KR101450447B1 - Specific primers for discrimination of Tribe Ophiopogoneae cultivars, and uses thereof - Google Patents

Abstract

The present invention relates to a primer set for discriminating tribe ophiopogoneae cultivars and a use thereof, and more specifically, to a primer set including equal to or more than two base sequences selected in a cluster composed of sequence number 1 to 8, and to a method for quickly, precisely and simply discriminating tribe ophiopogoneae cultivars using the same.

Description

Specific primers for discrimination of Tribe Ophiopogoneae cultivars, and uses thereof "

More particularly, the present invention relates to a primer set comprising two or more base sequences selected from the group consisting of SEQ ID NOS: 1 to 8, The present invention relates to a method for quickly, accurately, and simply discriminating a variety of cultivars.

Maekmun Buttercup group (Tribe Ophiopogoneae) plants in the family Liliaceae and maekmundong (Liriope), A lobular maekmundong (Ophiopogon) and in Perry Osan test (Peliosanthes) consists in three genus are all distributed in Asia. Among these, the plants of Macmun dong and Lilium macromusdon are perennial evergreen herbaceous plants, and there are 8 species in the genus Macmundan and 54 species in the lobule Macmundan from Himalaya to East Asia.

A study on the Korean mackunmodong and lobed mackumon dong reported that the Nakai (l911, 1952) reported two types of 2 variants after Palibin (1901) first reported Mondo koreana, (Mondo jaburan, Mondo japonicum, Mondo gracile, and Mondo taquetti) in two species of the genus Liriope koreana (Liriope muscari) and Mondo (Mondo). However, these species were also reported as Liriope graminifolia and Liriope platyphylla by Wang Tang (l951), Makino (1969), Ohwi (1972) and Liriope koreana as Liriope spicata. Since then, Jung (1972) has found Ophiopogon japonicus var. (1976) reported two species of the genus Liriope platyphylla (Liriope spicata) and two species of the lobular nuclei (Ophiopogon japonicus, Ophiopogon jaburan).

Ohwi (1972) studied morphological characteristics and Tanaka et al. (1978) used histological methods and Koh et al. (1985) used chromosomal structures (1996) studied the morphological considerations about the origins of the Maekmundong, but the studies on the SCRA marker analysis for the identification of the Maekmundong and the Maekmyeongdong Have not been reported.

Currently, in China and Japan, lyophilis (0. japonicus) is used as a medicament and L. spicata is used as a substitute (Lee, 1996). In Korea, have.

The McDermid and lobular McDermid have antioxidant activity, have a prominent effect on blood flow acceleration of coronary artery and protect against cardiomyopathy of cardiac muscle, and exhibit sedation. It also has an immune enhancing effect, lowering blood sugar and showing antibacterial activity against Staphylococcus aureus and E. coli. According to recent research reports, it has been reported that Panax ginseng CA Meyer (Ginseng, Ophiophoge on japonicus Ker-Gwal, Schizandra chinensis Bail) . An ischemia treatment agent, a cardiotonic agent, and the like.

As such, the herbal medicines used in Korea are often the same as the names of the herb medicines, which are actually originated plants. Therefore, there are many controversies about the quality of the medicinal herbs. In this context, the Ministry of Health and Welfare is striving to systematically develop oriental medicine by objectifying the medicinal effects of herbal medicines and standardizing the prescriptions. To this end, we are promoting a policy project to standardize the quality of herbal medicines and the quality of medicinal herbs .

However, it is difficult to discriminate the leaflet macromuscularus and the macromuscularus, and a method for discriminating the leaflet quickly and accurately is required.

SUMMARY OF THE INVENTION The present invention has been made in order to solve the above problems, and it is an object of the present invention to provide a discriminating method capable of promptly, accurately and simply discriminating between the macromuscular and lobulated macromolecular dyes and a primer used in the discriminating method.

The present invention provides a set of primers for discriminating the genus Pseudomonas species comprising two or more base sequences selected from the group consisting of SEQ ID NOS: 1-8.

According to a preferred embodiment of the present invention, the cultivar discriminated according to the present invention may be Liriope or Ophiopogon .

