KR101192417B1 - Antioxidative composition and apparatus for removing reactive oxygen using the same - Google Patents

Abstract

The present invention relates to an antioxidant composition and an active oxygen scavenger, and more particularly, to reduce the amount of reactive oxygen species generated in the body by delivering phytochemicals of volatile components to specific target areas such as skin or eye of the body through air. It relates to an antioxidant composition that can be erased and an active oxygen scavenging device using the same.
The antioxidant composition of the present invention includes a plant-derived fragrance capable of reducing or eliminating reactive oxygen species of the body part by delivering phytochemicals of volatile components to a part of the body through air.
The active oxygen scavenging device of the present invention includes a main body formed to cover a part of the body, a fixing member for fixing the main body to the body, and an antioxidant unit installed on the main body to release phytochemical to the body to eliminate the active oxygen species. Equipped.

Description

Antioxidant composition and apparatus for removing reactive oxygen using the same

The present invention relates to an antioxidant composition and an active oxygen scavenger, and more particularly, to reduce the amount of reactive oxygen species generated in the body by delivering phytochemicals of volatile components to specific target areas such as skin or eye of the body through air. It relates to an antioxidant composition that can be erased and an active oxygen scavenging device using the same.

The skin is the largest organ in the body and is always in direct contact with the external environment and acts as a protective shield to protect the living body from various irritation or dry environments. It is an organ that actively produces and destroys new cells compared to other organs of the human body. In addition, it plays a very important role in protecting the body from physical abrasions, preventing the loss of moisture inside the body, protecting it from the ultraviolet rays generated from the sun, and controlling the body temperature.

When the skin is subjected to external stimulation due to various physical factors and external environmental factors, aging such as wrinkle formation, loss of elasticity and keratinization occurs. Skin aging is largely divided into natural aging (or endogenous aging) and external aging. Natural aging is difficult to artificially control because it is influenced by genetic factors, whereas external aging is relatively easy to control because external aging is affected by environmental factors. Do.

Representative external aging factors include ultraviolet rays, and the most prominent external aging phenomenon is wrinkle formation (Daniell HW, Ann. Intern. Med., 1971, 75 (6), 873; Grove GL et al., J. Am. Acad Dermatol., 1989, 21 (3), 631; Griffiths CE et al., Arch.Dermatol., 1992, 128, 347). One of the mechanisms of photoaging caused by ultraviolet radiation is via free radicals (called free radicals or free radicals, called free radicals) (Harman D, J. Gerontol., 1956, 11 (3). ), 298).

Free radicals are known to cause breakdown of connective tissue formation such as skin collagen, inhibition of cell membrane function, promotion of DNA mutation, modification of protein action, energy transfer between cells, and modification of molecules related to metabolism (Lavker RM and Kligman AM, J. Invest.Drmatol., 1988, 90, 325). The involvement of free radicals in aging means that antioxidants or various chemical scavengers can be used to delay the aging process.

On the other hand, even in normal cells, some free radicals and peroxides are generated during metabolism, but as a defense against them, superoxide dismutase (SOD), catalase, peroxidase, etc. Along with antioxidant enzymes, vitamin C, vitamin E, glutathione (glutathione), ubiquinone (ubiquinone), uric acid (uric acid) and other antioxidants exist to protect themselves. However, oxidative stress is caused when an abnormality occurs in such a biological defense mechanism or when the generation of active oxygen exceeds the capacity of the biological defense system by various physical and chemical factors. Therefore, inhibition of free radicals is an important factor in skin aging cosmetics.

Various synthetic antioxidants such as tocopherol, polyphenols, Coenzyme Q 10, BHT, BHA, etc. have been developed for the purpose of eliminating these reactive reactive species (ROS), but most of these oxidants are applied directly to the skin or taken Subsequently, the sustainability of the drug is low, and in particular, for oral administration, there is a problem that the therapeutic effect is halved while the active ingredient of the drug passes through the liver. In addition, conventional synthetic antioxidants are limited in their use because of their safety concerns when applied to human skin for a long time.

The present invention was created to solve the above problems, and developed a natural antioxidant material derived from plants that have high antioxidant effect and ensure safety for human skin, and the phytochemical produced from such natural antioxidants is applied to the skin or eye of the body. It is an object of the present invention to provide an antioxidant composition and an active oxygen scavenging device capable of continuously reducing or eliminating active oxygen species by effectively delivering a non-contact method to a specific target site.

Antioxidant composition of the present invention for achieving the above object is effective in applying a plant-derived fragrance capable of reducing or eliminating active oxygen species of the body part by delivering a phytochemical of volatile components to a part of the body via air It is characterized by including as a component.

The fragrance is characterized in that it contains a phosphor that generates fluorescence by sunlight.

The fragrance is characterized in that it comprises an extract of hyeonggae, white paper, jihwang, gyeolmyeong.

The fragrance is characterized in that it further comprises an extract of the rind peel or leaf.

The antioxidant composition is characterized in that the purpose of the prevention or treatment of dry eye.

And the active oxygen scavenging device of the present invention for achieving the above object is a body formed to wrap a portion of the body; A fixing member for fixing the body to the body part; And an antioxidant unit installed in the main body and capable of reducing or eliminating active oxygen species of the body part by transferring phytochemicals of volatile components to the body part through air.

The antioxidant portion is filled with a receiving portion provided in the main body, characterized in that it comprises a plant-derived fragrance to generate the phytochemical.

And a propagation mediator layer for absorbing the phytochemical released from the antioxidant unit and delivering the phytochemical to the body part.

The fragrance delivery layer is characterized in that the spongy body formed with a plurality of ventilation holes to surround the antioxidant portion to absorb and release the phytochemical.

The spongy body is characterized in that the capsule is formed by impregnating a capsule having a different flavor than the phytochemical released from the antioxidant.

The antioxidant unit is characterized in that it comprises a rate release means for increasing the release rate of the phytochemical.

The main body is provided with a housing for accommodating the antioxidant portion therein and the housing is worn on the face by the fixing member, and coupled to the front or rear of the housing to cover the receiving portion and the phytochemical to be released to the face Characterized in that the cover having a vent formed therein.

The antioxidant unit is a fragrance derived from a plant supported on the surface or the inside of the main body to release the phytochemical to the face, the fragrance is extracted from at least one medicinal powder or medicinal herbs selected from the plants generating the phytochemical It is characterized in that the capsule is a polymer film formed on the surface of the extract.

The antioxidant unit is provided in the receiving unit provided in the main body and the first and second sheets are formed in abutment containing a fragrance derived from a plant formed between the first and second sheets to generate the phytochemical It is characterized by including a diverging layer.

Unlike conventional antioxidants, which are taken or applied directly to the skin, the antioxidant composition of the present invention delivers phytochemicals to specific target sites of the body through air without contact with the body, thereby reducing or eliminating reactive oxygen species, thereby aging and wrinkling the skin. Prevention, prevention and treatment of inflammatory diseases caused by oxidative stress of cells, eye fatigue recovery, eye disease prevention and improvement and the like.

In particular, it is effective for the prevention and treatment of dry eye and eye fatigue by reducing the damage of tear film and eye surface caused by free radicals through local delivery of phytochemical.

In addition, the antioxidant composition of the present invention is a plant-derived natural antioxidant material, the safety of human skin is secured and the antioxidant effect is high.

And the active oxygen scavenging device of the present invention, by wearing on the face or part of the body in various forms such as glasses or eyeglasses, bracelets, necklaces, etc. Free radical species generated in the body by delivering to the body phytochemical generated from the aroma derived from plants Decrease or cancel. In addition, the active oxygen scavenging apparatus of the present invention is different from the non-contact type drug delivery system in which the drug does not directly contact the skin, unlike the PAS type in direct contact with the skin.

1 is a perspective view showing an active oxygen scavenging device according to an embodiment of the present invention,
FIG. 2 is a rear view of FIG. 1;
3 is an exploded perspective view of FIG. 1,
4 is an exploded perspective view showing an active oxygen scavenging device according to another embodiment of the present invention,
5 is a cross-sectional view illustrating main parts applied to an active oxygen scavenging device according to another embodiment of the present invention.
6 is a perspective view showing an active oxygen scavenging device according to another embodiment of the present invention,
7 is a perspective view showing an active oxygen scavenging device according to another embodiment of the present invention,
8 is an exploded perspective view showing an active oxygen scavenging device according to another embodiment of the present invention,
9 is an exploded perspective view showing an active oxygen scavenging device according to another embodiment of the present invention,
10 is a cross-sectional view for illustrating the interior of FIG. 9;
11 is a diagram schematically illustrating a state in which a component adsorbed on a fiber is desorbed at a GC-MS inlet,
12 and 13 are graphs showing the results of GC-MS analysis for each sample,
14 and 15 are graphs showing the ultraviolet absorption spectrum of the extract of the mixture sample,
16 and 17 are graphs showing the fluorescence spectra of the extracts of the mixture samples,
18 to 21 are graphs showing ultraviolet absorption spectra (A) and fluorescence spectra of extracts extracted from C. vulgaris, Rehmannia vulgaris, white papers and molds, respectively;
22 is a graph showing ultraviolet absorption spectra of pullegon and menton,
23 is a graph showing fluorescence spectra of pullegon and menton,
24 to 28 is a graph showing the results of the cytotoxicity test for the extract of each sample,
29 is a graph showing the results of cytotoxicity test of pulle and menton,
30 is a graph showing the radical scavenging ability of the sample extract,
31 is a graph schematically illustrating IC ₅₀ ,
32 is a graph showing the radical scavenging ability of pullegon and menton,
33 to 36 are graphs showing the antioxidant efficacy of the sample extract,
37 is a graph showing the antioxidant efficacy of pullegon,
38 is a graph showing a standard curve of an ORAC assay,
39 is a graph quantifying the antioxidant levels of the extract and pullegon of the mixture sample by ORAC assay,
40 to 42 are photographs showing the expression of antioxidant enzymes in the extract of the mixture sample,
43 to 45 are graphs showing changes in symptom scores,
46 to 48 are graphs showing changes in tear film break time,
49 to 51 are graphs showing the change in the amount of basal tear secretion,
52 to 54 is a graph showing a change in the tear cleaning amount,
55 to 57 are graphs showing changes in corneal sensation,
58 to 60 are graphs showing changes in corneal epithelial disease,
61 to 63 are graphs showing changes in impression cytology test,
64 to 66 are graphs showing the change in CXCL11 concentration in tears.

Hereinafter, an antioxidant composition and an active oxygen scavenging apparatus using the same according to a preferred embodiment of the present invention will be described in detail.

Antioxidant composition according to an embodiment of the present invention is a plant-based fragrance that can reduce or eliminate the reactive oxygen species of the body parts by delivering a phytochemical of volatile components to one part of the body via air as an active ingredient Include.

The antioxidant composition of the present invention delivers phytochemicals of volatile components emanating from the fragrance in a non-contact state, that is, in a non-contact state, to the body parts via air.

Here, phyto chemical is a compound word of phyto, which means plants, and chemical, which means chemistry, and refers to all chemicals made from plants, stems, roots, and leaves. Phytochemicals are present in trace amounts in plants, which in turn serve to hinder the growth of competing plants or to protect one's body from various microorganisms and pests.

In particular, in the present specification, phytochemical means a volatile bioactive substance having antioxidant activity. Examples of such bioactive substances include terpene compounds, such as terpenoids having 10 carbon atoms such as plegon and menthone, and sesquiterpenoids having 15 carbon atoms. In addition to the above materials, compounds such as β-pinene, β-pinene, limonene, anethol, anethole, estragole and fenchone may be further exemplified.

β-pinene is known to have excellent biochemical effects on antibacterial, anti-swelling, anti-inflammatory, and blood circulation (Phytother. res. 17, 1-18 (2003); J. Der. Sci. (2006) 41, 137 -142). Menton has been reported for analgesic, anti-allergic, anti-toxic, antibacterial, insecticidal, anti-cancer activity (Int. J. Pharm. 229 (2001) 37-44; Int. J. Pharm. 219 (2001) 177-181) , Plegon has been reported anti-cancer, antibacterial and anti-toxic effect (Chem. Res. Toxicol. 1989 Sep-Oct; 2 (5): 349-55), limonene has analgesic effect, antidepressant, anti-tumor, blood circulation Effects such as strengthening and lowering blood pressure have been reported (Int. Immunopharmacology 5 (2005) 829-838; Drug Des Deliv. 1990 Sep; 6 (3): 229-38; Vitam Horm. 2005; 72: 505-35) ). Anetol has antimicrobial, antiviral, and insect repellent effects, and animal studies have shown that it has the effect of expectorants and sedatives (Bioorganic & Medicinal Chemistry 13 (2005) 4353-4358). It is known to exhibit sebum suppression and insecticidal activity (Chem. Res. Toxicol. 1998, 11, 863-872; Fitoterapia 71 (2000) 725-729; Yakugaku Zasshi 125 (4) 371-375 (2005); Phytother.Res 18, 827-830 (2004)), and Fenchon has reported effects of skin beauty (wrinkle removal) and digestion promotion (Int. J. Pharmaceutics 215 (2001) 229-240).

