다. 본 발명의 세라토바시디움(Ceratobasidium) 속 균주 JS1289 또는 그 배양액은 유해 미생물에 직접 영향을 미치는 것을 통해 탁월한 항진균 및 항염증 활성을 나타므로 상기의 식품이나 사료의 보존제, 화장품 보존제 및 의약품 보존제 등에 폭넓게 사용될 수 있다.A food or feed preservative is an additive used to prevent deterioration, decay, discoloration and chemical change of food or feed. It includes antiseptic and antioxidant, and inhibits the growth of microorganisms such as bacteria, fungi and yeast. , Cosmetics, medicines and the like, as well as functional antimicrobial agents such as inhibiting the growth of microorganisms or sterilizing the microorganisms. Ideal conditions for preserving food or feed should not be toxic and should be effective in trace amounts. Since the Ceratobasidium genus strain JS1289 of the present invention or its culture has an excellent antifungal activity and anti-inflammatory activity through directly influencing harmful microorganisms, it can be widely used for preservatives, cosmetic preservatives, .
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 세라토바시디움(Ceratobasidium) 속 균주 JS1289 또는 그 배양액을 함유하는 조성물을 치료를 필요로 하는 개체에 투여하여 병원성 세균을 사멸시키는 단계를 포함하는, 인간을 제외한 동물의 세균 또는 진균성 감염 질환을 치료하는 방법을 제공한다.According to another aspect of the present invention, the present invention provides a method for treating a human, comprising administering to a subject in need of treatment a composition containing the above-mentioned Ceratobasidium sp. Strain JS1289 or a culture thereof to kill pathogenic bacteria Lt; RTI ID = 0.0 > bacterial < / RTI > or fungal infectious disease.
또한, 발명의 또 다른 양태에 따르면, 본 발명은 상기 세라토바시디움(Ceratobasidium) 속 균주 JS1289 또는 그 배양액을 함유하는 조성물을 치료를 필요로 하는 개체에 투여하여 염증성 질환을 치료 또는 예방하는 단계를 포함하는, 인간을 제외한 동물의 염증성 질환을 치료하는 방법을 제공한다.According to still another aspect of the present invention, the present invention includes a method for treating or preventing an inflammatory disease by administering a composition containing the above-mentioned Ceratobasidium sp. Strain JS1289 or a culture thereof to an individual in need of treatment A method for treating an inflammatory disease of an animal other than human.
본 발명에 따른 상기 치료방법은 비록 인간을 제외한 동물을 치료하는 방법이나, 인간에 있어 이러한 치료방법이 효과가 없음을 의미하는 것은 아니다. 또한, 인간의 경우 있어서 본 발명에 따른 치료용 조성물의 투여에 의해 세균 또는 진균 감염이나, 염증성 질환에 대한 증상이 호전될 수 있음을 고려할 때, 인간의 치료에 있어서도 충분히 사용될 수 있다.The method of treatment according to the present invention does not mean that a method of treating an animal other than a human, but such a treatment method is ineffective in humans. Further, in the case of humans, it can be sufficiently used in the treatment of humans, considering that the administration of the therapeutic composition according to the present invention can improve symptoms of bacterial or fungal infections or inflammatory diseases.
본 발명에서 상기 "염증성 질환"은 염증을 주병변으로 하는 질병을 총칭하는 의미로서, 이에 제한되지는 않으나, 바람직하게는 부종, 피부염, 알레르기, 아토피, 천식, 결막염, 치주염, 비염, 중이염, 인후염, 편도염, 폐렴, 위궤양, 위염, 크론병, 대장염, 치질, 통풍, 강직성 척추염, 류마티스 열, 루푸스, 섬유근통(fibromyalgia), 건선관절염, 골관절염, 류마티스 관절염, 견관절주위염, 건염, 건초염, 근육염, 간염, 방광염, 신장염, 쇼그렌 증후군(sjogren's syndrome) 또는 다발성 경화증일 수 있다.The term " inflammatory disease " in the present invention means a disease in which inflammation is the main lesion, and includes, but is not limited to, edema, dermatitis, allergy, atopy, asthma, conjunctivitis, periodontitis, rhinitis, otitis, Rheumatoid arthritis, osteoarthritis, rheumatoid arthritis, shoulder inflammation, tendonitis, nephritis, myositis, hepatitis, osteoarthritis, osteoarthritis, osteoarthritis, Cystitis, nephritis, sjogren's syndrome or multiple sclerosis.
본 발명에서 용어 "인간을 제외한 동물"은 본 발명에 따른 치료용 조성물의 투여에 의해 증상이 호전될 수 있는 세균 또는 진균의 감염에 의해 유발되는 질환이나 염증성 질환을 갖는 인간만을 제외한 말, 양, 돼지, 염소, 낙타, 영양, 개 등의 동물을 의미한다. 본 발명에 따른 치료용 조성물을 인간을 제외한 동물에게 투여함으로써, 세균 및 진균 감염에 의한 질환이나 염증성 질환을 효과적으로 예방 및 치료할 수 있다.The term " animal excluding human being " in the present invention refers to an animal, such as a horse, a sheep, an animal, a mammal, or a mammal other than a human having an inflammatory disease or a disease caused by infection with a bacterium or a fungus, Pig, goat, camel, nutrition, and dog. By administering the therapeutic composition according to the present invention to an animal other than a human, diseases and inflammatory diseases caused by bacteria and fungal infections can be effectively prevented and treated.
본 발명에서 용어 "투여"는 어떠한 적절한 방법으로 동물에게 소정의 물질을 도입하는 것을 의미하며, 본 발명에 따른 치료용 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 경구 또는 비경구 투여될 수 있다. 또한, 본 발명에 따른 치료용 조성물은 유효성분이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다.The term " administering " in the present invention means introducing a predetermined substance into an animal by any appropriate method, and the administration route of the therapeutic composition according to the present invention may be administered orally, May be administered parenterally. In addition, the therapeutic composition according to the present invention may be administered by any device capable of moving the active ingredient into the target cell.
