KR20180059296A - Composition Containing Terminalia Chebula Extract and Artemisia Extract for Controlling Skin Bacterial Flora Growth, or Enhancing Skin Immunity - Google Patents

Abstract

The present invention relates to a composition for regulating growth or reinforcing skin immunity of skin bacteria flora containing Terminalia chebula extract and Artemisia extract as active ingredients. More specifically, growth of skin beneficial bacteria is improved by selective antibacterial activities for skin bacteria flora, and growth of skin harmful bacteria is inhibited. An expression amount of β-defensin of skin cells is increased. Thus, skin immunity is reinforced. When the composition according to the present invention is used, growth of lactic acid bacteria beneficial to skin according to selective antibacterial activities is improved, and growth of staphylococcus, Propionibacterium acnes, and Candida albicans is inhibited. Thus, a growth balance of skin bacteria flora is made, and expression of β-defensin which is a skin immunomaterial is improved. Thus, skin immunity is reinforced.

Description

[0001] The present invention relates to a composition for controlling the growth of a skin flora or a skin immunity containing a Gadia extract and a lysolecule extract,

The present invention relates to a composition for regulating the growth of a skin flour or a composition for enhancing skin immunity comprising an extract of Ghazam and a leaf extract as an active ingredient. More specifically, the present invention relates to a composition for increasing the growth of skin benefit bacteria by selective antibacterial activity against skin flour, The present invention relates to a composition containing as an active ingredient a Gadja extract and a lobster extract having an effect of suppressing the growth of harmful microorganisms and having an effect of enhancing skin immunity by increasing the expression amount of? -Diphenesin in skin cells.

Skin is a body part that is directly exposed to the external environment. It acts as a protective film for protecting the body from external stimuli. Many microorganisms live in the mucous membrane and skin tissue of a human, and this microorganism group is called a skin flour.

Skin bacterial guns are divided into skin resident and skin emery transient, whereas mantle bacteria are found primarily in the form around the epidermis and / or hair follicles, whereas emergency emery bacteria are found in infectious or contaminated environments It can be attached to the skin for a certain period of time, but it is killed by the self-correcting action of the skin in a person having normal skin immunity.

Beneficial bacteria among skin fungi maintain balance with harmful bacteria (for example, skin bacterial distribution, bacterial growth balance, etc.) among skin emergency bacteria and maintain skin immunity. However, when the immunity is reduced due to external stimuli, stress, hormonal changes, etc., the balance between the beneficial bacteria and the harmful bacteria is broken, and when the proliferation of the harmful bacteria and the penetration of the harmful bacteria are increased, the primary inflammatory reaction is generated. By the toxic metabolites Secondary inflammatory reactions such as skin itching, inflammation deepening reaction and skin immunity lowering reaction are induced. These inflammatory reactions and accompanying skin diseases are not only cosmetic problems, but also substances caused by the inflammation reaction cause pigmentation of the skin, promote the collapse of the elastic fibers of the skin, and increase the wrinkles of the skin .

However, when an antibiotic is used for the purpose of treating skin diseases as described above, it affects the entire skin flour culture, resulting in the death of beneficial bacteria as well as harmful bacteria, and even when the appearance of resistant bacteria results in a collapse of the balance of the skin bacteria do. Accordingly, there is an increasing need for a composition having selective antimicrobial activity that inhibits harmful bacteria and protects beneficial bacteria.

Examples of skin benefit bacteria include Lactobacillus spp . , Staphylococus epidermis , Micrococcus sp. leteus ).

Lactic acid bacteria are gram-positive bacteria, which ferment a saccharide to obtain energy and produce a large amount of lactic acid. It is known that the yeast germs live in the skin and promote the expression of skin immunity, thereby helping to strengthen skin immunity. In a normal environment, many lactic acid bacteria live in the vagina of women, and the inside of the vagina becomes weak acid to inhibit the growth of pathogens and fungi. However, when the balance inside the vagina is broken due to immune degradation and hormone change, The protection of lactic acid bacteria is especially important because it increases the growth of harmful microorganisms such as pathogens and fungi.

The skin harmful bacteria is Staph (Staphylococcus aureus), Bacillus acne (Propionibacterium acnes), Candida albicans (Candida albicans , and Pseudomonas epidermis .

Staphylococcus is a Gram-positive bacterium with a diameter of less than 1 μm. It causes pyritic inflammation in the skin and secretes ceramidase to decompose the ceramide, which is a lipid of the skin barrier, to weaken the skin barrier and increase the permeability of the stratum corneum. Facilitates penetration of contaminants and promotes inflammation of the skin. In addition, staphylococci induce degranulation of mast cells to cause skin itching and reduce skin immunity.

Acne bacterium is an anaerobic bacterium that reacts with keratinocytes to generate acne, and decomposes triglyceride, which is a major component of sebum, to produce free fatty acids, which cause skin irritation and worsen acne.

Candida albicans is a gram-positive fungus, a kind of skin fungus. It is present in the oral cavity, vagina, intestine and digestive tract of a healthy person. However, when the immunity is decreased, the proliferation is increased to cause watery inflammation and inflammation in the digestive tract and oral cavity. Typically, Causes septic salt. Candida albicans is a common disease in which about 75% of women suffer from candida vaginitis in more than one vagina and vulva, and 45% of the female population have recurrences more than twice a year.

"Let" Medicinal Plants used in the present invention, let the combretaceae (Terminalia chebula Retzins ) or villi ( Terminalia chebula Retzins . tomentella kurt. ) Of ripe fruit. The ingredients contained in Gaza are phenol compounds such as Chebulagic acid and Chebulinic acid, and it is reported that there are differences in the kinds and contents of the ingredients contained in Gaza depending on the species collected and cultivation methods. There is a bar. On the other hand, the extract of Ghazama is known to have excellent effects of whitening and antioxidation (Patent Documents 1 and 2).

As used herein, " ladybug " refers to the Artemisia argyi Lev . et Vant. ), Artemisia princeps Pampanini ) or wormwood ( Artemisia montana Pampani ). It has been reported that there are terpene compounds such as Artemisinin and Artemisinic acid, which are contained in the leaves, and that there are differences in components contained in the leaves depending on the collection species and cultivation methods . The anti-inflammatory activity of the leaf extract and the leaf ingredient was already reported, and Artemisia annua , and Asteraceae), Professor Tu Yuyu of China, who developed a malaria treatment using artemisinin, was awarded the Nobel Prize in Physiology in 2015. On the other hand, it has been known that the extract of lobules has excellent effects such as inhibition of blood coagulation and inhibition of osteoporosis induction (Patent Documents 3 and 4).