Fragrance derived from a plant means a substance obtained from a plant and releasing the above-mentioned phytochemical. Therefore, the fragrance means a medicinal extract extracted from the powder or medicinal herbs of phytochemical-releasing plants, especially medicinal plants (hereinafter, referred to as medicinal herbs) that are ingredients of medicinal herbs. Medicinal powder is used in the finely divided form by grinding the medicinal herbs. The medicinal powder is preferably ground to an average particle diameter of 10 to 400㎛ to properly control the release time of the phytochemical. It is preferable to have a particle size of 100 to 400 μm in order to delay the release time of the phytochemical, and to have a particle size of 10 to 100 μm in order to shorten the release time.

And the medicinal extract can be extracted in various ways. For example, after mixing the extraction solvent with a weight ratio of 2 to 20 times with respect to the medicinal herbs may be used for hot water extraction, cold needle or hot needle extraction for 10 to 150 ℃ for 1 to 24 hours. Further, a reflux cooling extraction method, an ultrasonic extraction method, or the like can be used. In addition to the above-described extraction method, it includes an extract that has undergone a conventional purification process. For example, the active fraction obtained through various purification methods additionally performed, such as separation using an ultrafiltration membrane having a constant molecular weight cut-off value and separation by various chromatography, is also included in the extract.

At least one selected from water, a lower alcohol having 1 to 4 carbon atoms, a polyhydric alcohol, or a mixture thereof may be used as the extraction solvent. As the lower alcohol having 1 to 4 carbon atoms, methanol, ethanol and the like can be used. As the polyhydric alcohol, butylene glycol, propylene glycol, pentylene glycol and the like can be used. Mixtures of water and lower alcohols, mixtures of water and polyhydric alcohols, mixtures of lower alcohols and polyhydric alcohols, or mixtures of water and lower alcohols and polyhydric alcohols can be used as the mixture. It goes without saying that the extract obtained by using the above-mentioned extraction solvent can be obtained in the form of powder through filtration, concentration under reduced pressure or freeze-drying, spray drying or the like.

As medicinal herbs that can be applied to the present invention, cheonmundong, makmundong, white ginseng, peppermint, jihwang, citrus fruits, sweet potato, baekbokyeong, mountain medicine, gojija, walnut, Seokgok, deficiency, passerby, gamguk, earthenware, crust, nutrition angle, windbreak, blue box, schisandra , Licorice, rhubarb, tired person, horoscope, chrysanthemum, glitches, stone name, purpose, bow, mansion type, old persimmon, gypsum, golden, duct, wooden skin, taxa, cornus, marigold, marigold, donkey, ephedra, One, two or more selected from Seol, Siho, Horseback Riding, Ginseng, Maengseon, Jimo, Dermis, Creation, Hyunsam, Poisonous, Safflower, Ogapi, Ginseng, White Paper, Sewage, Astragalus, and Hunting Dogs.

The above mentioned medicinal ingredients are natural substances and have the function of eliminating free radicals without toxic and side effects on the skin. Preferably, at least one selected from a mold, white paper, jihwang, and the faulty medicine. More preferably, it is used as a fragrance in the form of a mixture of mold opening, white paper, sulfur, and deficiency. For hyunggae, white paper, jihwang, and the deficiency, it is better to use the mixed antioxidant than to use alone.

Mold opening (荊芥) (Schizonepeta tenuifolia there is . japonica ) is an annual herb belonging to the Lamiaceae family. The stem is square, the outpost is dense with fine hairs, and the leaves are pinnate and divided into five branches. Split leaves are linear or lanceolate, without sawtooth at edge, flat and blunt with leaf tip. Most of the essential oils contain menthol and limonene and have a distinctive scent. For hyungae, leaves and stems are mainly used as medicinal herbs.

Cheung (白芷) is guritdae with Loose (Angelica dahurica Bentham et Hooker) or its medicinal herb made from dried roots. It has a peculiar smell and slightly bitter taste.

Rehmannia glutinosa) is as perennial herb belonging to Scrophulariaceae, Rehmannia (地黃) of the rosette (根燁) and remove the fine roots, and is referred to as a washed-up saengjihwang the soil root, Rehmannia put Huanggang or baekjue by Zhou Lin (酒浸) steaming After maturation, it is classified as sucrose and it is used differently. Saengjihwang has the effect of clear heat, Saengjin, and Guanjihwang has the effect of congestion of blood and congestion (실), cotton (), Bolu (崩), menstrual relief (月 부), moaning Applied to shortage, Dohan, Tinnitus, Mokhyun, Sugyeokbaek, Oil Well, Sogal due to shortage It is known. Diurnal root is mainly used as a medicinal herb.

Cassia is an annual herbaceous plant ( Cassia ) belonging to the legume (Leguminosae). obtusifolia L. ), or Cassia ( Cassie tora L. ) is used as a sanitary, formal, diuretic, and laxative in oriental medicine.

On the other hand, the fragrance may further include a rind or leaf of the insensitivity in addition to the above-mentioned herbs. Immortality is the citrus medica there is . sarcodactylis ), an evergreen shrub to rhyme , and is distributed in Japan, China, and Korea. The flowers are white and some have purple color. Fruits are used for edible and medicinal purposes.

And it is preferable that an aromatic substance contains the fluorescent substance which generate | occur | produces fluorescence by sunlight. The fragrance applied to the present invention generates fluorescence. Fluorescence is a type of light that is emitted when molecules excited electronically by light return to a stable state. Fluorescence does not occur in all compounds but must have a group of atoms capable of emitting light, that is, a fluorophore.

Factors that may affect antioxidant activity include fluorescence that can be emitted by the phosphor contained in the fragrance as well as the body delivery of volatile compounds emanating from the fragrance. In order for fluorescence to occur, at least two conditions, that is, light energy for the specific compound contained in the fragrance to be electronically excited, must be absorbed by the compound.

In the absorption spectrum of the fragrance applied to the present invention, it absorbs sunlight having a wavelength of 314 nm or more and is excited electronically by solar energy to emit fluorescence in the 300 nm to 500 nm wavelength region and fluorescence in the 650 nm to 800 nm wavelength region. The wavelength range of 300 ~ 500 nm is blue light, which is a light having relatively strong energy among the light in the visible light range. Light in these areas can be used primarily for the treatment of sterilization or viral diseases. On the other hand, light in the wavelength range of 650 ~ 800nm is red light and has less energy than blue light. Red light is known to be easier to penetrate into skin cells than blue light. This is because red light has less sterilization or antiviral action than blue light, but it is more excellent to directly irritate skin by light.

The antioxidant composition of the present invention may be used alone, but may be a composition containing a known carrier or excipient that is pharmaceutically acceptable in addition to the perfume.

In addition, the antioxidant composition of the present invention may be mainly in the form of a powder form, but if the form that can deliver the phytochemical to the body through the air is not limited to the formulation. Therefore, it can be used in the form of a solid or liquid form of granules, pills, capsules, suspensions, emulsions, aerosols and the like according to conventional methods. When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. which are commonly used may be used. Solid dosage forms are formulated with one or more excipients such as starch, calcium carbonate, sucrose or lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid formulations may include various excipients, such as wetting agents, sweeteners, fragrances, preservatives, etc., in addition to water and liquid paraffin, which are simple diluents. In addition, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, ethyl oleate and the like may be used.

The antioxidant composition of the present invention is characterized by the purpose of preventing or treating all parts of the body, especially dry eye. When the phytochemicals emitted from the antioxidant composition of the present invention are delivered to the eye, the amount and quality of tears and circulation of tears can be improved, and damage to the eye surface can be reduced. It can prevent and treat dry eye syndrome by reducing the damage of tear film and ocular surface caused by free radicals by eliminating free radicals through local delivery of antioxidants.

Hereinafter, an active oxygen scavenging device will be described in detail with reference to the accompanying drawings.

The active oxygen scavenging device of the present invention is different from the non-contact type drug delivery system in which the drug does not come in direct contact with the skin, unlike the pars form in direct contact with the skin.

1 to 3, one embodiment of the active oxygen scavenging apparatus of the present invention may be implemented as an eye mask worn on the face. The illustrated active oxygen scavenging apparatus includes a main body 10, a fixing member 20, and an antioxidant unit 30.

The main body 10 is formed to surround a part of the body. That is, in the illustrated example, the body 10 covers the area of the face to cover the eyes and the skin around the eyes. The main body 10 is fixed to the face by the fixing member 20. The body 10 may be made using a resin of a flexible material capable of elastic deformation.

The fixing member 20 extends rearward from both sides of the main body 10. The fixing member 20 is hinged to the main body 10 by the fixing pin 25 to be folded and unfolded with respect to the main body 10. The fixing member 20 is preferably formed in a curve so as to correspond to the side shape of the head. The fixing member 20 of the present embodiment is formed of a material that is elastically deformable and is formed to press the user's head from the side. However, the fixing member 20 is formed such that the rear end portion of the fixing member 20 is caught by the ear like a general eyeglass leg. It may be formed, or may be formed in the form of a belt surrounding the entire head. In addition, the fixing member 20 may be changed in various forms if the main body 10 can be fixed to the face of the user.

The main body 10 consists of a housing 11 and a cover 17. The housing 11 is a portion that forms the front surface of the main body 10, and a receiving portion 13 having a space in which the antioxidant portion 30 can be accommodated is provided on the rear surface. The housing 11 has a plurality of vent holes 13 are formed in a portion corresponding to the eyes when the main body 10 is worn on the face. The cover 17 is coupled to the rear surface of the housing 11 to cover the receiving portion 13. The cover 17 is also formed with a plurality of vent holes 19 in the portion corresponding to the eye, such as the housing (11). The cover 17 may be fitted to the housing 11 or may be fixed to the housing 11 by using a fastener such as a screw. On the other hand, unlike shown, the housing is provided in the front of the housing, the cover may be configured to be coupled to the front of the housing to cover the housing.

The antioxidant part 30 is installed in the accommodating part 15 of the housing 11. The antioxidant unit 30 functions to release phytochemicals to the eyes or skin around the eyes to eliminate reactive oxygen species. In the present invention, the antioxidant portion may be implemented in various examples, but in the illustrated example, the antioxidant portion 30 is formed in the support 31 and the support 31 accommodated in the receiving portion 15 of the housing 11. It consists of a fragrance diffusion layer 37. The fragrant acid layer 37 contains a fragrance derived from a plant that generates phytochemicals.

Aroma derived from plants means a substance obtained from plants and releasing phytochemicals. Since the plant-derived fragrance is the same as that applied to the above-described antioxidant composition, a detailed description thereof will be omitted.

The support body 31 supporting the above-mentioned fragrance is composed of two sheets 33 and 35. That is, the first sheet 33 is disposed on the front surface, and the second sheet 35 is disposed on the rear surface. The first and second sheets 33 and 35 are joined by fusion or sewing along the edges. The first and second sheets 33 and 35 are preferably formed of a breathable material so that the fragrance can be released to the outside. For example, the first and second sheets 33 and 35 may be formed of a nonwoven material. Between the first and second sheets 33 and 35, a fragrance-emitting layer 37 containing a fragrance is formed. The fragrance shedding layer 37 may be formed by mixing the fragrance in the form of a powder with the pressure-sensitive adhesive and then applied to the entire surface of the second sheet 35. It is preferable to use maltodextrin or a natural polymer which prevents long-term decay of the fragrance and maintains moisture retention as the pressure-sensitive adhesive, and the content of the pressure-sensitive adhesive is preferably not more than 40% of the weight of the perfume.

Although not shown, the antioxidant 30 may be filled with an aromatic substance in an empty space formed between the first and second sheets 33 and 35. At this time, the fragrance is applied in powder form.