본 발명에 따른 치료용 조성물의 바람직한 투여량은 치료 대상 동물의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 그러나, 바람직한 효과를 위해서, 본 발명의 약학적 조성물은 0.01 내지 10 ㎎/㎏이고, 바람직하게는 0.1 내지 1 ㎎/㎏ 이며, 하루 1회 내지 3회 투여할 수 있다.The preferable dosage of the therapeutic composition according to the present invention varies depending on the condition and body weight of the animal to be treated, the degree of disease, the type of drug, route of administration and period of time, but can be appropriately selected by those skilled in the art. However, for the desired effect, the pharmaceutical composition of the present invention is 0.01 to 10 mg / kg, preferably 0.1 to 1 mg / kg, and can be administered once to three times a day.
본 발명의 특징 및 이점을 요약하면 다음과 같다:The features and advantages of the present invention are summarized as follows:
(ⅰ) 본 발명은 구상나무 잎에서 유래한 세라토바시디움 속 JS1289 균주 또는 그 배양액을 유효성분으로 포함하는 항진균 및 항염증 조성물을 제공한다.(I) The present invention provides an antifungal and anti-inflammatory composition comprising a strain of JS1289 of the genus Ceratobasidium originating from a conifer tree leaf or a culture thereof as an active ingredient.
(ⅱ) 본 발명의 세라토바시디움 JS1289 균주 또는 그 배양액을 포함하는 조성물은 유해세균에 의해 발생하는 다양한 세균 감염증에 적용이 가능하며, 산화질소의 분비를 효과적으로 억제함으로써 염증성 질환에 적용이 가능하다. (Ii) The composition of the present invention, comprising the Serratobacidium JS1289 strain or a culture thereof, can be applied to various bacterial infectious diseases caused by harmful bacteria and can be effectively applied to inflammatory diseases by effectively inhibiting the secretion of nitric oxide.
(ⅲ) 또한, 본 발명의 조성물은 화장료 조성물, 식품 또는 사료 보존용 첨가제 조성물 등의 다양한 분야에서 항진균 및 항염증 목적으로 유용하게 이용가능하다.(Iii) Further, the composition of the present invention can be usefully used for antifungal and anti-inflammatory purposes in various fields such as cosmetic composition, food or feed preservative additive composition, and the like.
도 1은 Candida albicans에 대한 세라토바시디움 속 JS1289 균주의 항균활성 시험 결과를 나타낸 그래프이다.
도 2는 세라토바시디움 속 JS1289 균주의 배양액이 산화질소(NO) 생성 억제를 통해 항염증 활성을 나타내는 것을 보여주는 그래프이다.
도 3은 세라토바시디움 속 JS1289 균주의 배양액에 대한 세포독성 실험 결과를 나타내는 그래프이다.
도 4는 세라토바시디움 속 JS1289 균주가 감자설탕한천배지 상에서 생장하는 모습을 촬영한 사진이다.
도 5는 다양한 배지 조건에서 세라토바시디움 속 JS1289 균주가 생장하는 모습을 촬영한 사진이다.
도 6은 세라토바시디움 속 JS1289 균주의 ITS 염기서열 정보를 바탕으로 시행한 계통분석 그래프이다.
도 7은 세라토바시디움 속 JS1289 균주의 LSU 염기서열 정보를 바탕으로 시행한 계통분석 그래프이다.1 is a Candida FIG. 2 is a graph showing the antibacterial activity test results of the strain JS1289 of the genus Ceratobasidium on albicans .
FIG. 2 is a graph showing that a culture solution of a strain JS1289 of the genus Ceratobasidium shows anti-inflammatory activity through inhibition of nitric oxide (NO) production.
FIG. 3 is a graph showing the cytotoxicity test results of a culture solution of the strain JS1289 of the genus Ceratobacillus.
FIG. 4 is a photograph of a strain of the genus Ceratobasidium JS1289 growing on a potato sugar agar medium.
FIG. 5 is a photograph showing the growth of the strain JS1289 of the genus Ceratobasidium under various medium conditions.
6 is a systematic analysis graph based on ITS nucleotide sequence information of the genus Serratobacillus JS1289.
7 is a systematic analysis graph based on LSU nucleotide sequence information of the genus Serratobacillus JS1289.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다. Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention, and it is to be understood by those skilled in the art that the present invention is not limited thereto It will be obvious.
실시예 1. 균주 분리Example 1 Isolation of Strain
항진균 및 항염증 활성이 있는 식물 내생균을 수집하기 위해 먼저 식물 시료로 구상나무 줄기를 확보하였다. To collect live bacteria in plants with antifungal and antiinflammatory activity, conifer trees were first obtained as plant samples.
구상나무는 전라북도 무주군의 지리산 일대 및 제주도 한라산 지역에서 채집하였다. 채집한 식물 시료는 흐르는 수돗물로 표면에 붙은 흙먼지를 씻고 물기를 닦은 후, 내생균 분리에 사용하였다. 먼저, 잎 조직은 5mm×5mm 크기의 단편으로, 가지, 줄기 및 뿌리는 1 내지 2mm 폭으로 작게 조각내어 샘플을 채취한 후, 1.5% NaOCl 용액에 3분 동안 살균하고, 다시 70% 에탄올에서 2분간 표면 살균하였다. 살균된 샘플 증류수에 1분간 침지한 후 멸균된 페이퍼 타월로 물기를 닦아내고, 균주 분리용 배지에 치상하였다. The trees were collected from Jirisan area in Muju - gun, Jeollanam - do and Halla mountain area in Cheju island. The collected plant samples were washed with flowing tap water, and the dirt was wiped off and then used for segregation of endogenous bacteria. First, the leaf tissues were 5 mm × 5 mm pieces, and the branches, stems and roots were cut into small pieces with a width of 1 to 2 mm. Samples were collected, sterilized in a 1.5% NaOCl solution for 3 minutes, Lt; / RTI > The sterilized sample was immersed in distilled water for 1 minute, wiped off with a sterilized paper towel, and wound on a culture medium for strain isolation.