Under these technical backgrounds, the present inventors have made intensive efforts to develop a composition for controlling the growth and / or skin immunity of skin flour, and as a result, a composition containing an active ingredient of a mixture of an extract of Ghazam and a leaf extract has been found to increase the growth of skin- It has been confirmed that the effect of enhancing skin immunity is suppressed while inhibiting the growth of harmful bacteria in the skin, and the present invention has been completed.

Korean Patent Publication No. 10-2004-0035364 Korean Patent Publication No. 10-2004-0051784 Korean Patent No. 10-1083873 Korean Patent No. 10-0727887

It is an object of the present invention to provide a composition for enhancing skin immunity while controlling the balance of skin flour by accelerating the growth of beneficial bacteria and inhibiting the growth of harmful bacteria.

In order to accomplish the above object, the present invention provides a composition for controlling the growth of a skin flour culture, which comprises a mixture of an extract of Ghazia and a leaf extract as an active ingredient.

The present invention also provides a skin immunity-enhancing composition comprising as an active ingredient, a mixture of Gadja extract and a leaf extract.

The use of a composition containing an extract of Ghazana and a leaf extract according to the present invention as an active ingredient increases the growth of lactic acid bacteria beneficial to the skin due to the selective antimicrobial activity and the growth of staphylococcus, acne bacterium and Candida albicans, Inhibiting the growth of skin bacterial flies, while increasing the expression of the skin immune substance, β-diphencin, enhances skin immunity.

FIG. 1 shows the effect of a mixture composed of Gadja extract and a leaf extract on the growth of Lactobacillus plantarum.
FIG. 2 shows the effect of a mixture composed of Gadja extract and a leaf extract on the secretion of? -Diphenesin in human keratinocytes.
Fig. 3 shows the antimicrobial activity of the supernatant collected from cultures of human keratinocytes treated with a mixture of Gadjia extract and Laurea extract.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

In one embodiment of the present invention, in order to confirm the growth potency of the beneficial bacteria treated with the mixture consisting of the GAZA extract and the LAB extract, a mixture composed of the GAZA extract and the LAB extract was added to the Lactobacillus plantarum and Lactococcus lactis, As a result, it was confirmed that the growth of Lactobacillus plantarum and Lactococcus lactis was increased (see Test Example 1).

In another embodiment of the present invention, in order to confirm the growth efficacy of the harmful microorganisms treated with the mixture consisting of the Gadja extract and the ladybug extract, staphylococcus strains, Propionibacterium acnes and Candida albicans, which are harmful bacteria, As a result of treating the thus-prepared mixture, it was confirmed that the growth of Staphylococcus, Propionibacterium acnes and Candida albicans was inhibited (see Test Example 2).

In another embodiment of the present invention, in order to confirm the skin immunity-enhancing effect of the mixture consisting of the Gadja extract and the lysolecule extract, the human keratinocyte was treated with a mixture of the Gadia extract and the Leaf extract, -Diphenin was promoted and the supernatant of human keratinocyte culture treated with a mixture of Gadja extract and lobster extract was treated with Staphylococcus aureus to inhibit the growth of Staphylococcus aureus 3).

Accordingly, in one aspect, the present invention relates to a composition for controlling the growth of a skin flour culture, which comprises a mixture of GAZa extract and a leaf extract as an active ingredient.

In the present specification, skin bacterial gun means all strains existing in human skin and includes all bacteria which are beneficial or harmful to skin immunity.

In another aspect, the present invention relates to a composition for enhancing skin immunity, which contains, as an active ingredient, a mixture of Gadja extract and a leaf extract.

In the present invention, the mixture consisting of the ghatti extract and the lysolecule extract may be characterized by enhancing or maintaining skin immunity by balancing the growth (proliferation) of skin benefit bacteria and skin harmful bacteria.

In the present invention, the skin benefit bacteria means a bacterium having characteristics such as skin immunity enhancement, skin irritation mitigation, and inhibition (suppression) of proliferation of skin harmful bacteria, and skin harmful bacteria may cause skin immunity degradation, skin inflammation induction, skin pigmentation, A reduction in elasticity, skin toxicity, and inhibition (suppression) of proliferation of skin benefit bacteria.

In the present invention, the mixture consisting of the Gadamer extract and the lysolecule extract may be characterized by increasing the growth of skin benefit bacteria and reducing the growth of skin harmful bacteria.

The above-mentioned skin beneficial microorganism is selected from the group consisting of Lactobacillus spp . , Staphylococus epidermis and Micrococcus sp. luteus , but is not limited thereto.

The skin harmful bacteria is Staph (Staphylococcus aureus), Bacillus acne (Propionibacterium acnes), Candida albicans (Candida albicans) and Pseudomonas epi more misses (Pseudomonas epidermidis), but can be at least one selected from uniform, and the like.

In the present invention, the extract composed of the Gadamer extract and the lysolecule extract may be characterized by increasing the expression of [beta] -diphenesin in skin cells, and the effect of enhancing skin immunity by increasing the expression amount of [ Lt; / RTI >

In the present invention, the ghatti extract and the lyophilized extract are mixed at a ratio of 1 to 10: 1 to 10, preferably 1: 5: 1 to 5, more preferably 1: 2 on a weight basis.

In the present invention, the gad extract and the ladybug extract may be contained in an amount of 0.01 to 10.0% by weight based on the total weight of the composition. If the content of the extract is less than 0.01% by weight, it hardly affects the growth of skin microorganisms. If the content of the extract is more than 10.0% by weight, it may affect the formulation.

In the present invention, the above-mentioned Gadia extract or Liana extract may be obtained by extracting and isolating from a natural product by a method commonly used for extracting an active ingredient from a plant. That is, the GAZA extract or the ladybug extract may be obtained by mixing two plants (herbal medicines), namely, GAZA and LEAF, and then extracting them, or preparing the respective plant extracts and then mixing them. Preferably, The plants are mixed and extracted.