When the active oxygen scavenging device having the above-described configuration is worn on the face, the phytochemical generated from the antioxidant unit 30 is released to the outside of the main body through the vent hole 19 of the cover 17, and the released phytochemical mediates the air. Is transmitted to the eyes or skin around the eyes.

As described above, the present invention interrupts the main body formed with a ventilation hole between the antioxidant part and the specific part of the body to transfer the phytochemical emitted from the fragrance in a non-contact manner through the air through the air to phytochemical to a specific target site such as skin or eye of the body. Effective delivery to reduce or eliminate reactive oxygen species.

On the other hand, the active oxygen scavenging device according to another embodiment of the present invention is shown in FIG.

Referring to FIG. 4, the active oxygen scavenging device includes a main body, a fixing member 50, and an antioxidant unit 60. The body includes a housing 41 and a cover 44 which are mutually coupled. The rear of the housing 41 is provided with a receiving portion 42 having a space in which the antioxidant unit 60 can be installed, the housing is formed to a size that can cover the eyes and the face around the eyes.

The cover 44 is coupled to the housing 41 and is adjacent to the face of the user. The cover 44 may be fitted to the housing 41 or may be fixed to the housing 41 by using a fastener such as a screw. The cover 44 is formed by passing through a plurality of vent holes 45 so that phytochemicals emitted from the antioxidant unit 60 can be discharged to the outside.

In the illustrated example, the antioxidant unit 60 is formed on the support plate 63 of the rectangular plate shape, the fragrance emitting layer 61 formed on one surface of the support 63 and containing fragrance, and the fragrance radiating layer 61. Release rate increasing means for increasing the release rate of the phytochemical released to the outside.

The fragrance emitting layer 61 is formed by mixing the fragrance in the form of a powder with a pressure-sensitive adhesive and then molding the pad. Preference is given to using maltodextrins or natural polymer polymers which prevent the long-term decay of the fragrance as an adhesive and maintain moisture retention. In addition, a plurality of insertion holes into which the light emission layer 65 to be described later is inserted are formed in the emanation layer 61.

A plurality of light sources 65 for irradiating light to the emission rate increasing means, and a power supply for supplying power to the light source (65). A light emitting diode is used as the light source. Although not shown, the support 63 is provided with a plurality of mounts on which the light sources 65 can be mounted, and each of the mounts is electrically connected so that power applied from the power supply unit can be supplied to all the light sources 65. It is. In addition, the printed circuit is formed on the front surface of the support 63 so that each mounting portion can be electrically connected. The diffusion speed of the phytochemicals emitted from the emanation layer 61 is enhanced by the light irradiated from the light source 65 and the heat generated from the light source 65.

As another example of the release rate increasing means, as shown in FIG. 5, the support 63 is further provided with a magnet 67 in addition to the light emitting diode 65. Since the magnetic field is formed in the emanation layer 61 through the installation of the magnet 67, the release rate may be further enhanced by vibrating or exciting the phytochemical molecules. The magnet 67 may be formed so as to be positioned between the light emitting diodes 67 on the support 63 as shown in FIG. 5. Alternatively, the magnet 67 may include a magnetic body in the process of forming the perfume emitting layer 61. The entire layer 61 may be magnetic. In addition, as shown in FIG. 5, the light source may be omitted and only a magnet may be installed in the support as the release rate increasing means.

Referring back to Figure 4, the fixing member 50 is for fixing the housing 41 to the user's face, the fixing member 50 is coupled to both sides of the housing 41, such as a pair of glasses to a certain length rear It is formed to extend. Two fixing members 50 are formed to surround the head on the side of the user to fix the housing 41.

The first power supply terminal 43 is provided at both ends of the housing 41 so as to receive power from the battery 55 to supply power to the light source 63. The battery 55 is applied as a power supply unit for supplying power and is installed inside the fixing member 50. Accordingly, the fixing member 50 has a battery mounting space in which the battery 55 is mounted, and a second power supply terminal (not shown) in contact with the first power supply terminal 43 is formed in the fixing member. Power is supplied from the battery 55 to the light emitting diodes. The battery 55 is a secondary battery capable of charging and discharging, and the battery 55 may be replaced, but the external power cable may be fastened so that power may be supplied through an external power source or the battery 55 may be charged. The cable connection may be provided on one side of the fixing member.

When power is supplied to the light emitting diode 65 through the switch 51, the phytochemicals contained in the fragrance emitting layer 61 are activated, and the phytochemicals are released to the face through the vent hole 45.

6 shows another embodiment of an active oxygen scavenging device according to the present invention. In the present embodiment, the active oxygen scavenging device is implemented in the form of glasses.

Referring to FIG. 6, in the active oxygen scavenging apparatus of the present embodiment, a through hole is formed in a body 70 corresponding to an eye so that the user's field of view is not obscured when a user wears the lens 77. This is for the user who wears glasses everyday because of poor eyesight, so as to enable everyday life even in the state wearing the main body 70. In addition, for the user who does not normally wear glasses, a lens may be installed in the main body 70 or a lens without a degree of power.

And the lower side of the main body 70 is formed with a plurality of vent holes 71 exposed toward the face. Although not shown, the antioxidant portion is installed in the accommodating portion formed inside the main body 70, and the phytochemical generated from the antioxidant portion is discharged to the face through the vent hole 71. Antioxidation unit applied to the illustrated embodiment is changed only to correspond to the shape of the main body 70, the configuration is the same as the previous embodiments, so the detailed description is omitted.

And when the light source is applied as a rate of emission increase means power supply for supplying power to the light source (not shown), a wire cable (not shown) for electrically connecting the battery and the main body 70, And a connector 85 formed on the fixing member.

Since the active oxygen scavenging device of the present embodiment should be able to perform activities such as work or reading while wearing the main body 70, the battery is worn on a part of the body such as the waist, and connected to the connector through a wire cable as a light source. Enable the supply of power. The fixing member 80 extends rearward from the main body 70 like the glasses legs, and the rear end is caught by the user's ear to fix the main body 70 to the user's face.

7 illustrates an active oxygen scavenging apparatus according to another embodiment of the present invention. The illustrated reactive oxygen scavenging device is implemented in the form of an eye patch.

Referring to FIG. 7, the active oxygen scavenging device includes a main body 90, a fixing member 100, and an antioxidant unit.

The main body 90 is worn on the face by the fixing member 100, and overlaps two sheets 91 of a breathable material through which air can pass. Cotton, nonwoven fabric, pulp, woven paper and the like can be used as the breathable material. Since the main body 90 is easily deformed in shape, the main body 90 can be folded to have a small volume, so that it is easy to store or carry. The fixing member 100 is connected to both sides of the main body 90. An elastic band may be applied to the fixing member 100. In addition, the fixing members 100 may be connected to each other by a buckle or a clamp.

In the present embodiment, the antioxidant unit may be variously applied. For example, as shown in FIG. 1, a support having a perfume emitting layer formed therebetween can be used as an antioxidant unit between two sheets 91. In addition, a powdery fragrance may be filled between the two sheets 91 to be used.

In the example shown, the antioxidant is a fragrance supported on the surface or inside of the sheet 91. At this time, the fragrance is a capsule 110 in which a polymer film is formed on the surface of an extract extracted from at least one medicinal powder or medicinal herbs selected from plants generating phytochemicals. When the main body 90 is worn on the face, phytochemical is released from the medicine inside the capsule 110 while breaking the polymer membrane of the capsule due to friction or pressure. By encapsulating the fragrance as described above, the phytochemical can be slowly released to further extend the release time.

Capsules can be micro size or nano size. The capsule 110 is made of a micro or nano size by wrapping with a polymer film using a spray drying method, an interfacial polymerization method, a phase separation method. Since the manufacturing method of the micro or nano capsule 30 can be implemented as a known technique, a detailed description thereof will be omitted. As a simple example, the extract extracted from the medicinal herb to an aqueous solution of starch may be added and then emulsified and obtained by spray drying through a polymerization reaction and a slurrying step.

Capsules formed in various ways may be applied to the surface of the body or impregnated into the body. As an example of the impregnation method, 1% by weight of styrene-maleic hydride is dissolved in 70% by weight of distilled water, 20% by weight of medicinal extract is added, stirred at 10000 rpm for 3 minutes, and 9% by weight of melamine resin is added to increase the temperature to 60 ° C. The capsule is prepared by raising it for 2 hours. Then, 3% by weight of the capsule and 2% by weight of the binder are dissolved in 95% by weight of distilled water, and then the sheet is immersed and dehydrated and dried at 100 ° C. for 3 minutes to obtain a body impregnated with the capsule.

Since the active oxygen scavenging device having the above-described configuration can be utilized as a patch, phytochemicals are released only by wearing it on the face to continuously erase the active oxygen species, thereby reducing eye fatigue, preventing eye diseases, preventing wrinkles, and improving the effects. Has In addition, the active oxygen scavenging device is transformed into various forms such as glasses or necklaces, bracelets, bands, etc. in addition to the eye patch to be worn on the face or part of the body to transfer phytochemical to the body to prevent inflammatory skin diseases caused by oxidative stress of cells. And help in treatment.

Another embodiment of the present invention is illustrated in FIG. 8. Referring to FIG. 8, the active oxygen scavenging apparatus includes a main body 10, a fixing member 20, and an antioxidant unit 30. Here, since the main body 10, the fixing member 20, and the antioxidant unit 30 are the same as those of the embodiment of FIG. 1, detailed description thereof will be omitted. In contrast to the embodiment of FIG. 1, the active oxygen scavenging apparatus of FIG. 8 further includes a propagation medium 120.

The delivery media layer 120 is formed between the antioxidant unit 30 and the body wrapped around the body 10. The propagation mediating layer 120 absorbs the phytochemicals emitted from the antioxidant unit 30 and delivers them to specific parts of the body. In the illustrated example, the fragrance delivery layer 120 is composed of two sponges 125 surrounding the antioxidant portion before and after. As the sponge 125, a nonwoven fabric, a sponge, or the like, having a plurality of vent holes, may be used. A plurality of vents formed in the sponge 125 absorb and store phytochemicals emitted from the antioxidant unit 30, and gradually release the phytochemicals to the outside by friction or pressure applied from the outside to the body.

On the other hand, the spongy body 120 may be impregnated with a capsule that emits a particular flavor. At this time, the capsule is applied can be obtained by forming a polymer film on the surface of the aromatic material having a different odor than the odor of the phytochemical released from the antioxidant unit 30. Herbal extract may be used as an example of an aromatic substance.

Herb extracts include peppermint, spearmint, applemint, lavender, rosemary, limebloom, sage, lemongrass, lemon verbena, rosehip, cinnamon, jacque, sweet fennel, ginger, saffron, echinacea, jasmine, caraway, Hibiscus, marigold can be extracted from at least one leaf, flower or stem selected from the group consisting of.

Extract the leaves, flowers or stems of herbs such as peppermint or spearmint, and wash them, dry them in the shade for 1-2 days, crush them with a grinder, and put the herbs and distilled water in the extractor at a ratio of 1: 1. After heating to obtain an extract, 5 times of distilled water was added again, followed by heating in hot water at 90 ° C. for 2 to 4 hours to obtain a concentrated extract. In addition, it can be obtained by a conventional extraction method using an organic solvent such as water or ethyl alcohol. In addition, the obtained herbal extract can be obtained in a powder form through a drying process. It can also be obtained in the form of essential oils by conventional steam distillation.

As an example of the impregnation method for impregnating the capsule into the spongiform body 125, 1% by weight of styrene-maleic hydride is dissolved in 70% by weight of distilled water, 20% by weight of medicinal extract is added and stirred at 10000 rpm for 3 minutes, followed by melamine resin. 9% by weight was added to raise the temperature to 60 ℃ and then maintained for 2 hours to prepare a capsule. Then, 3% by weight of the capsule and 2% by weight of the binder are dissolved in 95% by weight of distilled water. Then, the spongy body 125 is immersed and dehydrated and dried at 100 ° C. for 3 minutes to obtain the spongy body 125 impregnated with the capsule.

As described above, when impregnating a capsule having a different scent from the antioxidant portion 30 in the sponge, the scent of the phytochemical released from the antioxidant portion 30 can be adjusted in various ways and can be applied according to the user's taste. In addition, the inherent aroma of the hub using the hub can provide the effect of relaxation and relaxation to the user.