According to another preferred embodiment of the present invention, the primer set may be obtained from Random Amplified Polymorphic DNA (RAPD) analysis on Liriope or Ophiopogon .

The present invention also relates to a primer set consisting of SEQ ID NOS: 1 and 2; A primer set consisting of SEQ ID NOS: 3 and 4; A primer set consisting of SEQ ID NOS: 5 and 6; And a primer set consisting of SEQ ID NOS: 7 and 8; and a primer set of SEQ ID NOS: 7 and 8.

According to a preferred embodiment of the present invention, a primer set consisting of SEQ ID NOS: 5 and 6; And a primer set consisting of SEQ ID NOS: 7 and 8, and can provide a primer set for discriminating the Pseudomonas spp. Discriminating Liriope .

According to another preferred embodiment of the present invention, Chinese Liriope of including a primer set consisting of SEQ ID NO: 5 and 6, and Liriope (genus) lt; RTI ID = 0.0 > platyphylla . < / RTI >

According to another preferred embodiment of the present invention, a primer set consisting of SEQ ID NOS: 1 and 2; And a primer set consisting of SEQ ID NOS: 3 and 4; , And can provide a primer set for discriminating papillomaviruses discriminating lobules ( Ophiopogon ).

According to another preferred embodiment of the present invention, there is provided a primer set comprising the primers set forth in SEQ ID NOS: 1 and 2, wherein the primer set of Ophiopogon it is possible to provide a set of primers for discriminating papillomaviruses that discriminates japonicus .

Further, the present invention relates to a primer set for discriminating the genus Pseudomonas species; And a reagent for carrying out an amplification reaction.

According to a preferred embodiment of the present invention, the cultivar discriminated according to the present invention may be Liriope or Ophiopogon .

According to another preferred embodiment of the present invention, the reagent may comprise a DNA polymerase, dNTPs or a buffer.

The present invention also relates to a method for isolating genomic DNA, comprising the steps of: Amplifying the target sequence using the separated genomic DNA as a template and using the primer set to prepare an amplification product; And detecting the amplified product. The method of the present invention may further comprise:

According to a preferred embodiment of the present invention, detection of the amplification product can be performed by capillary electrophoresis, DNA chip, gel electrophoresis, radioactive measurement, fluorescence measurement or phosphorescence measurement.

According to another preferred embodiment of the present invention, the method of discriminating the breed may further include a step of comparing the detected amplification product with the amplification product of the McMurray varieties standard to determine the breed.

The present invention provides stable and effective herb drugs by establishing and providing a standard or method for distinguishing the cultivars of the mulberry mulberry and the lobular mulberry mulberry which are used as the herbal ingredients by using the genetic specification of the special and medicinal crops and the DNA marker system. ≪ / RTI > and a method for preparing the same.

In addition, the primer of the present invention has excellent characteristics in discrimination of the macromuscular and lobular macromolecular dynamics, and is a primer capable of quickly, accurately, and easily discriminating the two species. In addition, Can be provided.

Fig. 1 shows the result of RAPD labeling electrophoresis using OPA 06 marker in Example 2. Fig.
Fig. 2 shows the result of RAPD labeling electrophoresis using OPA 08 marker in Example 2. Fig.
FIG. 3 shows the results of RAPD labeling electrophoresis using OPA 12 marker in Example 2. FIG.
Fig. 4 shows results of RAPD labeling electrophoresis using OPB 05 marker in Example 2. Fig.
FIG. 5 is a diagram showing DNA positions of a PUC-19 vector inserted in Example 3. FIG.
6 shows results of electrophoresis using SA06F and SA06R primers in Example 4. Fig.
Fig. 7 shows results of electrophoresis using SA08F and SA08R primers in Example 4. Fig.
Fig. 8 shows results of electrophoresis using SA12F and SA12R primers in Example 4. Fig.
Fig. 9 shows results of electrophoresis using SB05F and SB05R primers in Example 4. Fig.

Hereinafter, terms of the present invention will be described.

A "primer" of the present invention comprises a single strand oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for the synthesis of a primer extension product. The specific length and sequence of the primer may depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

As used herein, an oligonucleotide used as a primer may also include a nucleotide analogue, such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or alternatively, And may include an intercalating agent.