The ghatti extract and the ladybug extract may be prepared using an appropriate extraction solvent. Any solvent acceptable in the art may be used as the extraction solvent, and water or an organic solvent may be used. Examples of the solvent include alcohols having 1 to 4 carbon atoms, acetone, ether, and the like, including purified water, methanol, ethanol, propanol, isopropanol, butanol, Various solvents such as benzene, chloroform, ethyl acetate, methylene chloride, hexane, cyclohexane and 1,3-butylene glycol are used alone But it is not limited to this and is preferably extracted with purified water, 100% ethanol or 80% methanol (volume ratio, 80% methanol + 20% purified water).

The ghatti extract and the lyophilized extract may be prepared by any one of methods such as hot water extraction, cold extraction, reflux cooling, solvent extraction (polar solvent / nonpolar solvent extraction), steam distillation, ultrasonic extraction, But the present invention is not limited thereto. Various known extraction methods can be used, which are prepared from an extract that maintains antibiotic efficacy against skin microorganisms and skin immunity-enhancing effect.

In addition, the Gadamer extract and the ladybug extract may be further purified by a conventional fractionation process and / or purification method. For example, the above-mentioned extract can be prepared into a powdery state by an additional process such as vacuum distillation, freeze-drying or spray-drying, or a primary extract extracted by hot water extraction or solvent extraction. In addition, the primary extract can be further fractionated using a variety of chromatographies, such as silica gel column chromatography, thin layer chromatography, high performance liquid chromatography, .

That is, the above Gadja extract and the ladybug extract are concepts including all the extracts, fractions and tablets obtained in each step of extraction, fractionation or purification, their diluted solutions, concentrates or dried products.

The composition according to the present invention is generally a composition for external application for skin, which may be a cosmetic composition or a pharmaceutical composition, but is preferably a cosmetic composition.

Examples of the cosmetic composition include basic cosmetics, makeup cosmetics, hair cosmetics, and body cosmetics, and the formulations thereof are not particularly limited and may be appropriately selected according to the purpose. For example, the cosmetic composition may be formulated into a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing oil, powder foundation, emulsion foundation, wax foundation and spray , But is not limited thereto. More specifically, the present invention relates to a cosmetic composition, which comprises at least one of a softening agent, a nutritional lotion, a lotion, a body lotion, a nutritional cream, a massage cream, a moisturizing cream, a hand cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, Shampoo, rinse, body cleanser, toothpaste, ladies' cleanser or oral cleanser, such as cosmetics such as ointments, ointments, w / o type, Hair tonic, gel or mousse, or a hair cosmetic composition such as a hair dye or hair dye.

When the composition of the present invention is formulated into a cosmetic formulation, the composition of the present invention may contain all the ingredients commonly used in cosmetics in addition to the above-mentioned extracts. Examples of the composition include water-soluble vitamins, oil-soluble vitamins, polymer peptides, Lipids, and seaweed extracts.

The polymeric peptide may be selected from any of those that can be compounded in the cosmetic, and preferably collagen, hydrolyzed collagen, gelatin, elastin, hydrolyzed elastin, keratin and the like can be selected. The polymeric peptide can be obtained by a conventional method such as purification from a culture broth of a microorganism, an enzymatic method, or a chemical synthesis method, or it can be purified from natural products such as ducks such as pigs and cows and silk fiber of silkworms.

The polymeric polysaccharide may be selected from any of those that can be compounded in the cosmetic, and preferably hydroxyethyl cellulose, xanthan gum, sodium hyaluronate, chondroitin sulfate or a salt thereof (sodium salt, etc.) may be selected. For example, chondroitin sulfate or a salt thereof can be usually purified from mammals or fish.

Sphingo lipids may be selected from any of those that can be incorporated in cosmetics, but ceramides, phytosphingosine, sphingoglycolipids and the like may be preferably selected. Sphingoid lipids can be purified from ordinary mammals, fish, shellfish, yeast or plants by conventional methods or can be obtained by chemical synthesis.

The cosmetic of the present invention may contain, in addition to the above-mentioned essential ingredients, other ingredients usually added to cosmetics, if necessary. In this case, the compounding ingredient may be a preservative, a moisturizer, an emollient, a surfactant, an organic or inorganic pigment, an organic powder, an ultraviolet absorber, an antiseptic, a bactericide, an antioxidant, a plant extract, a pH adjuster, , A cold agent, an antiperspirant agent, purified water, etc. may be used.

Any of the above components may be blended within the range not impairing the object and effect of the present invention, but it is preferably 0.001 to 50% by weight based on the total weight, 0.01 to 5% by weight, more preferably 0.01 to 3% by weight.

The ingredients contained in the composition formulated in the cosmetic formulations of the present invention may contain, as an active ingredient, the ingredients commonly used in cosmetics in addition to the above extracts, for example, stabilizers, solubilizers, vitamins, And the like.

The pharmaceutical composition containing the Ghassa extract and the lysolecule extract of the present invention can be used as a preservative, a stabilizer, a wetting agent or an emulsifying accelerator, a pharmaceutical adjuvant such as a salt and / or a buffer for controlling osmotic pressure and other therapeutically useful substances (carrier, excipient, Diluent, etc.), and may be formulated in the form of various oral administration agents or parenteral administration (coating agents) according to a conventional method.

The term " carrier " is defined as a compound that facilitates the addition of a compound into a cell or tissue. For example, dimethylsulfoxide (DMSO) is a commonly used carrier that facilitates the introduction of many organic compounds into cells or tissues of an organism.

The term " excipient " refers to a substance which, when used in tablets or pills, is added to the medicine to make it easier to eat or to have a certain color and shape when the amount of the drug is low. Lactose or starch is mainly used do.

The term " diluent " is defined as a compound that not only stabilizes the biologically active form of the compound of interest, but also dilutes in water to which the compound is dissolved. Salts dissolved in buffer solutions are used as diluents in the art. A commonly used buffer solution is phosphate buffered saline, since it mimics the salt state of the human solution. Since buffer salts can control the pH of the solution at low concentrations, buffer diluents rarely modify the biological activity of the compounds.

As used herein, the composition containing the Gadia extract and the lysolecule extract is a medicinal composition which is mixed with other active ingredients, either alone or in combination with an appropriate carrier or excipient, .