Another embodiment of the present invention is illustrated in FIGS. 9 and 10. 9 and 10, the active oxygen scavenging device of the present invention includes a main body 90, a fixing member 100, an antioxidant unit 140, and an enhancement media 130.

The main body 90 and the fixing member 100 have the same configuration as the main body shown in FIG. 7. That is, the main body 90 is formed by overlapping two sheets 91 of the breathable material back and forth and sewing the edge. Cotton, nonwoven fabric, pulp, woven paper and the like can be used as the breathable material.

And in the present embodiment, the antioxidant unit 140 is composed of a support, and the fragrance diffusion layer 147 formed on the support. The support consists of a first sheet 145 forming a front surface and a second sheet 147 forming a rear surface. The first and second sheets 145 and 147 are formed with a fragrance diffusion layer 150 containing fragrances. The emanation layer 150 is formed in a circular shape on the front surface of the second sheet 147 corresponding to the eye part.

The forwarding mediation layer 130 is composed of two sponges 135 surrounding the front and rear of the antioxidant unit 140. As the sponge 135, a sponge or the like in which a plurality of vent holes are formed may be used. A plurality of vent holes formed in the sponge 135 absorbs phytochemicals emitted from the antioxidant unit 140 and gradually releases the phytochemicals to the outside to be delivered to the body.

On the other hand, as in the embodiment of Figure 8, the spongy body 135 can be impregnated with a capsule that emits a particular odor.

Hereinafter, the present invention will be described through experimental examples. However, the following experimental example is for describing the present invention in detail, and the scope of the present invention is not limited to the following experimental example.

Experimental Example 1: Analysis of Volatile Compounds of Aroma

1. Experimental material

The test material was prepared by purchasing mold, white paper, sulfur, and deficiency. The skins and leaves of imprisonment were provided by Chonnam National University College of Medicine.These materials were stored in a low-temperature storage at 4 ℃ and then crushed into 200㎛ size before the experiment. It was used as a sample.

2. Adsorption of Volatile Compounds by Solid State Microextraction (SPME)

Into a 15 mL SPME vial, add 1 g of each sample of 7 types of mixtures of mold, white, yellow, and bladder to equal weight ratio, mold, white, yellow, deficiency, dead skin and leaf. After closing the lid was installed in a dry bath (Bransted / Thermolyne, DB 28125) set to 50 ± 2 ℃. After the SPME device was erected vertically on the top of the vial, the needle was inserted into the sample and the fiber (Supelco, 65 μm polymethyl-siloxane divinyl-benzene, 57310-u) in the needle was exposed to the inside of the sample for 30 minutes. Thereafter, the components adsorbed on the fiber were analyzed by desorption at the GC-MS inlet set at 250 ° C. as shown in FIG. 11.

3. GC-MS Analysis of Adsorption Components

 Components adsorbed on the fiber by the SPME method were analyzed by GC-MS (HP 6890/5973) under the following conditions. That is, the column was DB5 (0.25 mm × 30 m) was used, the inlet temperature 250 ℃, carrier gas He, the flow rate was 1.0 mL / min. The splitness mode was used because the concentration of the sample was thin. The ionization energy of the MS part was 70 eV, the interface temperature was 250 ° C, and the ion source was EI. The oven temperature was maintained at 40 ° C. for 5 minutes and the temperature was raised to 220 ° C. at 3 ° C./min and then maintained at 220 ° C. for 5 minutes. Most compounds were identified and estimated using retention time (RT) comparisons with commercial products or MS library data. GC-MS analysis results of the adsorption components are shown in FIGS. 12 and 13, respectively.

First, four types of monoterpenoids (C10 compounds) were obtained in the case of mold opening, as shown by the following chemical formula. The most common volatile component of these was pullegone, followed by menthone. In other words, the main volatile components of molds are limonene (limonene) skeleton compounds, pullegon and menton were considered as index components. There are one chiral carbon in pulleon and two in menton, so there are many two and four isomers respectively.

pulegone menthone isomenthone 1,3,8- p -menthatriene

And in the case of a defect, a small amount of volatile components was detected. As shown by the following chemical formula, sesquiterpenoids which are C15 compounds were detected, and three types of compounds of the cadalene skeleton were detected.

α-amorphene 1S- cis -calamenene δ-cadinene

On the other hand, in case of sulfur, as shown in Fig. 12, there is almost no volatile component adsorbed, and thus the structure of the compound is omitted.

In addition, in the case of white paper, it emits a unique and powerful aroma, and various volatile components were detected by the GC-MS analysis of FIG. 12. As the volatile component, sesquiterpenoids such as β-elemene, which is a C15 compound, were mainly used as the volatile components.

                        β-elemene

In addition to the elemene, cedrene, copaene, α-gurjunene, aromadendrene, α-selinene, β-farnesene, germacrene, α-cubebene, β-patchoulene, α-curcumene and the like.

And it was confirmed that the mixture contains a volatile component different from the medicinal ingredients alone as shown in FIG. The main component of the volatile component contained in the mixture was a monoterpenoid series compound.

As shown in FIG. 13, the indel was more volatile than the leaves in the case of the rind, and its kinds also appeared in various ways. Principal components are two large peaks appearing between 23 and 27 minutes of RT (retention time), and the MS data for these were found to be limonene and carene. In particular, limonene made up 47% of the total volatiles. This result was thought to be because imprisonment belongs to the fragrance. In general, the fruit of the fennel contains a large amount of limonene, and the common scent of these fennel and the fruit is derived from limonene.

On the other hand, even in the case of inflorescence leaves have a very refreshing scent, the analysis results showed that the composition of the volatile components is very simple and the main ingredient was limonen like the rind. However, the content of limonene accounted for 61% more than the rind. Therefore, leaves may be useful when incense is used. Most components other than limonene consisted of isomers of limonene skeleton structure. It is expected from this that the inflorescence rind and leaves would be good as a natural fragrance material.

Through the above experiments, four kinds of monoterpenoids having volatile properties in the mold opening rather than the defector, the white paper, and the sulfur were mainly obtained. The most volatile component of these was pullegon, followed by menton. Only small amounts of volatiles were detected in the case of deficiency, white paper, and turmeric. These results can be interpreted that the antioxidant effect of the present invention mainly results from the chemical components present in the mold if the gaseous compounds vaporized by the volatile substance is delivered to the body. However, when using a combination of gyeongjak, white paper, jihwang, four types of hyeongjak than alone using hyeonggae, as shown in Figure 12, the content of pullegon and mentone is higher, and thus may be more beneficial to the antioxidant.

Looking at the structure and physical properties of pulle and menton, the main components of volatile substances, the structure of menton is as follows.

The pulley (C ₁₀ H ₁₆ O) has a molecular weight of 152.24, melting point 82 ℃, boiling point 223 ~ 224 ℃, density 0.936 g / ml. Pullegone is a compound of monoterpenes, in which two isoprenes are bonded to each other to form an essential structure of essential oils, and have a non-polar nature as a molecular structure in which a ketone group is substituted for a hydrocarbon. Therefore, it is almost insoluble in water but soluble in organic solvents such as benzene. Because of the weak attraction between molecules, it can be expected that the volatility is high. Pullegon is a colorless liquid and is known to be used for aromatherapy because it has the odor of pennyroyal or peppermint. Researchers have reported that pulegone has anti-inflammatory properties (G. Flamini, PL Cioni, R. Puleio, I. Morelli and L. Panizzi, "Antimicrobial activity of the essential oil of the Calamintha nepeta and its constituent pulegone against bacteria and fungi ".Phytother.Res. 13 (4), 349-351, 1999), (H. Sasaki," Etstallins-induced inflammation in rabbit eyes with five phytogenis compounds ". Zhongguo Yao Li Xue Bao. 14 (1), 13 -17, 1993), which indicates that there is a pharmacological action in the dragon.

And the structure of the menton is

Menton (C ₁₀ H ₁₈ O) has a molecular weight of 154.25 and has a melting point of −6 ° C., a boiling point of 207 ° C. and a density of 0.83 g / ml. Menton, which is a major volatile substance with pulley, is also a monoterpene compound formed by combining two isoprenes. It can be expected to have a nonpolar property and a high volatility. Menton has two asymmetric carbon atoms, so there may be four kinds of optically active agents. L-mentone is present in about 20% of peppermint oil, which is a liquid with a peppermint odor and boils at 207 ° C. It is almost insoluble in water but soluble in organic solvents such as benzene. L-mentone is produced by oxidizing L-menthol with an oxidizing agent. Conversely, reducing L-mentone results in L-menthol. D-Menton is found in fragrances and leaves and molds of plants. In addition, L-mentone is completely converted to D-mentone when treated with concentrated sulfuric acid at low temperature. Menton is used for aromatherapy because it has the scent of penny royal or peppermint like pullegon and is known to have analgesic effects.

  From these results, if the vaporized compounds in the defects, mold opening, turmeric and white paper stimulate the eyes and help to recover the eye fatigue, it is necessary for L-pulegone and d-menthone which are essential oil components of monoterpene included in mold opening. It can be interpreted that it is mainly caused.

Experimental Example 2: Fluorescence Characteristics of Aromas

Another possibility besides fatigue recovery of the eye by the volatile components of the perfume is fluorescence which can be emitted by the perfume. Fluorescence is a type of light that is emitted when a molecule excited electronically returns to a stable state. Fluorescence does not occur in all compounds but must have a group of atoms capable of emitting light, that is, a fluorophore. For this purpose, the spectroscopy properties of the fragrance, that is, the absorption and fluorescence characteristics of the fragrance were discussed.

1. UV absorption characteristics

To investigate the spectroscopic properties of fragrances, 10 ml of dichloromethane (CH) was added to 50 mg of five samples of mixtures of mold, white, yellow, and bladder at the same weight ratio. ₂ Cl ₂ ) and 10 ml of n-hexane (n-Hexane, nC ₆ H ₁₄ ) solution were added to extract the extract. Extraction proceeded very slowly with stirring for 24 hours using a stirrer. In order to speed up the extraction by the other method was extracted by applying an ultrasonic wave for 4 hours using an ultrasonic cleaner.

First, in the case of the extract extracted from the mixture sample, as shown in Figure 14 (A is extracted using dichloromethane, B is extracted using n-hexane) extracted with a stirrer for 24 hours The absorption spectrum of the solution and the absorption spectrum of the solution extracted by the ultrasonic cleaner for 4 hours show the same absorption peak model. From these results, it means that the chemical reaction does not occur even if extracted with an ultrasonic cleaner for 4 hours.

In FIG. 14, the absorption spectrum of the extract shows the maximum absorption peak near 240 nm and slightly absorbs light of 314 nm or more. Since the light energy reaching the earth's surface is known to be light with wavelengths above 314nm, the results of these experiments indicate that some of the compounds in the extracts can be excited electronically by sunlight. It is present.

In order to confirm in which solvent conditions the extract is extracted more, only the extraction solvents were compared under the same experimental conditions. As a result, as shown in FIG. 15, both of the extracts using the stirrer and the extract using the ultrasonic cleaner were extracted more from the n-hexane solution. Therefore, it was determined that n-hexane should be used as the extraction solvent.

2. Fluorescence Characteristics of Extracts

The absorption spectrum of the extract extracted from the mixture sample shown in FIG. 14 absorbs solar energy having a wavelength of 314 nm or more. These results show that the compounds contained in the extract can be excited electronically by solar energy. Therefore, in order to confirm whether the compounds generate fluorescence by sunlight, fluorescence was measured by setting the light of various monochromatic light as the excitation wavelength for the extract extracted from the mixture sample.

As a result, as shown in FIG. 16, a relatively strong fluorescence in the 300 nm to 500 nm wavelength region and a weak fluorescence peak were observed in the 650 nm to 800 nm wavelength region. The fact that these peaks were observed in a constant wavelength region irrespective of the excitation wavelength used for the measurement is a result proving that the measured peaks are due to fluorescence. The two measured fluorescence wavelength regions, that is, 300 nm to 500 nm wavelength regions, are light of blue series and are light having relatively strong energy among visible light region. Light in these areas can be used primarily for the treatment of sterilization or viral diseases.

On the other hand, light in the wavelength range of 650nm to 800nm is red light and has less energy than blue light. Red light is known to be easier to penetrate into skin cells than blue light. This is because red light has less sterilization or antiviral action than blue light, but it is more excellent to directly irritate skin by light.