배지는 50ppm 로즈 벵갈(Rose Bengal), 100ppm 카나마이신(Kanamycin), 100ppm 스트렙토마이신(Streptomycin)을 첨가한 PDA(potato dextrose agar) 배지와 MEA(malt extract agar) 배지를 사용하였다. 5 내지 10일간 배양 후 식물조직에서 자라나오는 균총의 가장자리에서 어린 균사를 새로운 PDA 배지에 옮겨 순수 분리하고, 분리된 균주를 넘버링 하였다.The medium used was a PDA (potato dextrose agar) medium and a MEA (malt extract agar) medium supplemented with 50 ppm of Rose Bengal, 100 ppm of kanamycin, 100 ppm of streptomycin. After culturing for 5 to 10 days, young mycelium was transferred to a new PDA medium at the edge of the microflora growing on the plant tissue, and the microorganism was separated purely, and the isolated strains were numbered.
실시예 2. 균주 배양 및 유효성분 추출Example 2. Culture of strains and extraction of active ingredient
감자한천액체배지(PDB: potato dextrose broth) 250ml에서 상기 실시예 1의 PDA(potato dextrose agar) 배지에서 자란 균사가 함유된 한천조각을 약 1mm2의 크기로 잘게 잘라서 접종하고, 24℃, 180rpm으로 3주간 진탕 배양하였다. The agar slices containing mycelium grown in the PDA (potato dextrose agar) medium of Example 1 were finely cut into 250 ml of potato dextrose broth (PDB) at about 1 mm 2 and inoculated at 24 ° C and 180 rpm And cultured for 3 weeks with shaking.
배양 후 미라클로스(miracloth)를 이용하여 균사체를 걸러내고 배양한 여액을 에틸아세테이트(Ethyl acetate)용매로 추출하였다. 추출은 배양 여액과 같은 부피의 에틸아세테이트(Ethyl acetate)로 20분씩 2회 진행하였다. 추출물은 감압농축하여 건조한 후 정량하고, DMSO 용액에 재용해한 후 활성 분석에 사용하였다.After culturing, the mycelium was filtered using miracloth, and the filtrate was extracted with ethyl acetate solvent. The extraction was carried out twice in 20-minute intervals with the same volume of ethyl acetate as the culture filtrate. The extracts were concentrated under reduced pressure, dried and quantitated, redissolved in DMSO solution and used for activity analysis.
실시예 3. 항진균 활성 검정Example 3. Antifungal activity assay
식물 내생균의 항진균 활성 실험은 마이크로 플레이트를 이용한 표준 분석 방법이 사용되었다(Serrone PD and Nicoletti M, 2013).The standard assay method using microplates was used to test the antifungal activity of live bacteria in plants (Serrone PD and Nicoletti M, 2013).
칸디다증을 유발하는 병원성 진균인 칸디다 알비칸스(Candida albicans)는 SDB(Sabouraud dexrtrose browth) 배지에서 30℃, 200rpm 조건으로 24시간 동안 배양하였다. 상기 병원성 진균을 1 X 105(conidia/ml) 농도로 희석하여 96 웰 플레이트(well plate)에 접종하고, 상기 실시예 2의 방법으로 추출된 추출물을 50ppm 농도로 처리하고, 30℃, 200rpm 조건에서 24시간 동안 배양하였다. 대조군으로 암포테리신 B(Amphotericin B) 10ppm을 양성대조군으로 사용하였다. Candida albicans , a pathogenic fungus inducing candidiasis, was cultured in SDB (Sabouraud dextrose broth) medium at 30 ° C and 200 rpm for 24 hours. The pathogenic fungus was diluted to a concentration of 1 × 10 5 (conidia / ml), inoculated into a 96-well plate, the extract extracted with the method of Example 2 was treated at a concentration of 50 ppm, For 24 hours. As a control group, 10 ppm of amphotericin B was used as a positive control.
항균 활성을 측정하기 위해 마이크로플레이트 리더기를 사용해 600nm에서 OD 값을 측정하였고, 시료 처리를 하지 않은 음성대조군과 비교하여 진균의 생장률을 계산하였다. 각 실험은 3번 반복해서 진행되었다. 균주 생장률은 아래 공식을 이용하여 계산하였다. To measure the antimicrobial activity, the OD value was measured at 600 nm using a microplate reader, and the growth rate of the fungi was calculated in comparison with the negative control group without sample treatment. Each experiment was repeated three times. The strain growth rate was calculated using the following formula.
Relative growth rate(%) = [(ControlAbs TreatmentAbs)/ControlAbs] x 100Relative growth rate (%) = [(Control Abs Abs ) / Control Abs ] x 100
그 결과, 상기 실시예 1에서 분리되어 JS1289로 넘버링 된 내생균의 추출물을 50ppm으로 처리한 실험군은 무처리군 대비 6.34±0.25%로 생장하여, 우수한 항진균 효과가 있음이 관찰되었다. 이러한 항진균 효과는 양성대조군인 Amphotericin B 10ppm 처리군의 항진균 활성과 유사한 결과를 갖는 것으로 확인되었다(도 1 참조). As a result, it was observed that the experimental group treated with 50 ppm of the extract of endogenous bacteria isolated in Example 1 and numbered JS1289 grew to 6.34 ± 0.25% as compared with the untreated group and had excellent antifungal effect. This antifungal effect was confirmed to be similar to the antifungal activity of the 10 ppm amphotericin B treatment group (see FIG. 1).
실시예 4. 항염증 활성 검정Example 4. Anti-inflammatory activity assay
식물 내생균 추출물의 항염증 활성은 LPS(Lipopolysaccharide)에 의해 활성화된 생쥐 미세아교세포(BV-2 Microglial)의 염증반응을 상대적 산화질소(NO; nitric oxide) 생성 정도(relative extracellular NO level)로 측정하였다. LPS를 처리하지 않은 세포와 LPS를 처리한 세포에서 생성되는 NO를 측정하고, 추출물에 의해 감소되는 NO 생성 정도와 비교하여 항염증활성을 확인하였다. 항염증활성 검정 후 MTS(sigma)를 이용하여 추출물에 의한 세포독성을 확인하였다. The anti-inflammatory activity of plant extracts was determined by measuring the inflammatory response of mouse microglia (BV-2 Microglial) activated by Lipopolysaccharide to relative nitric oxide (NO) production (relative extracellular NO level) Respectively. NO produced in cells treated with LPS and cells treated with LPS were measured and compared with the degree of NO production reduced by the extract, anti-inflammatory activity was confirmed. After the anti - inflammatory activity test, the cytotoxicity of the extract was confirmed using MTS (sigma).