Examples of carriers, excipients and diluents that can be contained in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , Methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

Examples of the oral administration agent include tablets, pills, hard and soft capsules, liquids, suspensions, emulsions, syrups, powders, powders, granules, granules and pellets, , Diluents (such as lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and glycine), lubricants (such as silica, talc, stearic acid and magnesium or calcium salts thereof and polyethylene glycols) . Tablets may also contain binders such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and polyvinylpyrrolidine, optionally mixed with starch, agar, alginic acid or its sodium salt Such as disintegrants, absorbents, coloring agents, flavoring agents, and sweetening agents. The tablets may be prepared by conventional mixing, granulating or coating methods.

The parenteral administration (coating) may be, for example, an injection, an ointment, an ointment, a lotion, a gel, a cream, a spray, a suspending agent, an emulsion, a suppository, But is not limited thereto.

The pharmaceutical composition according to an embodiment of the present invention may be administered (applied) by parenteral, topical, transdermal, subcutaneous, or the like. The pharmaceutical composition according to one embodiment of the present invention may be administered topically to the scalp, for example.

In addition, the pharmaceutically acceptable dose, that is, the dosage (amount) of the active ingredient may be appropriately determined depending on the age, sex, and weight of the subject to be treated, the specific disease or pathological condition to be treated, the severity of the disease or pathological condition, ) And the judgment of the prescriber. Determination of the dosage based on these factors is within the level of ordinary skill in the art. The dosage is to be administered (applied) in an amount of, for example, 0.01 to 5000 mg, preferably 0.1 to 2000 mg, more preferably 0.5 to 500 mg, and most preferably 1 to 100 mg per kg of body weight per day (Application) in a single dose or in several times, but the dose is not limited to the scope of the present invention by any means.

The ghatti extract and the lysolecule extract of the present invention are natural substances, and thus they can be continuously used in large quantities as pharmaceuticals because they have no toxicity.

Pharmaceutical compositions suitable for use in the present invention include compositions in which the active ingredients, including the Gadja extract and the lysolecule extract, are contained in an amount effective to achieve its intended purpose. More specifically, a therapeutically effective amount refers to an amount of a compound that is effective to prolong the survival of an object to be treated or to prevent, alleviate, or alleviate symptoms of the disease. The determination of a therapeutically effective amount is well within the ability of those skilled in the art, particularly in light of the detailed disclosure provided herein.

A therapeutically effective amount of the Gadja extract and the lysolecule extract used in the methods of the present invention and the composition (compounds) containing it as an active ingredient can be measured early from the cell culture analysis. For example, a dose can be calculated in an animal model to obtain a circulating concentration range that includes IC ₅₀ (half maximal inhibitory concentration) or EC ₅₀ (half maximal effective concentration) determined in cell culture. Such information can be used to more accurately determine useful doses in humans.

The toxicity and therapeutic efficacy of the Gadja extract and the lysolecule extract or the composition (compounds) containing it as the active ingredient as described herein can be determined, for example, by measuring the LD ₅₀ (lethal dose to 50% of the population), ED ₅₀ (Dose with a therapeutic effect on 50% of the population), IC ₅₀ (dose with therapeutic inhibition effect for 50% of the population), can be estimated by cell culture or by surface constraint procedures in laboratory animals . The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio between LD ₅₀ and ED ₅₀ (or IC ₅₀ ). Compounds with a high therapeutic index are preferred. Data from these cell culture assays can be used to estimate the range of doses used in humans. The dosage or amount of such compounds is preferably within the range of circulating concentrations, including the ED ₅₀ (or IC ₅₀ ), with no or little toxicity.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

[ Example  1] Let's go and Lady's  Mixture of Heat number  Preparation of extract

200 g of GAZA and 400 g of leaf lye was added with purified water in an amount of 10 to 20 times the mass of the mixture, and then boiled at 80 to 110 ° C for 10 to 15 hours using a reflux apparatus. The resulting hot water extract was applied to a rotary vacuum concentrator Concentrated and lyophilized to give 81 g of the lyophilized extract.

The extracts used in Test Examples 1 to 3 below were prepared by adding purified water to the lyophilized extract and containing the extract in a concentration of 1% by weight based on the total weight of the composition.

[ Example  2] Let's go and Lady's  Preparation of ethanol extract of mixture

100 g of ethanol was added at 10 to 20 times the mass of the mixture to a mixture of 200 g of GAZA and 200 g of leaf lye and then boiled at 80 to 110 DEG C for 10 to 15 hours using a reflux apparatus to obtain an ethanol extract Concentrated by a concentrator, and lyophilized to obtain 75 g of a lyophilized extract.

The extracts used in Test Examples 1 to 3 described below were prepared by adding the ethanol extract to the lyophilized extract in a solvent mixture of purified water and DMSO (dimethyl sulfoxide) at a volume ratio of 99: 1, Based on the total weight of the composition. Here, since the ethanol extract was not easy to dissolve, the extract was dissolved using a mixed solvent of purified water and DMSO instead of purified water.

[ Example  3] Let's go and Lady's  Preparation of methanol extract of mixture

(V / v) methanol mixed solvent at 10 to 20 times the mass of the mixture and then boiled at 80 to 110 ° C for 10 to 15 hours using a reflux condenser, The obtained methanol extract was concentrated using a rotary vacuum concentrator and lyophilized to obtain 68 g of a lyophilized extract.

The extracts used in the following Test Examples 1 to 3 were the above-mentioned methanol extract-containing compositions. A solvent in which purified water and DMSO were mixed at a ratio of 99: 1 by volume was added to the lyophilized extract, 1% by weight. Here, the methanol extract was not easy to dissolve and the extract was dissolved using a mixed solvent of purified water and DMSO instead of purified water.

[ Comparative Example  One] Let's go Heat number  Preparation of extract

The purified water was added to 400 g of ghastatin 10 to 20 times its mass and then boiled at 80 to 110 ° C for 10 to 15 hours using a reflux apparatus. The resulting hot water extract was concentrated by a rotary vacuum concentrator, lyophilized Lt; RTI ID = 0.0 > 105g < / RTI >

The extracts used in Test Examples 1 to 3 below were prepared by adding purified water to the lyophilized extract and containing the extract in a concentration of 1% by weight based on the total weight of the composition.

[ Comparative Example  2] Let's go  Preparation of ethanol extract

100 g of ethanol was added to 400 g of ghazu at a mass ratio of 10 to 20 times, and the resulting ethanol extract was boiled at 80 to 110 ° C for 10 to 15 hours using a reflux condenser. The ethanol extract was concentrated using a rotary vacuum concentrator and lyophilized 118 g of the lyophilized extract was obtained.