As shown in FIG. 17, the fluorescence of the extract changes depending on the amount of the extract, the conditions of the solvent, and the wavelength of the light to be irradiated to change to an electronically excited state. The extract of the mixture sample was confirmed that the fluorescence is emitted by absorbing light by solar energy in n-hexane or dichloromethane solution.

On the other hand, the ultraviolet absorption spectrum and fluorescence spectrum of the extract extracted from each of the sample of the defect, sulfur, white paper and mold are shown in Figures 18 to 21 (A is the ultraviolet absorption spectrum, B is the fluorescence spectrum) in turn. .

As a result, it was confirmed that the extracts from four samples contained compounds absorbing solar energy. However, the fluorescence emitted from these extracts was found to originate mainly from deficiency, papaver and mold. Particularly, in the mold opening, a lot of light in the red region was generated. In the case of white paper, as shown in FIG. 20 (B), it was found that fluorescence was hardly detected.

Fluorescence is a different action from skin irritation caused by volatile substances, and as mentioned above, phosphors must be present for fluorescence to occur. Phosphors are a different property from volatiles that easily vaporize. There is a small amount of volatile substances that easily evaporate in the seeds using the seeds, but there are many Anthraquinone-based compounds capable of generating fluorescence as shown in the following chemical formula.

The anthraquinone compounds are constituted by conjugated π bonds. Therefore, these compounds are generally stable in an excited state and are easy to emit fluorescence. The y-axis, which is the vertical axis in the fluorescence spectrum, generally indicates the intensity of fluorescence. As shown in FIGS. 18 and 19, it is shown that the fluorescence intensity of the extract of C. oleracea or C. vulgaris is greater than the mold opening. Of course, the fluorescence yield (Fluorescence quantum yield) of the C. vulgaris and Rehmannia vulgaris extract was about 0.05, which was much lower than that of general fluorescent materials, but it was confirmed that blue and red light were emitted. As mentioned earlier, the light in these two areas may be involved in some degree of skin irritation by sterilization, antiviral action and penetration.

3. Spectroscopic Characteristics of Pullegon and Menton

It was found that L-pulegone and d-menthone of essential oils, which have volatile properties as compounds of monoterpene type, were found in molds using medicinal leaves or stems, not seeds or roots. Therefore, in order to confirm the fluorescent properties of these materials, these materials were dissolved in dichloromethane and n-hexane solution, and then the UV absorption spectrum and fluorescence spectrum of the solution were measured. Absorption spectrum of these compounds in n-hexane solution shows that it can absorb light up to 400nm as shown in FIG. These results indicate that the absorption of solar energy reaching the Earth's surface is a common absorption wavelength region of monoterpene compounds.

In addition, as shown in FIG. 23, the fluorescence spectra of pulle and menton also showed a relatively strong fluorescence in the wavelength range of 320 nm to 500 nm and a weak fluorescence peak in the wavelength region of 650 nm to 800 nm, similarly to the fluorescence spectrum of the extract extracted from the sample. Although the occurrence of such fluorescence has a weak fluorescence intensity, it can be judged that these lights will affect the mucous membranes and skin cells of the eye.

From the results of this experiment, it was found that various bioactive substances exist among the fragrances, mold opening, turmeric and white paper, which are the fragrances applied to the present invention, and some of them contain compounds having volatile properties. Volatile compounds were mainly present in the mold, and L-pulegone and d-menthone, the essential oils of the monoterpenes, were the main components. These compounds have a relatively weak intermolecular attraction and have physical properties that easily evaporate. These compounds have the odor of pennyroyal or peppermint and are volatile, which may help to recover from fatigue.

In addition to the action of vaporization of volatiles, it has been experimentally demonstrated that fluorescence occurs from the fragrance although it has a relatively weak intensity. Among the compounds contained in the extracts of the cultivars, molds and turmeric, except white paper, there are chemical species that emit fluorescence. These compounds are excited by solar energy and are relatively strong in the wavelength range from 300nm to 500nm and from 650nm. Weak emission of fluorescence in the 800 nm wavelength range.

Experimental Example 3 Cytotoxicity and Antioxidant Activity of Aromas

In this experiment, we measure the amount of reactive oxygen species (ROS) generated by ultraviolet light (ultraviolet) in eye and skin cells, and verify the antioxidant activity and cytotoxicity of the fragrance that can selectively eliminate it.

1. Cell Culture

As a representative skin cell to verify the antioxidant effect, keratinocytes (hKs) and fibroblasts (hFs) are used. Also, human cornea epithelial cells (hCE-2) are used as eye cells. Was used).

(1) cultivation of hKs and hFs

Representative normal skin cell primary cultures of hKs and hFs consisted of 2 × 15 mm sized sections of the skin cut from the neonatal foreskin and 2.4 U / ml dispase (Boehriger Mannheim, Ingelhein, Germany) at about 30 ° C at 37 ° C. The epidermis and dermis were separated by treatment for a minute, and then the hKs culture was chopping the epidermis and the human keratinocyte growth supplement and antibiotic (100 U / ml penicillin and 100) in basal keratinocyte growth media (EpiLife, Cascade biologics, Portland, OR). 2nd-7th generations were used for the experiment by culturing with a medium containing mg / ml streptomycin). The hFs culture also cuts the dermis and contains Dulbecco's modified Eagle's medium (DMEM, BioWhittaker Cambrex) containing 10% fetal bovine serum (FBS) and antibiotics (100U / ml penicillin and 100ug / ml streptomycin, Gibco, Invitrogen corporation, NY, USA). Bio Sciencs, MD, USA) and cultured in 80-90% confluent cells were treated with 0.05% trypsin subculture and used in the experiment.

(2) HCE-2 culture

HCE-2 cell line was purchased from ATCC (Cat No. CRL-11135TM) and used for the experiment. HCE-2 cells were cultured in a medium containing human cornea growth supplement and antibiotics (100 U / ml penicillin and 100 mg / ml streptomycin) in basal keratinocyte growth media (EpiLife).

2. Cytotoxicity Assessment

After culturing hKs, hFs, and HCE-2 cells, various concentrations of bioactive substances were added, and then MTT assay (Chemicon, USA) was performed to test for cytotoxicity (survival rate). The cells were seeded in an appropriate amount (3X104 / well, 4X104 / well and 4X104 / well) in each 96 well plate (Nunc Do, Denmark), and the extracts were incubated for 24 hours. In the MTT method, 0.5 μg / μl MTT solution (3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyl tetrasodium bromide) was added to 10 μl per well for 2-4 hours, followed by DMSO. 100 μl of the solution was dissolved insoluble formazan crystals and absorbance was measured using an ELISA reader (EMAX, Molecular Device, USA) at a wavelength of 570 nm.

3. Extract

A total of five samples, including mixture, mold, white, yellow, and bladder, mixed with same weight ratio, Schisandra chinensis, Cultivator, inflorescence (bark) and inflorescence (leaf) were prepared and dried to use methanol (99.9%). The extract was extracted. Volatile plugones and mentones were subjected to primary extraction using hydrous alcohol, hydrous acetone or lower alcohols to prepare compounds of various polarities and large amounts of extracts. The extract was then concentrated and subjected to liquid-liquid extraction in the order of low polar solvent to high polar solvent. The reverse was also done. Generally, n- hexane (or petroleum ether), chloroform (or dichloromethane), ethylacetate, n- buthanol, and the like were sequentially extracted. Then, a secondary separation test was performed. There are several separation methods. In this experiment, we analyzed using separation method by chromatography (TLC) and preparative chromatography.

4. Evaluation of Antioxidant Activity of Extracts

(1) Oxygen radical absorbance capacity (ORAC) assay

Antioxidant effects on the extracts were used in the ORAC assay kit from Oxford biomedical research. The fluorescent labeling protein β-phycoerythrin (β-PE) decreases over time by the peroxy radicals. 2,2'- axobis (2-amindinopropane) dihydrochloride (AAPH) was used as a peroxy radical generator. Trolox (6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid), a water-soluble vitamin E analogue, was used as a control standard. Fluorescence ELISA reader (Molecular Device, USA) was measured for 45 minutes at 1 minute intervals (excitation wavelength: 488 nm, emission wavelengths: 515 nm).

(2) Total polyphenol content

Total polyphenol content was determined using the Folin-Denis method (Swain et al., 1959), which is widely used as an analytical method. 1 mg of each extract was dissolved in 1 mL of distilled water, 2 mL of 2-fold diluted Folin reagent was added to 2 mL of 10-fold diluted solution, mixed well, and left for 3 minutes. Then, 2 mL of 10% Na ₂ CO ₃ was slowly added. The mixture was left for 1 hour and absorbed at 700 nm by UV / VIS spectrophotometer. A standard curve was prepared using tannic acid to determine its content.

(3) Total active oxygen species measurement: 2'-7'-Dichloro Dihydrofluorescein Diacetate (DCF-DA) assay

After cell culture, the extract extracted from the mixture was pretreated for 40 minutes and then stained with 10 uM DCF-DA. Then, UVB 50 mJ / cm ² irradiated and washed, the cells were collected using a scrapper and centrifuged to suspend the cells in PBS. Flow cytometer (FACScalibur, BD Biosciences, Franklin Lakes, NJ, excitation wavelength: 488nm, emission wavelength: 530 nm) was measured by comparing the UV light and the cells treated with the extract and the UV light only.

(4) DPPH radical assay of extract

Antioxidant activity was measured by slightly modifying Blois's method (1958), which measures the radical scavenging effect of the sample using DPPH (2,2-diphenyl-1-picrylhydrazyl, Sigma) method. 500 ug / ml of the extract as an initial concentration was continuously diluted with ethanol and dispensed into 96 wells at concentrations of 10, 25, 50, 100, 250 and 500 ug / ml, and then mixed with 100ul of 1 × 10-4M DPPH, 30 After remaining in the dark for minutes, the residual radical concentration was measured at 517 nm using an ELISA reader (EMAX, Molecular Device, USA). The magnitude of the reducing power of the sample was expressed as radical scavenging activity, and IC50 was expressed as the amount of sample required to reduce DPPH concentration to 1/2 (ug / ml) and BHT (butylated hydroxytoluene), a well-known antioxidant. Compared with. DPPH radical scavenging activity (%) = ((absorbance of the control group without the sample-absorbance of the reaction group with the sample) / absorbance of the control without the sample) × 100.

(5) Protein expression for antioxidants: Western blot analysis

Cell homogenate was added with 1 × SDS sample buffer (50mM Trix HCl, pH 6.8, 10% glycerol, 0.02% bromophenol blue, 5% β-mercaptoethanol), followed by electrophoresis using 12% SDS-PAGE. Transfer to PVDF membrane (Millipore, MA, USA) and react with blocking solution (5% skim milk, TBS, 0.1% tween-20, TBS-T) at room temperature for 1 hour. The primary antibodies HO-1 (1: 1,000, Stressgen), NQO-1 (1: 1,000, Abcam) and mouse monoclonal β-actin (ab-6276, 1: 5,000, Abcam, UK) were then overnight at 4 ° C. The reaction was carried out during (O / N). The secondary antibodies anti-rabbit IgG (1: 5,000) and anti-mouse IgG (1: 5,000) were reacted at room temperature, respectively, and identified by color development using an ECL kit (Amersham, UK).

(6) Antioxidant mRNA expression: RT-PCR analysis

Total RNA was isolated from cells using RNeasy mini kit (Qiagen. CA, UVB). Synthesis of cDNA using Omniscript RT kit (Qiagen, CA, USA) (Condition: 1μg RNA, 10Xbuffer, dNTP, oligodT, inhibitor, reverse trascriptase, 1 hour at 37 ℃, 5 minutes at 93 ℃) Was carried out. PCR reaction of each enzyme was performed with the following primers: HO-1-caggcagagaatgctgagttc gatgttgagcaggaacgcagt (58 ° C), and GADDH-gtcttcaccaccatggagaaggc cggaaggccatgccagtgagctt. Anealing temperature was performed as follows, respectively. PCR products were analyzed using 1.5% agarose gel electrophoresis, stained with Cybersafe DNA gel staining buffer (Invitrogen, Carlsbad, Calif.) And observed with a luminescent image analyzer (LAS 3000, Fujifilm, Tokyo, Japan).