구체적으로 실험을 위해서, BV-2 세포를 37℃, CO2 incubator에서 10% FBS가 포함된 DMEM(Dulbecco's Modified Eagle's Medium) 배지에 배양하였다. 96well plate의 well 당 5 X 104/200ul의 세포 농도로 접종하고, 24시간 배양하였다. Specifically, BV-2 cells were cultured in DMEM (Dulbecco's Modified Eagle's Medium) medium containing 10% FBS at 37 ° C in a CO 2 incubator. The cells were inoculated at a cell concentration of 5 x 10 4 / 200ul per well of a 96-well plate and cultured for 24 hours.
배지를 걷어내고 추출물을 적정농도를 처리한 0.5% FBS가 포함된 DMEM 배지로 교체한 후, 3시간 후에 LPS를 처리하여 염증반응을 유도하였다. 24시간 반응 후, 배지 50ul를 새로운 plate로 옮기고, Griess reagent(Enzo) 50ul를 넣은 뒤, 호일로 싸서 빛을 차단하고, 5분 동안 상온에서 보관하고, 540nm에서의 흡광도를 측정하여 NO 생성 정도를 비교하였다. The medium was removed and the extracts were replaced with DMEM medium containing 0.5% FBS treated with the appropriate concentration. After 3 hours, LPS treatment induced inflammation. After 24 hours of reaction, 50 μl of the medium was transferred to a new plate, and 50 μl of Griess reagent (Enzo) was added, wrapped in foil to block light, stored at room temperature for 5 minutes and absorbance at 540 nm Respectively.
또한, 세포독성을 검정하기 위해서는 NO 생성확인이 끝난 plate의 배지를 모두 제거하고, MTS 20ul와 배지 100ul 섞은 용액 120ul를 처리하였다. 혼합용액을 37℃, CO2 incubator에서 1시간 30분 반응시킨 후, 흡광도(490nm)를 측정하여 세포독성을 확인하였다. 항염증 활성 검정을 위해 LPS 및 본 발명의 추출물을 처리하지 않은 실험군과, LPS를 처리하고 본 발명의 추출물을 처리하지 않은 실험군을 대조군으로 하여, 염증반응 정도를 상대적인 NO 생산량으로 확인하였다. In addition, to test cytotoxicity, all of the plates of the NO production-confirmed plate were removed, and 120ul of the solution containing 20ul of MTS and 100ul of the medium was treated. The mixed solution was incubated at 37 ° C for 1 hour and 30 minutes in a CO 2 incubator, and the absorbance (490 nm) was measured to confirm cytotoxicity. For the antiinflammatory activity test, the degree of inflammation was determined as the relative NO production amount by using the experimental group not treated with LPS and the extract of the present invention, and the experimental group treated with LPS and the extract of the present invention as a control group.
그 결과, LPS를 처리하지 않은 실험군(negative control)의 상대적 NO 생성량을 100%로 볼 때, LPS만을 처리한 실험군(positive control)에서는 3,631 ± 75.1 % 수준의 산화질소가 생성되어 염증반응이 유발됨을 확인하였다. As a result, when the relative NO production of the LPS-untreated control group was considered to be 100%, 3,331 ± 75.1% of the nitric oxide was produced in the LPS-treated positive control group, Respectively.
한편, 본 발명의 세라토바시디움(Ceratobasidium) 속 JS1289 추출물 50ppm을 처리한 후, LPS로 염증반응을 일으킨 실험군에서는 산화질소 생성 수준이 1,100 ± 12.1%로 나타나, LPS만을 처리한 실험군에 비해 산화질소의 생성량이 약 31% 수준으로 감소하여 통계적으로도 유의한 차이를 나타냈다. On the other hand, in the experimental group treated with 50 ppm of the extract of Ceratobasidium genus JS1289 of the present invention, the level of nitric oxide production was 1,100 ± 12.1% in the experimental group in which inflammation was caused by LPS, and compared with the group treated with LPS alone, The production amount decreased to about 31% level and statistically significant difference was shown.
이러한 항염증 활성은 추출물의 농도 의존적으로 관찰되었는데, 추출물 농도가 감소함에 따라 항염증활성도 감소됨을 확인하였다(도 2 참조). These anti-inflammatory activities were observed in a concentration-dependent manner, and it was confirmed that the anti-inflammatory activity was reduced as the concentration of the extract decreased (see FIG. 2).
한편, 세포의 생존율은 LPS를 처리하지 않은 실험군(negative control)의 세포 생존율을 100%로 볼 때, 본 발명의 세라토바시디움(Ceratobasidium) 속 JS1289 추출물을 50ppm의 농도로 처리하면 88.88 ± 2.81%로, 10ppm 농도로 처리하면 84.59 ± 2.24% 정도로 나타나, 임상적으로 허용 가능한 수치 범위인 것으로 관찰되었다(도 3 참조). On the other hand, the survival rate of cells was 88.88 ± 2.81% when the cell viability of the negative control of LPS was 100%, when the JS1289 extract of Ceratobasidium of the present invention was treated at a concentration of 50 ppm , And when treated at a concentration of 10 ppm, it was 84.59 ± 2.24%, which is a clinically acceptable range (see FIG. 3).
실시예 5. 탄소원에 따른 생장특성 검증Example 5. Verification of growth characteristics according to carbon source
세라토바시디움(Ceratobasidium) JS1289 균주의 배지에 따른 생장 특성을 파악하고자, CDA(Czapek Dox Agar) 배지에 탄소원을 다르게 처리하여 탄소원별 생장특성을 확인하였다. 탄소원은 프록토오스(Fructose), 글루코오스(Glucose), 이노시톨(Inositol), 만니톨(Mannitol), 만노오스(Mannose), 솔비톨(Sorbitol), 수크로오스(Sucrose), 및 자일로오스(Xylose)를 각각 2% 농도로 처리하였다. 이외에 영양배지인 PDA, V8, 및 오트밀(Oatmeal)의 3종 배지와 함께 비교하였다. In order to investigate the growth characteristics of Ceratobasidium JS1289 strain, growth characteristics of carbon sources were examined by treating carbon source differently with CDA (Czapek Dox Agar) medium. The carbon source is 2% each of Fructose, Glucose, Inositol, Mannitol, Mannose, Sorbitol, Sucrose, and Xylose, Lt; / RTI > In addition, we compared them with the three kinds of nutrient media: PDA, V8, and Oatmeal.