Hereinafter, the present invention will be described in more detail.

As described above, since the lobulus is closely related to each other and is similar to that of phytoplankton, it is not easy to discriminate. Therefore, there is a lot of controversy about the quality of the lobules and that of the lobules. A discriminating method capable of discriminating quickly, accurately and simply is required.

Accordingly, the present invention has solved the above-mentioned problem by providing a primer set for discriminating the genus Pseudomonas species comprising two or more base sequences selected from the group consisting of SEQ ID NOS: 1 to 8. Thus, it is possible to provide a method of quickly, accurately, and easily discriminating the discrimination of the lobular lobsters and the lobsters.

The primer of the present invention can provide a set of primers for discriminating the Pseudomonas species, including two or more base sequences selected from the group consisting of SEQ ID NOS: 1-8.

The present invention also relates to a primer set consisting of SEQ ID NOS: 1 and 2; A primer set consisting of SEQ ID NOS: 3 and 4; A primer set consisting of SEQ ID NOS: 5 and 6; And a primer set consisting of SEQ ID NOS: 7 and 8; and a primer set of SEQ ID NOS: 7 and 8, wherein the primer set comprises at least one selected from the group consisting of SEQ ID NOS: 7 and 8.

The primer set is not particularly limited as long as it is usually used for discriminating the breed of the McMarine family. Preferably, the primer set can be used to discriminate Liriope or Ophiopogon .

Further, the primer set is not particularly limited as long as it is produced by a method commonly used for discriminating the breed of the McMarine family. Preferably, the primer set is a Random Amplified Polymorphic Random Amplified Polymorphic Random Amplified Polymorphic Random Amplified Polynomial (RAPD) for Liriope or Ophiopogon DNA) analysis.

Next, the present invention relates to a primer set for discriminating the genus of the Aspergillus cerevisiae; And a reagent for carrying out an amplification reaction.

The reagent for carrying out the amplification reaction is not particularly limited as long as it is a reagent which can be added to the amplification reaction, but it may preferably include a DNA polymerase, dNTPs or a buffer. In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

In the kit of the present invention, the primer set included in the kit is a primer set for primer amplification for discriminating Mc-infectious varieties. The primer set included in the kit may be a primer set used in the kit, Can be easily designed, and the primer set thus designed is included within the scope of the present invention. Preferably, a RAPD analysis was performed on the McMonababy varieties, a variety-specific RAPD marker was selected, and a primer set was designed based on the result of the base sequence analysis of the selected RAPD markers. Designed primer sets can be constructed with oligonucleotide primer sets with or without eight primers for the leading RAPD marker.

The McFarlane varieties discriminating kit is not particularly limited as long as it is normally used for discriminating the cultivars of the McMarine family. Preferably, it can be used to discriminate Liriope or Ophiopogon .

Further, the present invention relates to a method for isolating genomic DNA, comprising the steps of: Amplifying the target sequence using the separated genomic DNA as a template and using the primer set to prepare an amplification product; And detecting the amplification product; To provide a method for discriminating the genus Corynebacterium varieties.

First, we describe the step of isolating the genomic DNA from a sample of the McMurat family.

The method of isolating the genomic DNA is not particularly limited as long as it is a method of isolating the genomic DNA from the sample. For example, a CTAB reaction (cetyltrimethyl ammonium bromide reaction) may be used, or a plant-specific DNA extraction kit (Qiagen, Germany) may be used.

Next, a step of amplifying the target sequence by performing the amplification reaction using the separated genomic DNA as a template and using the primer set will be described.

The method of amplifying the target sequence is not particularly limited as far as it is a method of amplifying the target sequence. For example, a polymerase chain reaction (PCR), a ligase chain reaction, nucleic acid sequence-based amplification, a transcription-based amplification system, , Amplification with strand displacement amplification or Qβ replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among the above methods, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such PCR methods are well known in the art and commercially available kits can be used.

In addition, the amplified target sequence may be labeled with a detectable labeling substance. The labeling substance is not particularly limited as long as it is ordinarily used as a primer-labeled substance. For example, fluorescent, phosphorescent or radioactive materials can be used, and preferably Cy-5 or Cy-3 can be used. When Cy-5 or Cy-3 is used, when the target sequence is amplified, Cy-5 or Cy-3 is labeled at the 5'-end of the primer and PCR is carried out so that the target sequence is labeled with a detectable fluorescent labeling substance . When the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution, the amplification product may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive.