5. Experimental results

(1) Cytotoxicity to Extracts

Stability tests were performed on hFs and hKs cells by diluting the extracts (mixture, mold opening, turmeric, white paper, ocher, inflorescence rind, inflorescence leaf extract) in half from the initial concentration of 1 mg / ml.

As a result, it was confirmed that hFs had no cytotoxicity at concentrations of 0.5, 1, 1, 1, and 1 mg / ml, respectively, extracts (mixture, deficiency, inflorescence rind, inflorescence leaf) (FIG. 24 and FIG. 25A and FIG. 25B). , FIG. 25C).

In hKs cells, extracts (mixtures, deficiencies, inflorescence rinds, inflorescence leaves) were found to be non-cytotoxic at concentrations of 0.5, 0.0625, 0.5, 0.5 and 0.5 mg / ml, respectively (FIGS. 26 and 27A, 27B, FIG. 27c).

And, in the cytotoxicity test for the extract (mixture, mold opening, turmeric, white paper) in HCE-2 cells as eye cells, it was confirmed that there is no cytotoxicity at concentrations of 0.125, 0.5, 0.0625 and 0.0625 mg / ml or less ( Figure 28).

In addition, the cell stability test for volatiles (Plugone, Mentone) in HCE-2 cells was added. As a result, it was confirmed that there is no cytotoxicity at a concentration of 1 mg / ml or less in both Plegon and Mentor (FIG. 29). These results confirmed that the main volatile components secreted alone or from the mixture is less toxic to human skin and eye cells.

(2) total polyphenol content of the extract

Phenolic compounds contained in plants are related to antioxidant activity. Oxygen-free radical reactions in vivo are related to aging and disease of biological tissues, and hydroxyl groups of phenolic substances are stable compounds of free radicals produced in the early stage. To form an oxidation inhibitory effect.

The total polyphenol content of the extract extracted from the mixture samples used in this experiment was relatively high, 1119.778 ± 7.5 ug / ml.

(3) DPPH radical scavenging ability of the extract

DPPH radical scavenging activity of the extracts of mixture, mold opening, turmeric, white paper, cactus (ether), cactus (ethanol), indel fruit and indel leaves was measured.

IC50 concentrations required to inhibit DPPH radical formation by 50% were 0.19, 0.78, *, 6.25, 3.125, 0.781, 1.2 and 1.563 mg / ml, respectively (Fig. 30: * indicates weak scavenging ability). As a result, the extracts were found to have almost the same antioxidant capacity as BHT used as a control. In Fig. 31, the IC50 of Fig. 30 is illustrated.

On the other hand, menton, a volatile substance, was weak in DPPH radicla scavenging activity, and pullene was relatively high (FIG. 32).

(4) free radical species (ROS) scavenging rate of the extract: DCF-DA assay

① Scavenging ability of reactive oxygen species induced by UV

hFs, hKs, and HCE-2 cells were irradiated with UVB ultraviolet light to induce free radicals, and the extracts from the mixture samples were treated to confirm the free radical scavenging rate. In hFs and hKs cells, the extract was pretreated at a concentration of 0.5 mg / ml and HCE-2 cells at a concentration of 0.1 mg / ml for 40 minutes, and then stained for 15 minutes with 10 uM DCF-DA. UVB ultraviolet light 50 mJ / cm ² was irradiated. It was then suspended in 500uL PBS and confirmed by FACS.

As a result, as shown in FIG. 33, the average value of the control group was 9.14, the average value of the cells irradiated with UV light was 51.12, and the average value was 3.76 in the cells treated with the UV light and the extract. It was confirmed that this reactive oxygen species was eliminated.

In the hFs cells, as shown in FIG. 34, the control group without any treatment had an average value of 3.68, and the cells irradiated with UV light alone had an average value of 1365.48, and the cells treated with the extract and UV light had an average value of 93.93. As a result, the cells treated with the extract were shifted to the left in the graph compared to the cells irradiated with ultraviolet light only, confirming that the active oxygen species was eliminated.

As shown in FIG. 35, HCE-2 cells had an average value of 11.64 for control groups, 46.25 for cells irradiated with UV light only, and 28.92 for cells treated with UV and extracts. As shown in the graph, the HCE-2 cells also moved back to the left in the cells treated with the ultraviolet light and the extract, indicating that the extract eliminated the reactive oxygen species ROS induced by the ultraviolet light.

② Scavenging ability of non-radical H ₂ O ₂ (hydrogen peroxide) reactive oxygen species

DCF-DA assay was performed when HCE-2 cells were treated with 1mM H ₂ O ₂ instead of UV light and treated with extracts. As shown in FIG. 36, the average value of the control group was 8.85 and H ₂ O ₂ was treated. The mean value of one cell was 40.66, and the mean value was 24.33 in cells treated with H ₂ O ₂ and the extract, indicating that the extract eliminated H ₂ O ₂ reactive oxygen species.

③ Active oxygen species scavenging ability of pullegon

The reactive oxygen species scavenging rate for the volatile substance Plegon was confirmed. Referring to FIG. 37, the average value of the control was 11.77 in HCE-2 cells, 43.79 in the group irradiated with ultraviolet light only, and 55.38 in the cell group treated with ultraviolet and pullegon. This result was confirmed that the volatile substance, pulleon itself, does not eliminate the active oxygen.

The extract extracted from the mixture contains radicals and non-radical free radical species, but pullegon is not able to eliminate free radical species.

5) Antioxidant Value (Score) of the Extract: ORAC assay

Antioxidant score was measured by the ORAC assay kit at the concentration of the extract extracted from the mixture is less than 10% compared to the initial concentration. First, after confirming the standard curve (Fig. 38) and the experiment, it was confirmed that the extract of 400 mg / ml is 394.1 uM Trolox value (Fig. 39). Therefore, the antioxidant score of the extract was 985 ORAC units per gram. As a result, it was suggested that the mixture sample had high antioxidant capacity.

(6) Expression of antioxidant and anti-inflammatory markers: RT-PCR assay & Western blot

① Expression of HO-1 and NQO-1 in Fibroblasts

Fibroblasts were treated for each concentration (500, 250, 100, 50, 10 ug / ml) for Westen blot analysis. As a result, the expression of HO-1 and NQO-1 in fibroblasts was significantly increased in proportion to the concentration of the extract (Fig. 40). The extracts are thought to enhance the antioxidant activity of cells by increasing the expression of antioxidant enzymes HO-1 and NQO-1.

② Expression of COX-2, HO-1, TNF-α, IL-6 in eye cells

HCE-2 cells, which are eye cells, were treated with the extract 1ug / ml concentration and analyzed by RT-PCR method. As a result, the expression of COX-2, TNF-α, IL-6 in the cells treated with the extract was not increased compared to the UVB group, HO-1 was significantly increased (Fig. 41). In the cells treated with the extract, the expression of COX-2 was not increased as in the RNA result (FIG. 42).

Therefore, extracts from eye cells have low effect on COX-2, TNF-α and IL-6, which are anti-inflammatory markers in the cells, while increasing the expression of HO-1. It was judged.

Experimental Example 4: Ophthalmic Clinical Trial

Dry eye syndrome is a multifactor disease that causes symptoms of eye discomfort, visual impairment, tear film instability, and damage to the ocular surface due to lack of tear or abnormal tear content. (Behrens A, Doyle JJ, Stern L, et al .; Dysfunctional tear syndrome study group.Dysfunctional tear syndrome: a Delphi approach to treatment recommendations.Cornea 2006 25: 900-907, Lemp MA, Baudouin C, Baum J, et al.The definition and classification of dry eye disease: report of the definition and classification subcommittee of the international dry eye workshop (2007) .Ocul Surf 2007 5: 75-92).

In addition, inflammatory chemokines CXCL9, CXCL10, and CXCL11 are expressed on the tear and eye surface of dry eye patients (Yoon KC, Park CS, You IC, Choi HJ, Lee KH, Im SK, Park HY, Pflugfelder SC. of CXCL9, CXCL10, and CXCL11, and CXCR3 in the tear film and ocular surface of patients with dry eye syndrome.Invest Ophthalmol Vis Sci 2010; 51: 643-650).

Dry eye syndrome, including Sjogren's syndrome, is also known to reduce the expression of antioxidant enzymes in the conjunctival epithelium, causing acidic damage to the ocular surface (Cejkovan J, Ardan T, Simonova Z, Cejka C, Malec J, Dotrelova D, Brunova B. Decreased expression of antioxidant enzymes in the conjunctival epithelium of dry eye (Sjogren's syndrome) and its possible contribution to the development of ocular surfacre oxidative injuries.Histol Histopathol 2008; 23: 1477-1483). In addition, oral antioxidants have been reported to increase tear secretion and tear film stability in dry eye patients (Drouault-Holowacz S, Bieuvelet S, Burckel A, et al. Antioxidant intake and dry eye syndrome: a crossover, placebo- controlled, randomized trial.Eur J Ophthalmol 2009; 19: 337-342). However, there are no studies on the effects of topical drug delivery on tears and ocular surfaces.

Therefore, the purpose of this study was to investigate the effect of local delivery of bioactive substances from fragrance on tear film and ocular surface.

1. Test Content

Symptoms, tearing time of tear film, basal tear secretion by Shirmer test, corneal sensation, corneal sensation, corneal epithelial disease in normal and dry eye patients before and 1 month and 2 months after topical delivery The tear film and ocular surface factors such as the number of, the number of conjunctival cup cells and the degree of squamous cell metaplasia were investigated. Other changes in visual acuity and IOP were also investigated.

To this end, a clinical trial was performed by wearing the eyeglasses shown in FIGS. 1 to 3. Nonwoven fabrics were used as the first and second sheets applied to the eye patch, and a pad-shaped odor diffusion layer was formed between the first and second sheets. The fragrance-dispersing layer is formed by mixing 70% by weight of fragrance and 30% by weight of a pressure-sensitive adhesive, which is formed by mixing a mixture of mold opening, white paper, sulfur, and crystals in the same weight ratio, and applying it to one surface of the second sheet. It was.

1) Ocular surface disease index (OSDI)

Using the questionnaire, 12 items of the subject's symptoms (5 items), functions (4 items), and triggers (3 items) are classified into scores from 0 to 4 (0 when there are no symptoms, and there are always 4) is expressed as a score from 0 to 100.

(1) Have you had any of the following symptoms during the past week?

① Your eyes are sensitive to light.

② Feeling like sand in eyes

③ My eyes are stinging or tingling.

④ The vision is blurred.

⑤ Difficult to see ahead.

(2) In the past week, have you been difficult and hard at your next daily life?

① Night driving

② Use a computer or cash dispenser

③ watching television

④ reading

(3) Have you ever been uncomfortable during the past week when your eyes were:

① windy weather

② dry place

③ Where the air conditioner operates

2) Tear film break-up time (BUT)

To measure tear film breakdown time, the wet fluorescence paper was contacted with the conjunctiva corner and the subject blinked several times for several seconds. Lastly, after blinking completely, eyes are not detected and the time from that point to the first occurrence of black spots or holes in the dyed tear film is measured three times using a cobalt blue light source of a slit lamp microscope and the average value is recorded in seconds. It was.

3) Measurement of basal tear secretion (Schirmer score, BST)

After 5 minutes of 0.5% proparacaine hydrochloride (Alcaine, Alcon, USA) in the lower conjunctival sac, contact Schirmer's paper (Eagle Vision, Memphis TN, USA) with the outer third of the lower eyelid for 5 minutes. The base tear secretion was measured in millimeters by measuring the length.

4) Tear clearance rate (TCR)

10 μl of fluorescent dye diluted with 0.5% (Fluorescite, Alcon, USA) and 0.5% proparacaine hydrochloride (Alcaine, Alcon, USA) were placed in the lower conjunctival sac and 5 minutes later, the Schirmer test paper (Eagle Vision, Memphis TN, USA) Tear cleaning rate was measured by contacting the outer third of the lower eyelid for 5 minutes and then comparing the staining degree of the tip of the test paper with the standard test paper. Standard test strips were diluted in 8 levels diluted to 1, 1/2, 1/4, 1/8, 1/16, 1/32, 1/64, 1/128, and 1/256, respectively, resulting in softening of the fluorescent pigment. Separated according to. For the numerical comparison of staining degree, log 2 is shown.

5) Corneal sensitivity test (CST)

Cochet-Bonnet tactile systems (Luneau Optalmologie, Chartres Cedex, France) were used to stretch nylon filaments to the maximum and then contact the tip perpendicular to the corneal center. As the length of the thread was shortened, the length of the thread was first measured in millimeters when the subject felt the first time.