실험은 6 웰 플레이트에 각각의 배지를 5ml씩 넣은 후, 세라토바시디움(Ceratobasidium) 속 JS1289를 접종하고, 1주에서 4주 동안 배양하여 비교하였다. In the experiment, 5 ml of each medium was added to a 6-well plate, and then JS1289 in Ceratobasidium was inoculated and cultured for 1 week to 4 weeks.
그 결과, CDA 배지에 8가지 탄소원을 첨가하여 제조한 배지의 경우, 탄소원이 달라도 성장속도가 유사하고 자라는 형태, 균사와 배지 색의 변화도 없는 것으로 관찰되었다. As a result, it was observed that the medium prepared by adding 8 carbon sources to the CDA medium had similar growth rates and no change in growth pattern, hyphae and medium color even though the carbon source was different.
한편, 영양배지인 PDA, V8, 오트밀 배지에서는 전체적으로 CDA 배지에 비하여 빠르고 풍성하게 자라는 것을 확인하였고, 특히 PDA와 오트밀 배지의 균사는 백색의 공기 중 균사(aerial mycelia) 형태로 자라는 특징이 있는 것으로 확인되었다. 반면 V8 배지에서는 균사가 배지에 붙어 자라면서 생장속도는 PDA, 오트밀 배지와 같지만 형태는 확연히 다른 것이 관찰되었다(도 5 참조). On the other hand, PDA, V8, and oatmeal media, which are nutrient media, showed faster and richer growth compared to CDA media. Especially, hyphae of PDA and oatmeal media were characterized as white aerial mycelia . On the other hand, in the V8 medium, the mycelium adhered to the medium and the growth rate was the same as that of the PDA and oatmeal medium, but the morphology was clearly different (see FIG. 5).
실시예 6. 내생균주의 염기서열 분석을 통한 동정Example 6 Identification of Endogenous Strains by Sequence Analysis
상기 실시예 3 및 4에서 항진균 및 항염증 효과가 검증된 JS1289 균주의 PDA 고체배지 상에서의 생장모습을 확인하였다. PDA 배지에서 분생포자를 형성하지 않았으며, 현미경으로 관찰했을 때 직각으로 분지하는 세라토바시디움 속 균주의 특징적 균사형을 보였다.In the above Examples 3 and 4, the growth of JS1289 strain on the solid medium of PDA confirmed the antifungal and anti-inflammatory effect was confirmed. The conidia were not formed in the PDA medium, and when observed with a microscope, they showed a characteristic mycelial form of a strain of the genus Ceratobasidium branching at a right angle.
분리된 DNA를 주형으로 서열번호 3의 ITS1F(CTTGGTCATTTAGAGGAAGTAA) 프라이머와 서열번호 4의 LR5(ATCCTGAGGGAAACTTC) 프라이머를 이용하여 ITS(Internal Transcribed Spacer)와 LSU(Large subunit of ribosomal DNA) 영역 일부를 증폭하고, ABI PRISM 3730 XL analyzer(마크로젠) 플랫폼으로, ITS1F, ITS3, ITS4, LR0R, LR5 프라이머를 이용하여 염기서열을 확보하였다(Gardes and Bruns, 1993; White et al., 1990). PCR 증폭과 시퀀싱에 사용된 프라이머 서열은 하기 표 1과 같다.(ITS1F (CTTGGTCATTTAGAGGAAGTAA) primer of SEQ ID NO: 3 and LR5 (ATCCTGAGGGAAACTTC) primer of SEQ ID NO: 4 were used as a template, and a part of ITS (Internal Transcribed Spacer) and LSU (Large subunit of ribosomal DNA) Primers were obtained using primers ITS1F, ITS3, ITS4, LR0R, and LR5 as the PRISM 3730 XL analyzer (Macrogen) platform (Gardes and Bruns, 1993; White et al., 1990). The primer sequences used for PCR amplification and sequencing are shown in Table 1 below.
JS1289 균주에서 추출된 genomic DNA를 주형으로 하여 ITS와 LSU rDNA region을 대상으로 유전자증폭(PCR)을 실시하였다. PCR 조건은 다음과 같다. 유전자증폭은 Thermal cycler(Applied Biosystems 2720)를 이용하여, ① 95℃, 5min, ② 90℃, 1min, ③ 50℃, 1min, ④ 72℃, 2min, 및 ② 내지 ④ 과정을 30 cycle 반복한 후, ⑤ 72℃, 10min의 프로그램으로 진행하였다. 상기 PCR 산물을 1.3% agarose gel에서 전기영동 후, 겔 다큐멘테이션(Bio-Rad)을 이용하여 결과를 확인한 후, PCR purification kit(K-3034, Bioneer)를 이용하여 증폭된 단편을 정제하였다. Gene amplification (PCR) was performed on ITS and LSU rDNA regions using genomic DNA extracted from JS1289 strain as a template. The PCR conditions were as follows. Gene amplification was repeated 30 cycles of (1) 95 ° C for 5 minutes, (2) 90 ° C for 1 minute, (3) 50 ° C for 1 minute, (4) 72 ° C for 2 minutes, and (5) The program was carried out at 72 ° C for 10 minutes. The PCR product was electrophoresed on 1.3% agarose gel, and the result was confirmed by gel-dication (Bio-Rad). The amplified fragment was purified using a PCR purification kit (K-3034, Bioneer).
확보된 염기서열은 Sequencher 프로그램으로 고품질 영역을 추출하고 조립하여 consensus sequence를 확정하고, NCBI의 ntDB를 대상으로 BLASTn 알고리즘으로 상동성을 검색하였다. The obtained sequences were extracted and assembled by using the Sequencher program to identify the consensus sequence, and the homology was searched using the BLASTn algorithm for ntDB of NCBI.