The extracts used in the following Test Examples 1 to 3 were the above-mentioned ethanol extract-containing compositions. The lyophilized extract was added with a solvent mixture of purified water and DMSO in a volume ratio of 99: 1, 1% by weight.

[ Comparative Example  3] Let's go  Preparation of methanol extract

The methanol extract obtained by adding 80% (v / v) methanol mixed solvent at 10 to 20 times its mass to 400 g of ghazu and boiling at 80 to 110 ° C for 10 to 15 hours using a reflux apparatus was added to a rotary vacuum concentrator ≪ / RTI > and lyophilized to give 98 g of the lyophilized extract.

The extracts used in the following Test Examples 1 to 3 were the above-mentioned methanol extract-containing compositions. A solvent in which purified water and DMSO were mixed at a volume ratio of 99: 1 was added to the above-mentioned dried extract, 1% by weight.

[ Comparative Example  4] Lady's Heat number  Preparation of extract

The purified water was added to 400 g of leaves at 10 to 20 times its mass, and then boiled at 80 to 110 ° C for 10 to 15 hours using a reflux apparatus. The resulting hot water extract was concentrated by a rotary vacuum concentrator, freeze-dried 29 g of the extracted extract was obtained.

The extracts used in Test Examples 1 to 3 below were prepared by adding purified water to the lyophilized extract and containing the extract in a concentration of 1% by weight based on the total weight of the composition.

[ Comparative Example  5] Lady's  Preparation of ethanol extract

100 g of ethanol was added to 400 g of leaves at 10 to 20 times its mass, and the ethanol extract obtained by boiling at 80 to 110 ° C for 10 to 15 hours using a reflux condenser was concentrated by a rotary vacuum concentrator and lyophilized 21 g of the lyophilized extract was obtained.

The extracts used in the following Test Examples 1 to 3 were the above-mentioned ethanol extract-containing compositions. The lyophilized extract was added with a solvent mixture of purified water and DMSO in a volume ratio of 99: 1, 1% by weight.

[ Comparative Example  6] Lady's  Preparation of methanol extract

The methanol extract obtained by adding 80% (v / v) methanol mixed solvent at 10 to 20 times its mass to 400 g of leaves and boiling at 80 to 110 ° C for 10 to 15 hours by using a reflux condenser, ≪ / RTI > and lyophilized to give 25 g of the lyophilized extract.

The extracts used in the following Test Examples 1 to 3 were the above-mentioned methanol extract-containing compositions. A solvent in which purified water and DMSO were mixed at a volume ratio of 99: 1 was added to the above-mentioned dried extract, 1% by weight.

[ Test Example  1] Gaza extract and Lady  Skin of mixture composed of extract Useful  Evaluation of growth promoting efficacy

(1) Let processing the mixture consisting of the extract and extract aeyeop Lactobacillus Increase in growth platforms LAN tarum

As an example of beneficial bacteria, a disk diffusion method was used to measure the growth effect of lactobacillus plantarum, a lactic acid bacterium. Briefly, MRS agar cultured with Lactobacillus plantarum (ATCC 8014) at a concentration of 10 ⁶ CFU / mL was dispensed into a petri dish, and then cooled to 25 ° C to be hardened. Then, the sterilized 8 mm Filter paper disks were placed on the dish surface at regular intervals and 40 μL of each of the samples of Examples 1 to 3 was injected into the disk to be absorbed and cultured in an incubator at 30 ° C. for 24 hours, Whether or not a clear zone was formed around the substrate and the diameter of the clear zone (unit: mm) were confirmed. Here, methylparaben, a positive control, was injected at a dose of 5.0 mg / 40 μL per disc.

5.0mg / 40μl / disc 2.5 mg / 40 μl / disc 1.25 mg / 40 μl / disc Methyl paraben
(5.0 mg / 40 mu l / disk) 14.6 (Figure 1A) Example 1 - - - Example 2 - (Figure 1C) - (Drawing 1 D) - (Figure 1E) Example 3 - - -

As a result, it was confirmed that the growth of Lactobacillus plantarum was increased in all of the extracts of Examples 1, 2 and 3. As shown in FIG. 1 and Table 1, a clear zone was formed around the disk into which methylparaben was injected, A clear zone was not formed around the disk into which the extract of Example 2 was injected, and the C region (5.0 mg / 40 μL extract per disk)> D region (5.0 mg / 40 μL extract per disk) 5.0 mg / 40 [mu] L extract), the growth of Lactobacillus plantarum was confirmed to increase.

(2) Lactococcus treated with a mixture consisting of gad extract and lobster extract Growth of lactis growth

As another example of beneficial bacteria, a disk diffusion method was used to measure the growth effect of lactococcus lactis, which is a lactic acid bacterium. Briefly, MRS agar cultured with Lactococcus lactis (KTCT 3769) at a concentration of 10 ⁶ CFU / mL was dispensed into a Petri dish, cooled to 25 ° C, and then sterilized using an 8 mm filter disc And 40 占 퐇 of each of the first to third embodiments were absorbed by the respective disks and cultured in an incubator at 30 占 폚 for 24 hours to determine whether clear zones were formed around the discs and whether the clear zones Diameter (unit: mm). Here, methylparaben, which is a positive control, was injected at an amount of 5.0 mg / 40 μL per disc.

As a result, it was confirmed that the growth of lactococcus lactis was increased in all of the extracts of Examples 1, 2 and 3 (data not shown).

[ Test Example  2] Gaza Extract and Lady  Evaluation of the inhibitory effect of the mixture composed of the extract on the growth inhibition of skin harmful bacteria

(1) inhibition of the growth of Staphylococcus aureus treated with a mixture consisting of Gadja extract and lobster extract

As an example of harmful bacteria, the disk diffusion method was used to measure the growth inhibitory effect of Staphylococcus aureus. Briefly, Staphylococcus aureus (Staphylococcus aureus) (ATCC 6835) 10 ⁷ after the CFU / mL concentration of TSA (Trypticase Soy agar) incubated with hardened cool to 25 ℃ busy after the petri dish, Sterilized 8-mm filter paper disks were placed at regular intervals on the dish surface, and then 40 μL of each of Examples 1 to 3 or Comparative Examples 1 to 6 was injected into the disk, followed by incubation at 37 ° C. for 24 hours in an incubator, Whether or not a clear zone was formed around the disk and the diameter of the clear zone (unit: mm) were confirmed. Here, methylparaben, which is a positive control, was injected at an amount of 5.0 mg / 40 μL per disc.