6) Keratoepitheliopathy scoring

In fluorescent dye staining, the area and density of corneal epithelial disease were scored and multiplied. Area score is 0 for unstaining, 1/3 for cornea or less, 1, 1/3 and 2/3 for 2, 2/3 or more, and density score for non-dyeing. The case where the lesions overlapped with 0, hardness 1, moderate 2, and density was shown as 3.

7) Conjunctival impression cytology

After eye drop anesthesia with 0.5% proparacaine hydrochloride before and after 2 months of wearing, cut 6.2 mm diameter cellulose acetate filter paper (MFS membrane filter, Advante MFS, USA) into a suitable circular size, The inferior conjunctival sac was contacted and pressed for 2-3 seconds. Carefully remove the filter paper from the contact surface to avoid tearing, place it onto the gelatin-coated glass slide, immediately fixed with 95% ethanol and then Periodic acid-Schiff (PAS) staining. The degree of metaplasia of the squamous epithelium and the concentration of goblet cells was evaluated by taking a 400x magnification under an optical microscope. The degree of squamous cell death was divided into grades 0, 1, 2, and 3 according to Nelson's classification. Is expressed as the number of cells per square millimeter.

8) Measurement of CXCL11 Concentration in Tears

After tears were collected using a glass capillary tube before and after wearing the eyeglass, the concentration of inflammatory chemokine CXCL11 / I-TAC was analyzed by enzyme-linked immunoassay.

2. Test result

(1) distribution of subjects

Of the 43 subjects, 13 were male and 30 were female. The mean age was 28.3 ± 7.4 years (22 ~ 55 years). Of 27 normal subjects without dry eye syndrome, 8 were male and 19 were female. The average age was 28.3 ± 8.1 years (22 ~ 55 years). 5 of 16 patients with dry eye syndrome were male and 11 were female. The mean age was 28.5 ± 6.1 years (22 ~ 43 years).

(2) Symptom Score (OSDI)

Referring to FIG. 43, the symptom scores of the entire subjects were 39.4 ± 31.9 before wearing the eye patch, 33.1 ± 25.0 (p = 0.04) at 2 weeks after wearing the eyeball, 33.8 ± 24.9 (p = 0.04) at the 4th week, and 32.3 ± at 8 weeks. There was a change to 23.2 (p = 0.02). Among the symptom factors, 1.7 ± 1.4 before wearing eye patch, 1.5 ± 1.1 (p = 0.47) at 2 weeks after wearing eye patch, 1.4 ± 1.2 (p = 0.03) at 4 weeks, and 1.3 ± 0.8 (p = 0.07) at 8 weeks. The functional factors were 1.3 ± 1.4 before wearing, 1.2 ± 1.3 (p = 0.29) at 2 weeks after wearing, 1.2 ± 1.3 (p = 0.37) at 4 weeks, and 1.1 ± 1.3 (p = 0.22) at 8 weeks. They were 1.7 ± 1.4 before wearing, 1.2 ± 1.1 (p <0.01) at 2 weeks after wearing, 1.6 ± 0.9 (p = 0.41) at 4 weeks, and 1.4 ± 0.9 (p = 0.10) at 8 weeks.

Referring to FIG. 44, the symptom score of the general subject group without dry eye syndrome was 16.6 ± 9.1 before eyewear, 16.7 ± 6.7 (p = 0.94) at 2 weeks after eyeglass wear, and 17.2 ± 8.8 (p = 0.79) at 4th week. At week 8 there was no significant change of 17.2 ± 11.8 (p = 0.84). The symptom factors were 0.8 ± 0.9 before wearing, 1.0 ± 0.5 (p = 0.48) at 2 weeks after wearing, 0.6 ± 0.6 (p = 0.21) at 4 weeks, and 0.9 ± 0.7 (p = 0.87) at 8 weeks. Factors were 0.3 ± 0.6 before wearing, 0.3 ± 0.5 (p = 1.00) at 2 weeks after wearing, 0.4 ± 0.6 (p = 0.65) at 4 weeks, and 0.3 ± 0.6 (p = 1.00) at 8 weeks. At 0.9 ± 0.8, they were 0.6 ± 0.7 (p = 0.21) at 2 weeks after wearing, 1.2 ± 0.6 (p = 0.11) at 4 weeks, and 0.9 ± 0.6 (p = 0.86) at 8 weeks.

45, the symptom score of the dry eye patient group was 77.9 ± 13.8 before wearing the eyeglass, 60.7 ± 19.4 (p = 0.02) at 2 weeks after wearing the eyeglass, 61.8 ± 16.1 (p <0.01) at the 4th week, and 8th week. 57.8 ± 12.6 (p <0.01) showed significant improvement. Among the symptom factors, 3.1 ± 0.8 before wearing, 2.5 ± 1.1 (p = 0.11) at 2 weeks after wearing, 2.6 ± 0.7 (p = 0.07) at 4 weeks, and 2.1 ± 0.3 (p <0.01) at 8 weeks. Factors were 3.0 ± 0.6 before wearing, 2.6 ± 1.0 (p = 0.22) at 2 weeks after wearing, 2.5 ± 1.0 (p = 0.12) at 4 weeks, and 2.5 ± 1.0 (p = 0.10) at 8 weeks. At 3.3 ± 0.7, 2.1 ± 1.1 (p = 0.01) at 2 weeks after wearing, 2.2 ± 0.9 (p <0.01) at 4 weeks, and 2.4 ± 0.6 (p <0.01) at 8 weeks.

(3) tear film break time (BUT)

Referring to FIG. 46, the tear film destruction time of all subjects was 9.3 ± 3.7 seconds before wearing the eyeball in the right eye, 12.5 ± 3.0 seconds (p <0.01) at the second week after wearing the eyeball, and 12.7 ± 3.4 seconds at the fourth week (p <0.01). ) And 13.1 ± 3.6 seconds (p <0.01) at 8 weeks, 9.4 ± 3.3 seconds before wearing in the left eye, 12.7 ± 3.3 seconds (p <0.01) at 2 weeks after wearing, and 13.0 ± 3.2 seconds at 4 weeks (p <0.01). ), And at week 8 there was a change of 12.9 ± 3.1 seconds (p <0.01).

Referring to FIG. 47, the tear film destruction time of the general subject group without dry eye was 11.8 ± 1.7 seconds before wearing in the right eye, 14.0 ± 2.3 seconds (p <0.01) at 2 weeks after wearing, and 14.2 ± 2.8 seconds (4 weeks). p <0.01), and 14.4 ± 3.6 seconds (p <0.01) at 8 weeks, 11.6 ± 1.8 seconds before wearing in the left eye, 14.1 ± 2.8 seconds (p <0.01) at 2 weeks after wearing, and 14.2 ± 3.0 seconds at 4 weeks (p <0.01). p <0.01) and 14.2 ± 3.1 sec (p <0.01) at 8 weeks.

Referring to FIG. 48, the tear film destruction time of the dry eye group was 5.1 ± 1.8 seconds before wearing in the right eye, 9.9 ± 2.1 seconds (p <0.01) at 2 weeks after wearing, and 10.3 ± 2.8 seconds at 4 weeks (p <0.01). And 10.8 ± 2.4 seconds (p <0.01) at 8 weeks, 5.8 ± 1.7 seconds before wearing in the left eye, 10.4 ± 2.6 seconds (p <0.01) at 2 weeks after wearing, and 10.8 ± 2.6 seconds (p <0.01) at 4 weeks after wearing And 8 weeks, 10.7 ± 1.5 seconds (p <0.01).

(4) Measurement of basal tear secretion (Schirmer score, BST)

Referring to FIG. 49, the basal tear secretion of the entire subject was 10.9 ± 5.8 mm before wearing in the right eye, 15.9 ± 6.1 mm (p <0.01) at 2 weeks after wearing, 16.4 ± 8.0 mm (p <0.01) at 4 weeks, and 16.3 ± 6.3 mm (p <0.01) at 8 weeks, 11.4 ± 6.8 mm before wearing in the left eye, 15.8 ± 5.8 mm (p <0.01) at 2 weeks after wearing, 15.9 ± 6.9 mm (p <0.01) at 4 weeks, and At week 8 there was a change of 16.6 ± 5.3 mm (p <0.01).

Referring to FIG. 50, the basal tear secretion of the general subject group without dry eye was 14.0 ± 5.0 mm before wearing in the right eye, 17.4 ± 6.7 mm (p = 0.03) at 2 weeks after wearing, and 17.6 ± 8.1 mm at 4 weeks (p). = 0.03), and 17.2 ± 6.3 mm (p = 0.03) at 8 weeks, at 14.9 ± 6.2 mm before wearing in the left eye, 17.2 ± 5.9 mm (p = 0.03) at 2 weeks after wearing, and 17.0 ± 6.5 mm (p at 4 weeks). <0.01) and 17.8 ± 4.7 mm (p = 0.01) at 8 weeks.

Referring to FIG. 51, the basal tear secretion of the dry eye group was 5.6 ± 1.7 mm before wearing in the right eye, 13.2 ± 3.9 mm (p <0.01) at 2 weeks after wearing, and 14.4 ± 7.7 mm (p <0.01) at 4 weeks, At 8 weeks, it was 14.8 ± 6.1 mm (p <0.01), at 5.4 ± 1.5mm before wearing in the left eye, 13.4 ± 4.9 mm (p <0.01) at 2 weeks after wearing, and 13.9 ± 7.3 mm (p <0.01) at 4 weeks, There was a change of 14.6 ± 5.6 mm (p <0.01) at 8 weeks.

(5) Tear Clearance Test (TCR)

Referring to FIG. 52, the tearing amount of all subjects was 5.4 ± 1.3 before wearing in the right eye, 6.2 ± 0.5 (p <0.01) at 2 weeks after wearing, 6.4 ± 0.6 (p <0.01) at 4 weeks, and 6.4 ± at 8 weeks. 0.6 (p <0.01) in the left eye, 5.3 ± 1.2 before wearing, 6.1 ± 0.5 (p <0.01) at 2 weeks after wearing, 6.3 ± 0.5 (p <0.01) at 4 weeks, and 6.4 ± 0.5 (p <8) at 8 weeks. 0.01).

Referring to FIG. 53, the tear clearance of the general subject group without dry eye was 6.1 ± 1.1 before wearing in the right eye, 6.2 ± 0.5 (p = 0.60) at 2 weeks after wearing, and 6.4 ± 0.6 (p = 0.02) at 4 weeks, And 6.4 ± 0.6 (p = 0.01) at 8 weeks, 5.9 ± 0.9 before wearing in left eye, 6.0 ± 0.4 (p = 0.36) at 2 weeks after wearing, 6.3 ± 0.5 (p = 0.03) at 4 weeks, and 6.4 at 8 weeks. There was a change of ± 0.6 (p = 0.01).

Referring to FIG. 54, the tear clearance of the dry eye group was 4.4 ± 1.0 before wearing in the right eye, 6.1 ± 0.5 (p <0.01) at 2 weeks after wearing, 6.3 ± 0.5 (p <0.01) at 4 weeks, and 6.3 at 8 weeks. ± 0.6 (p <0.01), 4.3 ± 0.9 before wearing in left eye, 6.3 ± 0.4 (p <0.01) at 2 weeks after wearing, 6.3 ± 0.5 (p <0.01) at 4 weeks, and 6.4 ± 0.5 (p at 8 weeks <0.01).

(6) corneal sensitization (CST)

Referring to FIG. 55, the corneal sensation test of all subjects was performed at 59.4 ± 1.6 mm before wearing in the right eye, 59.8 ± 1.1 mm (p = 0.26) at 2 weeks after wearing, 59.8 ± 1.1 mm (p = 0.26) at 4 weeks, and 59.8 ± 1.1 mm (p = 0.26) at 8 weeks, 59.5 ± 1.5 mm before wearing in the left eye, 59.7 ± 1.3 mm (p = 0.57) at 2 weeks after wearing, 59.5 ± 1.5 mm (p = 1.00) at 4 weeks, and At 8 weeks, it was 59.8 ± 1.1 mm (p = 0.42).