ITS 영역(ITS1F-ITS4 사이)과 LSU 영역의 서열(LR0R과 LR5 사이)을 각각 나누고, 상동성 검색결과 나온 근연종의 서열과 다중정렬(multiple alignment)한 후, 계통수를 그려 계통관계를 확인하였다. 다중정렬은 ClustalW 프로그램을 이용하였고, 계통수는 MEGA version 6.06(Tamura et al., 2011)의 neighbor-joining method(Saitou and Nei, 1987)를 이용하여 작성하였으며, 1,000번의 bootstrap을 통해 신뢰도를 제고하였다.The ITS region (between ITS1F-ITS4) and the sequence of LSU region (between LR0R and LR5) were divided, and multiple alignments were made with the sequence of the relatives from the homology search result, . Multiple alignment was performed using the ClustalW program, and the number of trees was created using the neighbor-joining method of MEGA version 6.06 (Tamura et al., 2011) (Saitou and Nei, 1987).
그 결과, ITS1과 LR5 프라이머를 이용하여 증폭된 단편의 크기는 약 1,500bp 정도로 확인되었다. 상기 5개의 primer를 이용하여 얻은 염기서열은 SEQUENCHERTM (GeneCodes Corporation) program을 이용하여 ITS region 에서 LSU 영역까지 하나의 콘티그(contiguous sequence)로 만들고, 각 영역의 서열로 나누었다. As a result, the size of the fragment amplified using the ITS1 and LR5 primers was found to be about 1,500 bp. The nucleotide sequences obtained by using the five primers were made into a contiguous sequence from the ITS region to the LSU region using a SEQUENCHER ™ (GeneCodes Corporation) program, and the sequence was divided into regions.
그 결과 확보된 ITS 영역의 서열은 서열번호 1의 681bp 서열로 나타났고, LSU 영역의 서열은 서열번호 2의 921bp 서열로 나타났다.The resultant sequence of the ITS region was represented by the 681 bp sequence of SEQ ID NO: 1, and the sequence of the LSU region was represented by the 921 bp sequence of SEQ ID NO: 2.
또한, JS1289 균주의 ITS 서열을 이용한 상동성 검색 결과, 세라토바시디움(Ceratobasidium) 속[Basidiomycota 문; Agaricomycotina 아문; Agaricomycetes 강; Cantharellales 목; Ceratobasidiaceae 과] 균주들의 ITS 서열과 가장 높은 상동성을 보였다.As a result of homology search using the ITS sequence of the JS1289 strain, the genus Ceratobasidium (Basidiomycota; Agaricomycotina; Agaricomycetes River; Cantharellales Neck; Ceratobasidiaceae] showed the highest homology with the ITS sequence.
근연종의 ITS 서열과 계통수를 그려본 결과, 세라토바시디움(Ceratobasidium) 속 균주들과 단계통을 이루고 있는 것으로 나타났다(도 6 참조). 또한, LSU 서열을 이용한 상동성 검색에서도 세라토바시디움(Ceratobasidium) 속 균주들과 가장 높은 상동성을 보였으며, 이들과 단일계통을 이루는 것으로 나타났다(도 7 참조).The ITS sequence and phylogenetic tree of the relatives were shown to be in phase with the strains of Ceratobasidium genus (see FIG. 6). In addition, homology search using LSU sequence showed the highest homology with Ceratobasidium sp. Strains, and it showed a single lineage with them (see Fig. 7).
이러한 결과를 바탕으로 JS1289 균주는 세라토바시디움(Ceratobasidium) 속에 속하는 균주임을 확인할 수 있었다. 본 발명자들은 우수한 항진균 및 항염증 활성을 갖는 본 발명의 균주를 세라토바시디움 (Ceratobasidium) 속 JS1289로 명명하고, 국립농업과학원 농업유전자원정보센터에 기탁번호(KACC 83016BP)로 기탁하였다. Based on these results, it was confirmed that the JS1289 strain belongs to the genus Ceratobasidium . The present inventors named the strain of the present invention having excellent antifungal and antiinflammatory activity in the genus Ceratobasidium JS1289 and deposited it with the accession number (KACC 83016BP) of the National Institute of Agricultural Science and Technology, National Institute of Agricultural Science and Technology.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.
<110> National Institute of Biological Resources <120> Novel Strain of Ceratobasidium sp. JS1289 Having Anti-Fungal and Anti- inflammatory Activity, and Uses thereof <130> PN20170058AN <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 681 <212> DNA <213> Unknown <220> <223> Ceratobasidium sp. <400> 1 agtaaaagtc gtaacaaggt ttccgtaggt gaacctgcgg aaggatcatt atcgaatgaa 60 atcagagtcg gttgtcgctg gcctcttcac tgaggcatgt gcacgccttc tctattcatc 120 cacacacacc tgtgcacttg tgagacggat ccgaccctct cgggggaacg gtccgtctat 180 tatacataaa ctccaataat ataaatctga atgtaatttg atgtaacaca tctttaaact 240 aagtttcaac aacggatctc ttggctctcg catcgatgaa gaacgcagcg aaatgcgata 300 agtaatgtga attgcagaat tcagtgaatc atcgaatctt tgaacgcacc ttgcgctcct 360 tggtattcct cggagcatgc ctgtttgagt atcatgaaat cctcaaaata aatcttttgt 420 tcattcgatt gatttttatt ttggacttgg aggtctgcag attcacgtct gctcctctta 480 aatttattag ctggatctcc gtgaactcgg ttccactcgg cgtgataagt atcactcgct 540 gaggacactg taaaaaggtg gccggggtcg tggaagaacc gcttccaata gtccattgac 600 ttggacaata aattatttat gatctgatct caaatcaggt aggactaccc gctgaactta 660 agcatatcaa taagcggagg a 681 <210> 2 <211> 921 <212> DNA <213> Unknown <220> <223> Ceratobasidium sp. <400> 2 ctacccgctg aacttaagca tatcaataag cggaggaaaa gaaactaaca aggattcccc 60 