Further, the primer sets used for amplifying the target sequence may be those shown in SEQ ID NO: 1 to SEQ ID NO: 8.

Next, the step of detecting the amplification product will be described.

The method of detecting the amplification product is not particularly limited as long as it is a method of detecting an amplified product, but it is preferably performed by capillary electrophoresis, DNA chip, gel electrophoresis, radioactive measurement, fluorescence measurement or phosphorescence measurement have.

The capillary electrophoresis can use, for example, an ABi Sequencer. In addition, gel electrophoresis can be performed, and gel electrophoresis can utilize agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution to mark the amplification product, and then a radioactive measurement device such as a Geiger counter or liquid scintillation counter The radioactivity of the amplification product can be measured using a liquid scintillation counter.

In addition, according to one embodiment of the present invention, the method for discriminating the breed may further include a step of comparing the detected amplification product with the amplification product of the McMurray family standard.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to explain the present invention to the average person skilled in the art in more detail.

[ Example ]

Example  1. The genus DNA  extraction

The Pcyanthus spp. Varieties used in the present invention are shown in the following Table 1. (The RDA of the table is located in Suwon, Korea, as a medicinal crop division of the National Institute of Horticultural Science.)

DNA was extracted from the fresh leaves and dried tubers of the above-mentioned McNamara variety in order to establish a fast and efficient molecular biological discrimination method for the MacMoushong and Lobstrom macromorphs, which are closely related species.

The DNA was extracted from a fresh-leaf of Mc-infected with a DNA extraction kit (Qiagen, Germany). In addition, in order to facilitate DNA isolation, cetyltrimethyl ammonium bromide (CTAB) buffer was used for extraction.

200 ㎎ of tubers were crushed and cut into small pieces, and the small - sized tubers were made of powder using liquid nitrogen. The flour was then washed with 0.1 M Tris-HCl, 1 M NaCl, 20 mM ethylenediaminetetraacetic acid (EDTA), 1% CTAB and 1% Polyvinyl Pyrrolidone (PVPP ) (w / v) in a tube containing 2 ml of CTAB / PVPP extraction buffer.

The mixture was incubated at 65 DEG C for 20 minutes to prepare a culture solution. DNA was extracted with a liquid containing chloroform / isoamyl alcohol (24: 1 (v / v)).

Example  2. RAPD  analysis

The PCR mixture (25 μl) contained 2.5 μl of 10 × PCR buffer, 0.4 μl dNTP mixture (0.2 mmol / L each of dATP, dCTP, dGTP and dTTP), 2 μl template DNA (~50 ng), 0.5 μl Taq DNA polymerase (1.25 U) and distilled water to a total volume of 25 [mu] l.

The PCR reaction was carried out using a thermal cycler (PCR-200 system) under the following program. Denature the PCR mixture at 94 [deg.] C for 5 minutes; The denaturation at 94 ° C for 1 min, annealing at 40 ° C for 1 min, and extension at 72 ° C for 2 min were repeated 35 times to produce amplified PCR products.

Amplified PCR products were identified by electrophoresis on 1.5% agarose gel and 1x TBE buffer (including tris base, boric acid, EDTA and water). An electrophoresis photograph taken through the electrophoresis is shown in FIGS. 1 to 4. FIG. 1 to 4 are RAPD-labeled electrophoresis photographs.

As can be seen in Fig. 1, it can be seen that the singular band appeared in O. japonicas appearing on line 5.

As can be seen in FIG. 2, it can be seen that a singular band capable of distinguishing the lobular nuclei from the two species of japonicas in Ophiopogon and one species of jaburan was formed.

As seen on Figure 3, it can be confirmed that maekmundong (Liriope) a specific band that can distinguish the platyplylla species that appears in line 1 of the inside are formed.

As shown in the four identified, and distinguished from the genus maekmundong (Liriope), it can be seen that the specific band to distinguish O. japonicas appear on the 5 lines of the leaflets in maekmundong (Ophiopogon) formed.