Referring to FIG. 56, corneal sensory examination of the general subject group without dry eye was 59.4 ± 1.6 mm before wearing in the right eye, 59.8 ± 1.0 mm (p = 0.33) at 2 weeks after wearing, and 59.8 ± 1.0 mm (p at 4 weeks). = 0.33), and 59.8 ± 1.0 mm (p = 0.33) at 8 weeks, at 59.4 ± 1.6 mm before wearing in the left eye, 59.6 ± 1.3 mm (p = 0.33) at 2 weeks after wearing, and 59.4 ± 1.6 mm (p at 4 weeks). 1.00), and 59.8 ± 1.0 mm (p = 0.33) at 8 weeks.

Referring to FIG. 57, the corneal sensory examination of the dry eye group was performed at 59.4 ± 1.7 mm before wearing in the right eye, 59.7 ± 1.3 mm (p = 0.58) at 2 weeks after wearing, and 59.7 ± 1.3 mm (p = 0.58) at 4 weeks, respectively. And 59.7 ± 1.3 mm (p = 0.58) at 8 weeks, 59.7 ± 1.3 mm before wearing in the left eye, 59.7 ± 1.3 mm (p = 1.00) at 2 weeks after wearing, 59.7 ± 1.3 mm (p = 1.00) at 4 weeks, And at 8 weeks, it was 59.7 ± 1.3 mm (p = 1.00).

(7) Keratoepitheliopathy scoring

Referring to FIG. 58, the corneal epithelial disease scores of all subjects were 0.7 ± 1.1 before wearing in the right eye, 0.1 ± 0.3 (p <0.01) at 2 weeks after wearing, 0.2 ± 0.4 (p <0.01) at 4 weeks, and 8 weeks. 0.1 ± 0.3 (p <0.01), in the left eye, 0.6 ± 1.1 before wearing, 0.1 ± 0.3 (p <0.01) at 2 weeks after wearing, 0.2 ± 0.4 (p = 0.02) at 4 weeks, and 0.1 ± 0.4 (at 8 weeks). p = 0.01).

Referring to FIG. 59, the corneal epithelial disease score of the general subject group without dry eye was 0.2 ± 0.4 before wearing in the right eye, 0.1 ± 0.2 (p = 0.19) at 2 weeks after wearing, and 0.2 ± 0.4 (p = 1.00 at 4 weeks after wearing). ) And 0.1 ± 0.3 (p = 0.66) at 8 weeks, 0.2 ± 0.4 before wearing in the left eye, 0.1 ± 0.3 (p = 0.66) at 2 weeks after wearing, 0.2 ± 0.4 (p = 1.00) at 4 weeks, and 8 The week was 0.2 ± 0.4 (p = 1.00).

Referring to FIG. 60, the corneal epithelial disease score of the dry eye patient group was 1.5 ± 1.4 before wearing in the right eye, 0.1 ± 0.3 (p <0.01) at 2 weeks after wearing, 0.2 ± 0.4 (p <0.01) at 4 weeks, and 8 0.1 ± 0.3 (p <0.01) at week, 1.4 ± 1.5 before wearing in left eye, 0.1 ± 0.3 (p <0.01) at 2 weeks after wearing, 0.2 ± 0.4 (p <0.01) at 4 weeks, and 0.1 ± 0.3 at 8 weeks. There was a change (p <0.01).

(8) Conjunctival impression cytology

Referring to FIG. 61, the concentration of cups of conjunctival cells in all subjects was 166.7 ± 72.1 cells / mm2 before wearing, and 196.5 ± 78.3 cells / mm2 (p = 0.06) at 8 weeks after wearing. At 1.6 ± 1.2, there was a change of 1.0 ± 0.7 (p <0.01) at 8 weeks after wearing.

Referring to FIG. 62, the concentration of goblet cells in the conjunctiva of the general subject group without dry eye was 198.5 ± 69.7 cells / mm2 before wearing, and 205.2 ± 70.3 cells / mm2 (p = 0.75) at 8 weeks after wearing. The life span was 1.0 ± 0.7 before wearing and 1.1 ± 0.7 (p = 0.44) at 8 weeks after wearing.

Referring to FIG. 63, the concentration of intraocular cupillary cells in the dry eye group was 113.1 ± 35.7 cells / mm2 before wearing, and 181.9 ± 90.6 cells / mm2 (p <0.01) at 8 weeks after wearing, and the degree of squamous cell metaplasia was worn. There was a change from 2.8 ± 0.9 before to 0.9 ± 0.8 (p <0.01) at 8 weeks after wearing.

(9) Measurement of CXCL11 Concentration in Tear

Referring to FIG. 64, the concentration of CXCL11 in the tears of all subjects was 519.6 ± 262.0 pg / ml before wearing and 483.0 ± 249.9 pg / ml after wearing (p = 0.43).

Referring to FIG. 65, the concentration of CXCL11 in the tears of the general subject group without dry eye was 407.3 ± 233.1 pg / ml before wearing and 410.5 ± 260.8 pg / ml after wearing (p = 0.97).

Referring to FIG. 66, the concentration of CXCL11 in the tears of the dry eye patients group changed from 709.3 ± 192.0 pg / ml before wearing to 605.5 ± 177.5 pg / ml after wearing (p <0.01).

(10) Visual acuity

Overall visual acuity was 1.0 ± 0.2 in the right eye, 1.0 ± 0.3 (p = 0.66) at 2 weeks after wearing, 1.0 ± 0.2 (p = 1.00) at 4 weeks, and 1.0 ± 0.2 (p = 1.00) at 8 weeks. In the left eye, 1.0 ± 0.2 before wearing, 1.0 ± 0.3 (p = 0.57) at 2 weeks after wearing, 1.0 ± 0.3 (p = 0.66) at 4 weeks, and 1.0 ± 0.2 (p = 1.00) at 8 weeks.

The visual acuity of the general subject group without dry eye was 1.0 ± 0.2 before wear in the right eye, 1.0 ± 0.2 (p = 1.00) at 2 weeks after wearing, 1.0 ± 0.2 (p = 1.00) at 4 weeks, and 1.0 ± 0.2 at 8 weeks. (p = 1.00) in the left eye at 1.0 ± 0.2 before wearing, 1.0 ± 0.2 (p = 1.00) at 2 weeks after wearing, 1.0 ± 0.3 (p = 0.57) at 4 weeks, and 1.0 ± 0.2 (p = 1.00 at 8 weeks). ).

The visual acuity of the dry eye group was 1.0 ± 0.3 before wearing in the right eye, 1.0 ± 0.3 (p = 0.58) at 2 weeks after wearing, 1.0 ± 0.3 (p = 1.00) at 4 weeks, and 1.0 ± 0.3 (p = 1.00 at 8 weeks). In the left eye, 1.0 ± 0.3 before wearing, 1.0 ± 0.3 (p = 0.33) at 2 weeks after wearing, 1.0 ± 0.3 (p = 1.00) at 4 weeks, and 1.0 ± 0.3 (p = 1.00) at 8 weeks.

(11) intraocular pressure

The intraocular pressure of all subjects was 13.3 ± 0.9 mmHg before wearing in right eye, 13.7 ± 0.6 mmHg (p = 0.05) at 2 weeks after wearing, 13.1 ± 0.7 mmHg (p = 0.47) at 4 weeks, and 13.1 ± 0.7 mmHg (p at 8 weeks). = 0.30), and in the left eye, 13.2 ± 0.9 mmHg before wearing, 13.8 ± 0.8 mmHg (p = 0.05) at 2 weeks after wearing, 13.5 ± 0.9 mmHg at 4 weeks (p = 0.19), and 13.3 ± 0.7 mmHg at 8 weeks (p). = 0.69).

Intraocular pressure in the general subject group without dry eye was 13.3 ± 0.9 mmHg before wearing in the right eye, 13.6 ± 0.6 mmHg (p = 0.13) at 2 weeks after wearing, 13.0 ± 0.6 mmHg (p = 0.21) at 4 weeks, and 13.0 at 8 weeks. ± 0.6 mmHg (p = 0.21), at 13.3 ± 0.9 mmHg before wearing in the left eye, 13.7 ± 0.7 mmHg (p = 0.11) at 2 weeks after wearing, 13.5 ± 0.9 mmHg at 4 weeks (p = 0.44), and 13.3 at 8 weeks ± 0.7 mmHg (p = 1.00).

Intraocular pressure in the dry eye group was 13.2 ± 1.0 mmHg before wearing in the right eye, 13.8 ± 0.6 mmHg (p = 0.08) at 2 weeks after wearing, 13.3 ± 0.7 mmHg at 4 weeks (p = 0.76), and 13.2 ± 0.7 mmHg at 8 weeks. p = 1.00), 13.1 ± 0.9 mmHg before wearing in the left eye, 14.0 ± 1.0 mmHg (p = 0.05) at 2 weeks after wearing, 13.4 ± 0.8 mmHg at 4 weeks (p = 0.25), and 13.3 ± 0.7 mmHg at 8 weeks p = 0.55).

Through the above-described clinical experiments, eyes symptoms (dryness, fatigue, etc.) improved from the second week after wearing the eyeglasses according to an embodiment of the present invention, the quantity and quality of tears and the circulation of tears were improved, The degree of damage was reduced. There was no significant change in symptoms before and after wearing, but the amount and quality of tears and circulation of tears were improved. In patients with dry eye before wearing, that is, in patients with discomfort in the eyes, all tears and ocular surface factors improved significantly after eye patch wearing, and conjunctival cytology was confirmed.

In conclusion, it has been found that the topical delivery of the bioactive substance generated from the antioxidant composition of the present invention helps to improve dry eye and eye fatigue by reducing free radical damage of tear film and eye surface.

In the above, the present invention has been described with reference to one embodiment, which is merely exemplary, and it will be understood by those skilled in the art that various modifications and equivalent embodiments are possible.

Accordingly, the true scope of protection of the present invention should be determined only by the appended claims.

10: body 11: housing
17: cover 19: ventilator
15: accommodating part 20: fixing member
30: antioxidant 31: support
37: Hyangbalsan Formation

Claims (14)

delete It contains a plant-based fragrance that can reduce or eliminate the reactive oxygen species of the body parts by delivering phytochemicals of volatile components to one part of the body through the air,
The fragrance is an antioxidant composition, characterized in that it contains a phosphor that generates fluorescence by sunlight. According to claim 2, wherein the fragrance is an antioxidant composition, characterized in that it comprises extracts of mold opening, white paper, sulfuric acid, defect. 3. The antioxidant composition according to claim 2, wherein the fragrance comprises extracts of inflorescence rinds or leaves. The antioxidant composition according to any one of claims 2 to 4, wherein the antioxidant composition is for the purpose of preventing or treating dry eye syndrome. A main body formed to cover a portion of the body;
A fixing member for fixing the body to the body part;
And an antioxidant unit installed in the main body and capable of reducing or eliminating active oxygen species of the body part by transferring phytochemicals of volatile components to the body part through air.
The antioxidant unit has a plant-derived fragrance for generating the phytochemical,
And said fragrance contains phosphors that generate fluorescence by sunlight. delete 7. The active oxygen scavenging device according to claim 6, further comprising a propagation mediator layer for absorbing the phytochemical released from the antioxidant unit and delivering the phytochemical to the body part. 9. The active oxygen scavenging device according to claim 8, wherein the fragrance delivery layer is a spongy body having a plurality of vents formed around the antioxidant unit to absorb and release the phytochemical. 10. The active oxygen scavenger according to claim 9, wherein the spongy body is formed by impregnating a capsule having a different odor from that of the phytochemical released from the antioxidant unit. 7. The active oxygen scavenging device according to claim 6, wherein the antioxidant unit comprises a release rate increasing means for increasing the release rate of the phytochemical. According to claim 6, wherein the main body is provided with a housing for accommodating the antioxidant portion therein, the housing is worn on the face by the fixing member, coupled to the front or rear of the housing to cover the receiving portion and the phytochemical face Active oxygen scavenging device comprising a cover formed with a plurality of vent holes to be emitted to. The method of claim 6, wherein the fragrance is supported on the surface or inside of the body to release the phytochemical to the face,
The fragrance is an active oxygen scavenging device, characterized in that the capsule is a polymer film formed on the surface of the extract extracted from at least one medicinal powder or medicinal herbs selected from the plants generating the phytochemical. According to claim 6, wherein the antioxidant unit is installed in the receiving portion provided in the main body and the first and second sheet is formed between the support and the first and the second sheet is formed between the fragrance and the fragrance containing the fragrance An active oxygen scavenging device comprising a layer.

Images