5.0mg / 40μl / disc 2.5 mg / 40 μl / disc 1.25 mg / 40 μl / disc Methyl paraben
(5.0 mg / 40 [mu] l / disc) 12.4 Example 1 11.7 10.1 9.6 Example 2 20.1 18.8 18.1 Example 3 19.0 17.6 13.2

5.0mg / 40μl / disc 2.5 mg / 40 μl / disc 1.25 mg / 40 μl / disc Methyl paraben
(5.0 mg / 40 [mu] l / disc) 12.9 Comparative Example 1 - - - Comparative Example 2 17.2 11.6 7.9 Comparative Example 3 15.5 10.3 8.6 Comparative Example 4 - - - Comparative Example 5 11.7 - - Comparative Example 6 9.2 - -

As a result, as shown in Table 2, clear zones were formed around the discs in all of the extracts of Examples 1, 2 and 3, and it was confirmed that the growth of Staphylococcus aureus was inhibited. In particular, when the extracts were compared at the same concentration, the inhibitory effect of the extract of Example 2 was the highest, the extract of Example 3 was the most effective, and the extract of Example 1 showed the lowest efficacy.

On the other hand, as shown in Table 3, in Comparative Examples 2, 3, 5, and 6, growth of Staphylococcus aureus was inhibited, but the effect was lower than those of the examples. It was confirmed that the composition extracted from the mixture of ghazia and leek was more excellent than the composition applied to each composition.

(2) Let aeyeop extract and treated with the extract of mixture consisting of propionic sludge tumefaciens growth inhibition of ACK Nice

As another example of harmful bacteria, a disk diffusion method was used to measure the growth inhibitory effect of acne bacterium, Propionibacterium acnes. Briefly, Propionibacterium < RTI ID = 0.0 > acnes) (ATCC 6919) to 10 ⁷ CFU / mL concentrations BHI (Brain heart infusion culture a), after dispensing the agar in the Petri dish after hardened cool to 25 ℃, arranged at regular intervals, a sterile 8mm filter paper disc on the dish surface Then, 40 μL of each of Examples 1 to 3 or Comparative Examples 1 to 6 was injected into the disk, absorbed and incubated in an anaerobic chamber at 37 ° C. for 24 hours to form a clear zone around the disk And the diameter of the clear zone (unit: mm). Here, methylparaben, which is a positive control, was injected at an amount of 5.0 mg / 40 μL per disc.

5.0mg / 40μl / disc 2.5 mg / 40 μl / disc 1.25 mg / 40 μl / disc Methyl paraben
(5.0 mg / 40 [mu] l / disc) 23.4 Example 1 19.4 18.7 13.2 Example 2 22.1 20.7 19.9 Example 3 22.0 19.4 17.0

5.0mg / 40μl / disc 2.5 mg / 40 μl / disc 1.25 mg / 40 μl / disc Methyl paraben
(5.0 mg / 40 [mu] l / disc) 19.7 Comparative Example 1 - - - Comparative Example 2 13.2 10.6 7.9 Comparative Example 3 10.5 9.3 7.6 Comparative Example 4 - - - Comparative Example 5 10.7 - - Comparative Example 6 9.2 - -

As a result, as shown in Table 4, it was confirmed that clear zones were formed around the discs in all of the extracts of Examples 1, 2 and 3, and the growth of propionibacterium acnes was inhibited. In particular, the growth inhibitory effect of Example 2 was the highest at the same concentration, the extract of Example 3 was the next highest, and the extract of Example 1 showed the lowest efficacy.

On the other hand, as shown in Table 5, in Comparative Examples 2, 3, 5, and 6, the growth of propionibacterium acnes was inhibited, but the effect was lower than those of the Examples. It was confirmed that the composition of the present invention was superior to the composition of the present invention.

(3) inhibition of the growth of Candida albicans treated with a mixture consisting of Gadja extract and a lobule extract

As an example of harmful microorganisms, disk diffusion method was used to measure the growth inhibitory effect of Candida albicans. Briefly, YM (Yeast Malt) agar cultured with Candida albicans (ATCC 10231) at a concentration of 10 ⁷ CFU / mL was dispensed into a Petri dish, cooled to 25 ° C, After disposing the discs at regular intervals on the dish surface, 40 μL of each of Examples 1 to 3 was injected into the disc and absorbed, followed by culturing in an incubator at 37 ° C. for 24 hours to determine whether or not a clear zone around the disc was generated, The diameter of the zone (unit: mm) was confirmed. Here, methylparaben, which is a positive control, was injected at a content of 1.25-5.0 mg / 40 μL per disc.

5.0mg / 40μl / disc 2.5 mg / 40 μl / disc 1.25 mg / 40 μl / disc Methyl paraben
(5.0 mg / 40 [mu] l / disc) 23.6 Example 1 12.5 11.0 9.3 Example 2 19.8 18.3 16.8 Example 3 18.9 16.2 15.0

As a result, as shown in Table 6, clear zones were formed around the discs in all of the extracts of Examples 1, 2 and 3, confirming that the growth of candida albicans was inhibited. In particular, the growth inhibitory effect of Example 2 was the highest at the same concentration, the extract of Example 3 was the next highest, and the extract of Example 1 showed the lowest efficacy.

[ Test Example  3] Gadja extract and Lady  Assessment of Skin Immunity Strengthening Effect of Mixture of Extracts

(1) accelerated beta -dipenadine secretion of skin cells treated with a mixture of Gadja extract and a lysolecule extract

Medium containing 10% FBS, 1% penicillin / streptomycin was used to raise human keratinocyte (HaCaT). The keratinocytes were cultured in a 5% CO ₂ incubator at 37 ° C. Were inoculated to each well in 6-well plate at the concentration of the cell such that 2x10 ⁵ cells / well cultured for 48 hours, 1.7mM calcium chloride (calcium chloride) and adding the above Examples 1 to 3 and Comparative Examples 1 to 6 For 24 hours (cell reaction).