tagtaacggc gagtgaagcg ggaagagctc aaatttaaaa tctggcggtc gcaccgtccg 120 agttgtagtc tagagaagca tcatctacgc tggaccatgt acaagtctct tggaacagag 180 cgtcatagag ggtgagaatc ccgtccttga catggactcc cagtgttctg tgttgtgctc 240 tcaacgagtc gagttgtttg ggaatgcagc tcaaaatggg tggtaaattc catctaaagc 300 taaatattgg cgagagaccg atagcgaaca agtaccgtga gggaaagatg aaaagcactt 360 tggagagaga gttaaacagt acgtgaaatt gttgaaatgg aaacgcttga agtcagtcgc 420 gttctctggg attcagcctt gcttttgctt ggtgcatttc ctagtctacg ggccagcatg 480 gatttcgacc gttggaaaag ggctggggga atgtggcacc ttcgggtgtg ttatagcccc 540 ctgtcgcatg catcggttgg gatcgaggac ctcagtgcac gcttcggttg tgctttgatg 600 ctggcgtaat ggctttaaac gacccgtctt gaaacacgga ccaaggagtc taacatgtct 660 gcgagtgttt gggtgaaaaa ctcggacgcg caatgaaagt gatagttggg aacctttcac 720 gaggggcacc gacgcccgga ccagaccttc tgtgacggat ccgaggtaga gcatatatgt 780 tgggacccga aagatggtga actatgcctg catagggtga agccagagga aactctggtg 840 gaggctcgta gcgattctga cgtgcaaatc gatcgtcaaa tgtgggtata ggggcgaaag 900 actaatcgaa ccatctagta c 921 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ITS1F primer <400> 3 cttggtcatt tagaggaagt aa 22 <210> 4 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> LR5 primer <400> 4 atcctgaggg aaacttc 17 <110> National Institute of Biological Resources <120> Novel Strain of Ceratobasidium sp. JS1289 Having Anti-Fungal and Anti-inflammatory Activity, and Uses thereof <130> PN20170058AN <160> 4 <170> KoPatentin 3.0 <210> 1 <211> 681 <212> DNA <213> Unknown <220> <223> Ceratobasidium sp. <400> 1 agtaaaagtc gtaacaaggt ttccgtaggt gaacctgcgg aaggatcatt atcgaatgaa 60 gcctgtcg cacacacacc tgtgcacttg tgagacggat ccgaccctct cgggggaacg gtccgtctat 180 tatacataaa ctccaataat ataaatctga atgtaatttg atgtaacaca tctttaaact 240 aagtttcaac aacggatctc ttggctctcg catcgatgaa gaacgcagcg aaatgcgata 300 agtaatgtga attgcagaat tcagtgaatc atcgaatctt tgaacgcacc ttgcgctcct 360 tggtattcct cggagcatgc ctgtttgagt atcatgaaat cctcaaaata aatcttttgt 420 tcattcgatt gatttttatt ttggacttgg aggtctgcag attcacgtct gctcctctta 480 aatttattag ctggatctcc gtgaactcgg ttccactcgg cgtgataagt atcactcgct 540 gaggacactg taaaaaggtg gccggggtcg tggaagaacc gcttccaata gtccattgac 600 ttggacaata aattatttat gatctgatct caaatcaggt aggactaccc gctgaactta 660 agcatatcaa taagcggagg a 681 <210> 2 <211> 921 <212> DNA <213> Unknown <220> <223> Ceratobasidium sp. <400> 2 ctacccgctg aacttaagca tatcaataag cggaggaaaa gaaactaaca aggattcccc 60 tagtaacggc gagtgaagcg ggaagagctc aaatttaaaa tctggcggtc gcaccgtccg 120 agttgtagtc tagagaagca tcatctacgc tggaccatgt acaagtctct tggaacagag 180 cgtcatagag ggtgagaatc ccgtccttga catggactcc cagtgttctg tgttgtgctc 240 tcaacgagtc gagttgtttg ggaatgcagc tcaaaatggg tggtaaattc catctaaagc 300 taaatattgg cgagagaccg atagcgaaca agtaccgtga gggaaagatg aaaagcactt 360 tggagagaga gttaaacagt acgtgaaatt gttgaaatgg aaacgcttga agtcagtcgc 420 gttctctggg attcagcctt gcttttgctt ggtgcatttc ctagtctacg ggccagcatg 480 gatttcgacc gttggaaaag ggctggggga atgtggcacc ttcgggtgtg ttatagcccc 540 ctgtcgcatg catcggttgg gatcgaggac ctcagtgcac gcttcggttg tgctttgatg 600 ctggcgtaat ggctttaaac gacccgtctt gaaacacgga ccaaggagtc taacatgtct 660 gcgagtgttt gggtgaaaaa ctcggacgcg caatgaaagt gatagttggg aacctttcac 720 gaggggcacc gacgcccgga ccagaccttc tgtgacggat ccgaggtaga gcatatatgt 780 tgggacccga aagatggtga actatgcctg catagggtga agccagagga aactctggtg 840 gaggctcgta gcgattctga cgtgcaaatc gatcgtcaaa tgtgggtata ggggcgaaag 900 actaatcgaa ccatctagta c 921 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ITS1F primer <400> 3 cttggtcatt tagaggaagt aa 22 <210> 4 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> LR5 primer <400> 4 atcctgaggg aaacttc 17
Claims (9)
산화질소(Nitric oxide, NO) 매개 염증성 질환에 대하여 산화질소(Nitric oxide, NO)의 생성 억제를 통한 항염증 활성을 갖는,
세라토바시디움(Ceratobasidium) 속 균주 JS1289(수탁번호: KACC 83016BP).Has antifungal activity against Candida albicans ,
It has anti-inflammatory activity through inhibition of nitric oxide (NO) production against nitric oxide (NO) mediated inflammatory diseases.
Ceratobasidium genus strain JS1289 (accession number: KACC 83016BP).
상기 균주는 서열번호 1의 ITS 유전자 서열 또는 서열번호 2의 LSU(Large subunit of ribosomal DNA) 유전자 서열을 갖는 것을 특징으로 하는 세라토바시디움(Ceratobasidium) 속 균주 JS1289(수탁번호: KACC 83016BP).The method according to claim 1,
Wherein said strain has an ITS gene sequence of SEQ ID NO: 1 or a large subunit of ribosomal DNA (LSU) gene sequence of SEQ ID NO: 2. Ceratobasidium genus strain JS1289 (accession number: KACC 83016BP).