Example  3. Selected varieties RAPD  Cover Cloning and  Sequencing

The selected strain-specific RAPD amplicons were separated by gel electrophoresis and DNA was extracted from the agarose gel by electrophoresis using Solgent gel and PCR purification kit (manufactured by Solgent Korea).

The extracted DNA was transferred into a PUC-19 vector and transferred to a DH 5α dye. The plasmid DNA was purified from white colonies using a Solgent Plasmid Mini-prep Kit. The positions where the vectors are inserted are MCS (Multiple Cloning Sites) sites shown in Fig. In addition, inserted DNA sequences were analyzed using a Bio-systems ABI 3500 capillary sequencer.

Example  4. Species specific SCAR primer  Development

The strain-specific SCAR primers were prepared based on the nucleotide sequence analysis results of the RAPD markers selected in Example 3. At this time, the nucleotide sequence of each of the replicated RAPD markers based on the RAPD marker was used in the SCAR primer design.

The SCAR primers were used for PCR amplification of genomic DNA isolated from the six samples shown in Table 1 above.

The prepared SCAR primers are shown in Table 2 below.

RAPD
Marker SCAR
primer Sequence (5'-3 ') Tm
(° C) order
number PCR product (bp) Blast Genbank No. OPA-06 SA06F GGTCCCTGACTATATCGTGTT 62 One 460 Predicted protein XP_002322179 SA06R GGTCCCTGACACATACACATG 64 2 OPA-08 SA08F GTGACGTAGGAAACATGGTAG 62 3 441 Cobyrinic acid ZP_06369075.1 SA08R GTGACGTAGGTGTATTGTGGT 62 4 OPA-12 SA12F TCGGCGATAGTGTAGGATATG 62 5 485 Hypothetical protein XP_002280042.1 SA12R TCGGCGATAGAGGTGATACA 60 6 OPA-05 SA05F TGCGCCCTTCAAACAAAACAAG 64 7 553 Hypothetical protein CAJ00237.1 SA05R TGCGCCCTTCCCCAGGTAAC 66 8

The result of electrophoresis using the OPA 06 marker in Table 2 is shown in FIG. As can be seen in Fig. 6, bands appeared in a single band of 460 bp only in O. japonicus (Chinese), and two other species (O. japonicus (RDA acid) and O. jaburan) I did.

The results of the electrophoresis using the OPA 08 marker in Table 2 are shown in FIG. As can be seen in Fig. 7, only 441 bp bands were present in the lobulated bifurcation, and no bands appeared in the bifurcation.

The results of electrophoresis using the OPA 12 marker in Table 2 are shown in FIG. As can be seen in Fig. 8, a band of 485 bp appeared only in L. platyphylla.

The results of electrophoresis using the OPB 05 marker in Table 2 are shown in FIG. As can be seen in FIG. 9, only a band of 553 bp was present in M. mangoni and O. japonicus (Chinese origin), while the other two species (O. japonicus (RDA acid) and O. jaburan) .

In addition, it was confirmed that the four bands expressed by OPA 06, OPA 08, OPA 12 and OPB 05 identified in FIGS. 6 to 9 were product specific RAPD markers.

Polymeric DNA labels prepared by the RAPD markers were cloned and sequenced in the SCAR primer. Each SCAR primer set based on the replicated RAPD sequence was designed and tested.

The four RAPD markers identified above were successfully cloned and sequenced. The size of the inserted DNA marker was confirmed by the following PCR analysis method. The first 10 nucleotides of the sequence corresponded to the used RAPD markers.

For the PCR analysis, 50 ng of the DNA prepared in Example 1, 0.4 mM dNTP, and 1.25 U Taq DNA polymerase were added to prepare a reaction mixture containing distilled water so that the total volume was 25 μl. PCR, the SCAR primer amplification was performed with the following program: denaturing the reaction mixture at 94 ° C for 5 minutes; The amplified SCAR product was prepared by 35 cycles of denaturation at 94 DEG C for 30 seconds, annealing at 60 DEG C for 40 seconds, annealing at 72 DEG C for 2 minutes, and extension at 72 DEG C for 5 minutes.

Four primers were readily identified by electrophoresis and the amplicons obtained by the PCR assay showed dominant presence / deficiency pattern.

As shown in Fig. 6, the SA06 primer amplified the 460-bp marker only in O. japonicus (China). In addition, the SA08 primer generated a 441-bp marker only in the lobular nucleus (see FIG. 7). Furthermore, the SA12 primer generated a 485-bp label only in L. platyphylla (see FIG. 8). Finally, the SB05 primer was amplified only in the genus Macrophotus and O. japonicus (China) (see FIG. 9).

The amplified SCAR product obtained from the SCAR primer amplification was subjected to homology testing using the non-redundant green plant database of Genbank at the NCBI and the BLASTN program. However, blast (BLAST) searches of OPA-06, OPA-12 and OPB-05 sequences using the NCBI nucleotide database were not identical to any known nucleotide sequence.

As can be seen from the examples, the four primer sets of the present invention are specific for the variety of the McMonagoby family having the specific characteristics of the McMarine family, and the primer set of the McMarine family is more simple And can provide a method for accurate and rapid identification.

<110> Kongju National University Industry-Academy Cooperation <120> Specific primers for discrimination of lily cultivars, and uses          the <130> 1039751 <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> DNA <213> lily <400> 1 ggtccctgac tatatcgtgt t 21 <210> 2 <211> 21 <212> DNA <213> lily <400> 2 ggtccctgac acatacacat g 21 <210> 3 <211> 21 <212> DNA <213> lily <400> 3 gtgacgtagg aaacatggta g 21 <210> 4 <211> 21 <212> DNA <213> lily <400> 4 gtgacgtagg tgtattgtgg t 21 <210> 5 <211> 21 <212> DNA <213> lily <400> 5 tcggcgatag tgtaggatat g 21 <210> 6 <211> 20 <212> DNA <213> lily <400> 6 tcggcgatag aggtgataca 20 <210> 7 <211> 22 <212> DNA <213> lily <400> 7 tgcgcccttc aaacaaaaca ag 22 <210> 8 <211> 20 <212> DNA <213> lily <400> 8 tgcgcccttc cccaggtaac 20

Claims (12)

delete delete delete A primer set consisting of SEQ ID NOS: 1 and 2;
A primer set consisting of SEQ ID NOS: 3 and 4;
A primer set consisting of SEQ ID NOS: 5 and 6; And
A primer set consisting of SEQ ID NOS: 7 and 8; and a primer set comprising at least one selected from the group consisting of SEQ ID NOS: 7 and 8. 5. The method of claim 4, further comprising: a primer set consisting of SEQ ID NOs: 1 and 2; And a primer set consisting of SEQ ID NOS: 3 and 4; And a preemergence set for discriminating papillomaviruses ( Ophiopogon ). [Claim 6] The primer set of claim 5, which comprises a primer set consisting of SEQ ID NOS: 1 and 2, and which discriminates among Chinese lobules of Ophiopogon japonicus among the lobules of genus. 5. The method of claim 4, wherein the primer set comprises SEQ ID NOS: 5 and 6; And
A primer set consisting of SEQ ID NOS: 7 and 8; and a set of primers for discriminating the pterygomatophyta discriminating Liriope from at least one selected from the group consisting of: The method of claim 7, comprising a primer set consisting of SEQ ID NO: 5 and 6, maekmundong platinum pillar of Liriope (genus) (Liriope platyphylla) determine maekmun primer set for determining that Buttercup group. 9. A primer set for discriminating the genus Macaroni of any one of claims 4 to 8; And a reagent for carrying out an amplification reaction. [Claim 9] The kit for discriminating the Barnacle &apos; s Barley varieties according to claim 9, characterized in that the varieties of the McMoon barbarians identified are Liriope or Ophiopogon . Isolating the genomic DNA from a sample of the Mcartan group;
Amplifying the target sequence by using the separated genomic DNA as a template and using the primer set of claim 4 to prepare an amplification product; And
Detecting the amplification product;
Gt; of the &lt; RTI ID = 0.0 &gt; Pseudomonas. &Lt; / RTI &gt; 12. The method according to claim 11, wherein the detection of the amplification product is performed by capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

Images