After 24 hours, the supernatant in the cell culture was collected and used for the antimicrobial activity test of the skin immunoassay in (2). Cells in the cell culture were washed with phosphate buffered saline (PBS) And collected in a tube. Then, cDNA was synthesized using High Capacity RNA-to-cDNA Kit (Applied Biosystems, Thermo Fisher Scientific Inc.). The cDNA was then RT-PCR amplified using primers of Table 7 by methods known to those skilled in the art and mRNA expression of HBD-2 and HBD-3 genes, human β-defensin (HBD) Respectively. At this time, GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used as a control.

name Primer sequences (5 ' - > 3 ') SEQ ID NO: HBD-2_forward CCTGTTACCTGCCTTAAGAG SEQ ID NO: 1 HBD-2_reverse GAATCCGCATCAGCCACAG SEQ ID NO: 2 HBD-3_forward CTTCTGTTTGCTTTGCTCTT SEQ ID NO: 3 HBD-3_reverse CACTTGCCGATCTGTTCCTC SEQ ID NO: 4 GAPDH_forward ATTGTCATACCAGGAAATGAGCTT SEQ ID NO: 5 GAPDH_reverse GTGTTCCTACCCCCAATGTGT SEQ ID NO: 6

Name of sample the amount of? -dipensin expression Control group 1.00 Example 1 2.020 Example 2 4.836 Example 3 2.806 Comparative Example 1 - Comparative Example 2 1.856 Comparative Example 3 1.993 Comparative Example 4 1.250 Comparative Example 5 1.706 Comparative Example 6 1.533

As a result, as shown in Fig. 2 and Table 8, the expression amount of? -Diphenecin, which is a skin immunizing substance, was the highest in the extract of Example 2, the next highest in the extract of Example 3, Was the lowest.

On the other hand, when the extract of the comparative example was used, the amount of β-diphenosin expressed was found to be excellent in the efficacy of the composition obtained by blending lees

(2) let the antimicrobial activity of the skin immune substances secreted from the extract and the extract aeyeop a skin cell treated with a mixture consisting of

In order to measure the inhibitory effect of the immune substance contained in the supernatant collected from the skin cell cultures treated with the mixture of the Gadja extract and the leaf extract, the above (2) experiment (test for confirming the promotion of? -Diphenesin secretion ), The antimicrobial activity of the supernatant collected after the termination of the cell reaction was measured by the disk diffusion method. Briefly, TSA (10 μg / ml) obtained by culturing Staphylococcus aureus (ATCC 6835) at a concentration of 10 ⁷ CFU / Trypticase Soy agar) was dispensed into a petri dish and cooled to 25 DEG C, and sterilized 8-mm filter paper disks were placed at regular intervals on the dish surface. Then, the supernatant collected after the treatment of the extracts of Examples 1 to 3 Containing fresh supernatant) was injected into the disc 10 times at 40 μl per well and absorbed. After incubation at 37 ° C for 24 hours in an incubator, the presence or absence of the clear zone around the disc and the diameter Unit: mm). Here, methylparaben, which is a positive control, was injected at an amount of 5.0 mg / 40 μL per disc. The antimicrobial activity measurement was repeated twice.

1 time Episode 2 Methyl paraben
(5.0 mg / 40 [mu] l / disc) 12.5 (FIG. 3A) Example 1 18.1 (Figure 3 D) 17.4 (Figure 3E) Example 2 21.0 (Figure 3 F) 19.8 (Figure 3G) Example 3 15.0 (FIG. 3 H) 16.75 (Figure 3 I)

As a result, as shown in Fig. 3 and Table 9, the extract of Example 2 having the highest amount of? -Diphenyin expression showed the highest antimicrobial activity, and the extract of Example 3 was the next most effective, 1 extract showed the lowest efficacy.

The pharmaceutical, food and cosmetic composition containing the mixture of the extract of Ghazia and the extract of the present invention as an active ingredient of the present invention can be manufactured into various formulations (pharmaceuticals, cosmetics) of Formulations 1 to 7, but the present invention is not limited thereto, Taking into account the functionality, cost and other conditions of the product, it can be applied to various preparations and formulations including a mixture of a suitable amount of GAZA extract and a leaf extract.

[ Formulation example  1] Manufacture of ointment

The ointments containing the mixture of the Ghassa extract and the lysolecule extract of the present invention were prepared by mixing the ingredients of Table 10 containing the oil component and the water component.

Compounding ingredient Content (% by weight) Purified water Balance
Mixture of Gadja Extract and Leaf Extract
(Examples 1, 2, or 3) 10.0 Caprine / capryl triglyceride 10.0
Liquid paraffin 10.0
Sorbitan sesquioleate 6.0
Octyldodec-25 9.0
Cetyl ethyl hexanoate 10.0
Squalane 1.0
Salicylic acid 1.0
glycerin 15.0
Sorbitol 10.0

[ Formulation Example  2] Nourishing lotion ( Milk lotion )

The ingredients of Table 11 containing the oil component and the water component were mixed to prepare a nutritional lotion containing the mixture of the Ghassa extract and the lysolecule extract of the present invention.

Compounding ingredient Content (% by weight) Purified water Balance Mixture of Gadja Extract and Leaf Extract
(Examples 1, 2, or 3) 0.1 Wax 4.0 Polysorbate 60 1.5 Sorbitan sesquioleate 1.5 Liquid paraffin 0.5 Montana 202 (Manufacturer: Seppic) 5.0 glycerin 3.0 Butylene glycol 3.0 Propylene glycol 3.0 Carboxyvinyl polymer 0.1 Triethanolamine 0.2 Preservative, coloring, fragrance Suitable amount

[ Formulation Example  3] Manufacture of massage cream

The ingredients of Table 12, including the oil and water components, were mixed to produce a massage cream containing a mixture of the Ghassa extract and the lysolecule extract of the present invention.

Compounding ingredient Content (% by weight) Purified water Balance Mixture of Gadja Extract and Leaf Extract
(Examples 1, 2, or 3) 0.1 Wax 10.0 Polysorbate 60 1.5 Piggy 60 hardened castor oil 2.0 Sorbitan sesquioleate 0.8 Liquid paraffin 40.0 Squalane 5.0 Montana 202 (Manufacturer: Seppic) 4.0 glycerin 5.0 Butylene glycol 3.0 Propylene glycol 3.0 Triethanolamine 0.2 Preservative, coloring, fragrance Suitable amount

[ Formulation Example  4] Manufacture of pack

The ingredients of Table 13 containing the oil component and the water component were mixed to prepare a pack containing the mixture of the Ghassa extract and the lyophilized extract of the present invention.

Compounding ingredient Content (% by weight) Purified water Balance Mixture of Gadja Extract and Leaf Extract
(Examples 1, 2, or 3) 0.1 Polyvinyl alcohol 13.0 Sodium carboxymethylcellulose 0.2 glycerin 5.0 Allantoin 0.1 ethanol 6.0 Pingyi-12 nonylphenyl ether 0.3 Polysorbate 60 0.3 Preservative, coloring, fragrance Suitable amount

[ Formulation Example  5] Manufacture of hair tonic

The ingredients of Table 14, including the oily and aqueous components, were mixed to produce a hair tonic containing a mixture of the Gadia extract and the lysolecule extract of the present invention.

Compounding ingredient Content (% by weight) Purified water Balance Mixture of Gadja Extract and Leaf Extract
(Examples 1, 2, or 3) 5.0 Castor oil 5.0 Resorcinol 0.1 menthol 0.05 Panthenol 0.2 Salicylic acid 0.1 Tocopheryl acetate 0.1 Pyridoxine hydrochloride 0.1 ethanol Suitable amount Preservative, coloring, fragrance Suitable amount

[ Formulation Example  6] Hair shampoo  Produce

A hair shampoo containing a mixture of the Ghadam extract and the lysolecide extract of the present invention was prepared by mixing the ingredients of Table 15 including the oil component and the water component.

Compounding ingredient Content (% by weight) Purified water Balance Mixture of Gadja Extract and Leaf Extract
(Examples 1, 2, or 3) 5.0 Ammonium lauryl sulfate (ALS) 20 Ammonium laureth sulfate (ALES) 20 Coca- Suitable amount Disodium iodide 0.03 Carbomer Suitable amount ethanol Suitable amount Cocamide Profile Betaine 6.0 Dimethicone (50%) 2.0 Dimethicone (70%) 2.0 DL-Panthenol Suitable amount Tocopheryl acetate Suitable amount Triethanolamine Suitable amount menthol Suitable amount Methylchloroisothiazolinone
Mixture of methylisothiazolinone (MC / IMI) 0.03 Methylparaben Suitable amount Preservative, coloring, fragrance Suitable amount

[ Formulation Example  7] Hair Conditioner  Produce

The ingredients of Table 16 containing the oily components and the water component were mixed to prepare a hair conditioner containing a mixture of the extract of the present invention and the lysolecule extract of the present invention.

Compounding ingredient Content (% by weight) Purified water Balance Mixture of Gadja Extract and Leaf Extract
(Examples 1, 2, or 3) 5.0 ethanol 3.5 Self emulsifying glycerin monostearate 1.5 Propylene glycol 2.5 Stearylmethylbenzylammonium chloride (25%) 7.0 Methyl paraoxybenzoate 0.3 Preservative, coloring, fragrance Suitable amount

While the present invention has been particularly shown and described with reference to the specific embodiments thereof, those skilled in the art will readily appreciate that many modifications are possible, will be. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> MORECHEM Co., Ltd <120> Composition Containing Terminalia Chebula Extract and Artemisia          Extract for Controlling Skin Bacterial Flora Growth, or Enhancing          Skin Immunity <130> YPD201611-0036 <160> 6 <170> KoPatentin 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HBD-2_forward <400> 1 cctgttacct gccttaagag 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HBD-2_reverse <400> 2 gaatccgcat cagccacag 19 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HBD-3_forward <400> 3 cttctgtttg ctttgctctt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HBD-3_reverse <400> 4 cacttgccga tctgttcctc 20 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_forward <400> 5 attgtcatac caggaaatga gctt 24 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_reverse <400> 6 gtgttcctac ccccaatgtg t 21

Claims (15)

A composition for controlling the growth of a skin bacterial flora containing a mixture of an extract of Ghazia and a leaf extract as an active ingredient.
The composition according to claim 1, wherein the mixture increases the growth of skin benefit bacteria in the skin flora.
2. The composition of claim 1, wherein the mixture reduces the growth of skin noxious bacteria among dermatophytes.
The composition according to claim 1, wherein the mixing ratio of the Gossamer extract and the lobster extract in the mixture is 1 to 10: 1 to 10 by weight.
The composition of claim 1, wherein the mixture is present in an amount of 0.01 to 10.0% by weight based on the total weight of the composition.
The method according to claim 1, wherein the extract or mixture is selected from the group consisting of purified water, alcohols having 1 to 4 carbon atoms such as methanol, ethanol, propanol, isopropanol, butanol, acetone, ether, benzene), chloroform, ethyl acetate, methylene chloride, Wherein the composition is extracted with at least one solvent selected from the group consisting of cyclohexane, 1,3-butylene glycol, and mixtures thereof.
The method of claim 2, wherein the skin yuikgyun are lactic acid bacteria (Lactobacillus spp.), Staphylococcus Cocos epi more misses (Staphylococus epidermis) and micro Cocos urethane mouse (Micrococcus luteus), characterized in that at least one gyunin selected from, the composition.
The method of claim 3, wherein the skin harmful bacteria is Staphylococcus aureus (Staphylococcus aureus), Klebsiella acne (Propionibacterium acnes ), Candida albicans ( Candida albicans and Pseudomonas sp. epidermidis ). &lt; / RTI &gt;
The composition according to claim 1, wherein the composition is an external skin cosmetic composition or a skin external composition pharmaceutical composition.
A composition for enhancing skin immunity, comprising a mixture of an extract of Ghazia and a leaf extract as an active ingredient.
11. The composition according to claim 10, wherein the mixing ratio of the Gadja extract and the lyophilized extract in the mixture is 1 to 10: 1 to 10 by weight.
11. The composition according to claim 10, wherein the mixture is present in an amount of 0.01 to 10.0% by weight based on the total weight of the composition.
11. The method of claim 10, wherein the extract or mixture is selected from the group consisting of purified water, alcohols having 1 to 4 carbon atoms such as methanol, ethanol, propanol, isopropanol, butanol, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, Wherein the composition is extracted with at least one solvent selected from the group consisting of cyclohexane, 1,3-butylene glycol, and mixtures thereof.
11. The composition of claim 10, wherein the mixture increases the expression of [beta] -diphenesin in skin cells.
11. The composition of claim 10, wherein the composition is an external skin cosmetic composition or a skin external composition pharmaceutical composition.

Images