칸디다 알비칸스(Candida albicans)에 대한 항진균 활성을 갖으며,
산화질소(Nitric oxide, NO) 매개 염증성 질환에 대하여 산화질소(Nitric oxide, NO)의 생성 억제를 통한 항염증 활성을 갖는,
항진균 및 항염증 조성물.A method for producing a microorganism which comprises the strain of claim 1 or a culture thereof as an active ingredient,
It has antifungal activity against Candida albicans ,
It has anti-inflammatory activity through inhibition of nitric oxide (NO) production against nitric oxide (NO) mediated inflammatory diseases.
Antifungal and antiinflammatory composition.
인간을 제외한 동물의 칸디다 알비칸스(Candida albicans) 진균 감염 질환을 치료하는 방법.10. A method for treating Candida albicans , comprising administering to said subject an antifungal and anti-inflammatory composition according to claim 3 for the treatment of Candida albicans .
A method for treating Candida albicans fungal infectious disease in an animal other than human.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020170176935A KR101983575B1 (en) | 2017-12-21 | 2017-12-21 | Novel Strain of Ceratobasidium sp. JS1289 Having Anti-Fungal and Anti- inflammatory Activity, and Uses thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020170176935A KR101983575B1 (en) | 2017-12-21 | 2017-12-21 | Novel Strain of Ceratobasidium sp. JS1289 Having Anti-Fungal and Anti- inflammatory Activity, and Uses thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
KR101983575B1 true KR101983575B1 (en) | 2019-06-03 |
Family
ID=66848889
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020170176935A KR101983575B1 (en) | 2017-12-21 | 2017-12-21 | Novel Strain of Ceratobasidium sp. JS1289 Having Anti-Fungal and Anti- inflammatory Activity, and Uses thereof |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101983575B1 (en) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20010104464A (en) * | 2000-04-29 | 2001-11-26 | 박한오 | Orchid Mycorrhizal Fungi Useful in Orchid Cultivation |
KR20120050490A (en) * | 2009-08-28 | 2012-05-18 | 바이오랩 세너스 팔마씨우티카 엘티디에이. | Benzyl aralkyl ether compounds, method for preparing same, intermediate compounds, use of said compounds, method for treatment and/or prevention, pharmaceutical composition and medicament containing same |
US20160262335A1 (en) * | 2013-03-06 | 2016-09-15 | Grasslanz Technology Limited | Improved fungal endophytes |
-
2017
- 2017-12-21 KR KR1020170176935A patent/KR101983575B1/en active IP Right Grant
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20010104464A (en) * | 2000-04-29 | 2001-11-26 | 박한오 | Orchid Mycorrhizal Fungi Useful in Orchid Cultivation |
KR20120050490A (en) * | 2009-08-28 | 2012-05-18 | 바이오랩 세너스 팔마씨우티카 엘티디에이. | Benzyl aralkyl ether compounds, method for preparing same, intermediate compounds, use of said compounds, method for treatment and/or prevention, pharmaceutical composition and medicament containing same |
US20160262335A1 (en) * | 2013-03-06 | 2016-09-15 | Grasslanz Technology Limited | Improved fungal endophytes |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2019225785A1 (en) | Antimicrobial and antifungal composition comprising eugenol and gallic acid as active ingredients | |
IT202000003233A1 (en) | BACTERIAL STRAIN AND ITS MEDICAL USES | |
KR20160097539A (en) | Composition comprising Lactobacillus sakei derived from Lonicera japonica Thunb. or cultured products thereof as a active ingredient | |
KR102059392B1 (en) | Antimicrobial and Antifungal Composition Containing Clove, Hibiscus, and Coconut Extract Complex as Active Ingredient | |
KR102422611B1 (en) | Antimicrobial composition comprising a novel Bacillus Velezensis strains or compounds isolated therefrom | |
KR101394550B1 (en) | Anti-bacterial or Anti-inflammatory Composition Comprising Extracts from Flower of Rosa hybrida as Active Ingredient | |
KR102068470B1 (en) | Novel Strain of Arthrinium sp. JS0567 Having Anti-Fungal and Anti- inflammatory Activity, and Uses thereof | |
KR101392808B1 (en) | Antibacterial compositions containing plant extracts or fractions | |
KR101983575B1 (en) | Novel Strain of Ceratobasidium sp. JS1289 Having Anti-Fungal and Anti- inflammatory Activity, and Uses thereof | |
KR20180116735A (en) | A novel marine-derived bacterium, and cosmetic compositions using the same | |
KR101433823B1 (en) | External Composition for Skin Using an Extract or a Fraction of Padina arborescens | |
KR102032116B1 (en) | Method for preparing tea fermented materials and cosmetic composition comprising the same | |
KR102610934B1 (en) | Composition for hair or scalp comprising lysate of Lactobacillus sakei | |
KR102408301B1 (en) | Novel Strain of Streptomyces sp. SBC-4 Having Anti-bacterial Activity, and Uses thereof | |
KR102273234B1 (en) | Kocuria varians strain and skin condition improving uses of thereof | |
KR20190037436A (en) | Cosmetic composition including fermented water lily extract and method for manufacturing the same | |
KR101268170B1 (en) | Novel cyclic peptide-based compound having anitmicrobial activity and uses thereof | |
KR101788585B1 (en) | Novel Strain of Fusarium solani JS-169 having anti-bacterial and anti-fungal activity, and uses thereof | |
KR101928211B1 (en) | Composition having inhibitory effect on microorganism and virus including enterovirus 71 causing hand-foot-mouth symptom | |
KR102461715B1 (en) | Novel Strain of Penicillium bissettii with Anti-bacterial and Anti-fungal Activity and Uses thereof | |
KR102558085B1 (en) | Bifidobacterium animalis subsp. lactis strain and its use for improving skin conditions | |
KR20180059296A (en) | Composition Containing Terminalia Chebula Extract and Artemisia Extract for Controlling Skin Bacterial Flora Growth, or Enhancing Skin Immunity | |
KR101392810B1 (en) | Antibacterial compositions containing plant extracts or fractions | |
KR20170027594A (en) | A composition comprising an extract of Dendranthema Zawadskii for preventing and treating inflammatory disease | |
KR20120092763A (en) | Anti-bacterial composition comprising extract from leaf of ilex rotunda or phenylpropanoid compound as active ingredient |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |