KR100496013B1 - Specific Primers for Detection of Cucumber green mottle mosaic virus - Google Patents

Abstract

The present invention relates to a nucleic acid fragment that specifically reacts with a noinoban half-molecule virus, and more particularly, based on the nucleotide sequence represented by SEQ ID NOs: 2 to 4 and 7 to 9, its complementary nucleotide sequence or these nucleotide sequences A primer consisting of either a nucleic acid fragment of a modified sequence subjected to a mutation or a specific combination of these nucleic acid fragments is disclosed.

According to the present invention, the detection limit is more than 1,000 times higher than that of the diagnostic method using antiserum, and detection of all strains of cucumber nocturnal mosaic virus known to date is possible. In addition, there is no non-specific reaction with other related viruses that occur in gourd crops, which makes it possible to more accurately diagnose the infection of cucumber nocturnal mosaic virus.

Description

Specific Primers for Detection of Cucumber green mottle mosaic virus

The present invention relates to a nucleic acid fragment that specifically reacts with Cucumber green mottle mosaic virus ( CGMMV), and more particularly, the nucleotide sequence represented by SEQ ID NOs: 2 to 4 and 7 to 9, its complement The present invention relates to a primer consisting of any one nucleic acid fragment or a specific combination of these nucleic acid fragments of a base sequence or a modified sequence subjected to a mutation based on these base sequences.

Cucumber nocturnal mosaic virus causes severe damage to watermelons, cucumbers, and melon and other crops every year. There are several strains of cucumber nocturnal mosaic virus known to date, and there are considerable variations between them. To date, only serological diagnostic methods have been disclosed for the cucumber nocturnal mosaic virus. However, this method is highly likely to fail detection due to the limitation of detectability when there is interline variation, but there is no alternative yet.

SUMMARY OF THE INVENTION An object of the present invention devised to provide a solution to the problems of the prior art is to provide nucleic acid fragments or primers having a broad detection spectrum across all cucumber novan half mosaic virus species, despite interline variation.

The present invention in a first aspect to solve the above problems is to the base sequence represented by SEQ ID NO: 2 to 4 and 7 to 9, species complementary base sequence or these base sequence that reacts species-specific reaction with the Oinbanvan mosaic virus And nucleic acid fragments selected from any one of the modification sequences subjected to the mutation.

In addition, the nucleic acid fragment in the first point of view has a base sequence represented by SEQ ID NOs: 2 to 4 and 7 to 9 or a variation based on its complementary nucleotide sequence, and a partial deletion of the nucleotide sequence, addition of an excessive base or nucleotide sequence Or a substitution of a base or subsequence with another base sequence in a base sequence, or a complex thereof.

In addition, the nucleic acid fragment in the first aspect includes a sequence in which a label that binds to a molecule of the nucleic acid fragment and / or a site capable of binding to a solid carrier is introduced.

In the case of the modified sequence, it means a sequence in which some bases are deleted, inserted, added, and substituted within a range that substantially maintains hybridization ability with the genome of Oinobanvan mosaic virus.

In addition, the modification sequence should be such that it is not hybridized with genomes such as cucumber mosaic virus, curinoban mosaic virus, watermelon mosaic virus 2 and zucchini sulfide mosaic virus found in bruises and crops.

When used as a probe or primer, the number of modified bases does not require any particular limitation as long as it substantially maintains the hybridization ability. However, the total number of bases of the nucleic acid fragments obtained as a result of the variation is preferably about 10 to 50.

If the nucleic acid fragment is used as a primer, the position of the mutation is not particularly limited as long as it does not interfere with the hybridization, but preferably, the 3 'terminal portion that affects the elongation step of the polymerase chain reaction is excluded or Only minimal variations should be allowed.

Markers that bind to the molecules of the nucleic acid fragments may include any of radioactive materials or non-radioactive materials. The radioactive material may be, for example, comprising a radioisotope in the phosphate ester moiety. Examples of the non-radioactive label may be fluorescent materials such as rhodamine, fluorosine and derivatives thereof. Biotin, hapten, and the like may also be introduced as indirect markers.

The site capable of binding to a solids-phase carrier is used when the specific fragment of the nucleic acid is specifically bound to the solid carrier, for example, a sandwich hybridization reaction. The solid phase carrier is not particularly limited as long as it can more effectively perform selective detection of polymerase chain reaction products. Examples of these solid carriers include the introduction of streptoavidin, an antibody, and the like to capture binding sites introduced in the primer to solid carriers such as agarose beads, polyacryl beads, latex, microtiters, and polystyrene balls. There is this.

When used as a primer, the site capable of binding to the predator or the solid carrier is preferably introduced at the 5 'end so as not to interfere with the extension during the polymerization chain reaction.

A more specific example of using a modified sequence, a label, a solid carrier, and the like in a nucleic acid fragment as described above but different from the sequence of the nucleic acid fragment of the present invention is disclosed in Japanese Patent Laid-Open No. 2001-0095120.

The present invention according to the second aspect is a combination of nucleic acid fragments,

A nucleic acid fragment selected from any one of the nucleotide sequences represented by SEQ ID NOs: 2 to 4, species complementary to nucleotides thereof, or a modified sequence subjected to mutations based on these nucleotide sequences;

The nucleotide sequence represented by SEQ ID NOS: 7 to 9, which is combined with any of the nucleic acid fragments selected above, and species-specifically reacts with the cucumber noduban mosaic virus, has been subjected to a nucleotide sequence thereof or a mutation based on these nucleotide sequences. It comprises a primer consisting of a combination of nucleic acid fragments selected from any one of the modification sequences.

Nucleic acid fragments constituting the primer according to the second point of view has a base sequence represented by SEQ ID NO: 2 to 4 and 7 to 9 or a variation based on its complementary nucleotide sequence is partially deleted, excessive base or nucleotide sequence of the nucleotide sequence The addition of or a substitution of a base or subsequence with another base sequence in a base sequence, or a combination thereof.

In addition, the nucleic acid fragment constituting the primer according to the second point of view includes a sequence in which a label that binds to the molecule of the nucleic acid fragment and / or a site capable of binding to a solid phase carrier is introduced.

In the nucleic acid fragment constituting the primer in the second aspect of the present invention, the modified sequence, the label, the solid carrier, and the like are substantially the same as described above in the contents of the present invention by the first aspect, and thus will be omitted herein.

The present invention includes a method for detecting cucumber novan half mosaic virus from a product obtained by a polymerase chain reaction by using a nucleic acid fragment or a combination of nucleic acid fragments disclosed above as a primer and adding the primer to an unknown virus genome.

As for the primer extension reaction, various techniques have been disclosed, for example, enzymes, reaction conditions, and the like used for PCR amplification of genes. The base sequences represented by SEQ ID NOs: 2 to 4 and 7 to 9, which are the basis of the present invention, have sufficient length and base sequence as primers by any of various PCR methods. Therefore, even if any of a variety of PCR is applied, additional modifications, adjustment of base length, introduction of mutations, and the like as described above can be carried out as needed to detect the cucumber noduban mosaic virus.

Hereinafter, the content of the present invention will be described in more detail with reference to Examples. However, these examples are only presented to understand the content of the present invention, and the scope of the present invention should not be construed as being limited to these embodiments.

Example 1 Isolation and Maintenance of Viruses

The isolation method and maintenance of the virus used for the present invention are as follows.

(1) Test Subject Virus

Cucumber copperas mosaic virus diagnostic nucleic acid fragment naejineun contrast to the target virus, cucumber copperas mosaic virus to develop primers virus cucumber mosaic virus (Cucumber mosaic virus, CMV), Curie copperas mosaic virus (Kyuri green mottle mosaic virus, CGMMV ), watermelons Watermelon mosaic virus 2 (WMV2), and Zucchini yellow mosaic virus (ZYMV) were used.

(2) Isolation of test subject virus

Cucumbers are isolated from watermelons, cucumbers and melons, cucumber mosaics from cucumbers and peppers, Curinobban mosaic virus from zucchini and cucumbers, watermelon mosaic virus from melon, and zucchini sulfa mosaic virus from pumpkins. It became.

The isolated virus is isolated by pure separation by the local disease separation method commonly used in plant virus separation using Mengju ( Chenopodium amaranticolor ), and then inoculated in the fruit plant to maintain it.

Example 2 Design of Primer

(1) Analysis of genetic information of cucumber nocturnal mosaic virus isolates

To develop diagnostic primers that can be used for all strains of cucumber nocturnal mosaic virus, the genetic information of the isolated cucumber novan half mosaic virus strains was analyzed. The cucumber nocturnal mosaic virus isolates used for sequencing are shown in Table 1 below.

<Table 1> Cucumber isolates of cucumber nocturnal mosaic virus used for primer design

Separation Separator Presentation year Presenter CGMMV-W watermelon 1983 Meshi, T. CGMMV-SH Melon 1991 Ugaki, M. CGMMV-KW1 watermelon 1990 Lee, K. W. CGMMV-KC1 cucumber 2000 Plant Pathology Division, KAIST CGMMV-SM1 melon 2000 Plant Pathology Division, KAIST CGMMV-SW1 watermelon 2000 Plant Pathology Division, KAIST

Sequencing for primer synthesis was performed on the 3 'untranslated region (3'UTR) containing coat protein (CP) and movement protein (MP).

(2) searching for common sequences

In the region, five upstream primers and five downstream primers were synthesized as shown in Table 2 by searching for sequences that meet the conditions of the primers among the nucleotide sequences common to all the genus of Noybanban mosaic virus. Synthesis was performed using chemical synthesis, and DNA autosynthesis model 381A (Perkin Elmer) was used.

<Table 2> Primers Designed Specific to Oinbanvan Mosaic Virus Species

Kinds primer Sequence (5 '→ 3') size location Upstream Primer SEQ ID NO: 1 TGATCTTACAAAACACCT 18 MP SEQ ID NO: 2 ATGGAACGTACCGGAATC 18 MP SEQ ID NO: 3 AATCGGAGGTTGGACTCTGCTTCTG 25 MP SEQ ID NO: 4 AATCCGATCACACCTAGCAAA 21 CP SEQ ID NO: 5 CTGAGTCGCTTAACGCTGTA 20 CP Downstream primer SEQ ID NO: 6 AGAATTACTGCCCATAGA 18 3'UTR SEQ ID NO: 7 TAAGCTTTCGAGGTGGTAG 19 CP SEQ ID NO: 8 GACTCTATTAAATTATCTATCTC 23 CP SEQ ID NO: 9 AATTAAGTAAAGTCCTGACG 20 CP SEQ ID NO: 10 TGGAGGTTTAGAATGCCGCTTAC 23 MP

The positions of the primers designed above are shown in FIG. 1.

Example 3 Primer Selection

1. Total RNA isolation method and RT-PCR conditions used for the present invention are as follows.

(1) total RNA isolation

Total RNA was isolated using guanidine acid-phenol extraction method. To 50 mg of infected plant, 600 μl of denatured buffer solution (4 M guanidinium thiocyanate, 25 mM sodium citrate, 0.5% sarcosyl, 100 mM 2-mercetoethanol) was added and ground using mortar and pestle.

60 µl of 2 M sodium acetate (pH 4.0) was added thereto, and 600 µl of phenol: chloroform: isoamyl alcohol (125: 24: 1) was added thereto, followed by mixing on ice and centrifugation at 10,000 g for 20 minutes. Separated.

Then, the aqueous layer containing RNA was taken, mixed with the same amount of isopropanol, left at -20 ° C for 30 minutes and centrifuged at 10,000 g for 20 minutes. The precipitate formed was dissolved in 500 μl of denatured buffer, and then mixed with the same amount of isopropanol, and left standing at −20 ° C. for 30 minutes and centrifuged at 10,000 g for 10 minutes.

The precipitate was then washed three times with 75% ethanol and centrifuged, and frozen and dissolved in 100 μl distilled water.

(2) reverse transcriptase-polymerase chain reaction (RT-PCR)

RT-PCR was performed under the following conditions.

Reverse transcription was performed with 4 fold reverse transcriptase (250 mM Tris-HCl, 40 mM MgCl ₂ , 150 mM KCl, 5 mM dithiositol, pH 8.5), 4 μL AMV reverse transcriptase 2.5 U, 2 μL 10 mM dNTP, RNase inhibitor 10 U, downstream primer 25 pmole, and 1 μl of total RNA were added, distilled water was added to make 20 μl of the reaction solution. Then, reverse transcription was carried out at 42 ° C. for 30 minutes, followed by treatment at 95 ° C. for 2 minutes, and then at 4 ° C. Cooled.

PCR was performed by adding 8 μl of 10 times PCR buffer (100 mM Tris-HCl, 15 mM MgCl ₂ , 500 mM KCl, pH 8.3) to 20 μl of the reverse transcription reaction solution, 25 pmole of upstream primer, 2.5 U of Taq DNA polymerase and distilled water. Was added to form a 100 μl reaction solution.

PCR was denatured at 95 ° C. for 2 minutes, followed by a total of 40 times for 45 seconds at 94 ° C., 1 minute at 58 ° C., and 1 minute at 72 ° C. PCR products were analyzed on 1.2% agarose gel.

2. In consideration of the size of the RT-PCR product, the synthesized primers were combined in 17 pairs of upstream and downstream primers in pairs. The 17 combinations were subjected to RT-PCR and total RNA isolated from the crops infected with the Oinbanvanmosavirus virus to select the combination that is effective for the diagnosis of the Oinubanvan Mosaic Virus. The primer combinations selected here are SEQ ID NO: 4/7, SEQ ID NO: 3/7, SEQ ID NO: 3/8, and SEQ ID NO: 2/9 (see Figure 2).

The primary selected primer combinations were subjected to RT-PCR with other viruses occurring in gourd crops, such as cucumber mosaic virus, Curinobvan mosaic virus, watermelon mosaic virus 2, and zucchini sulfide mosaic virus (see FIG. 3). Primer combinations that did not result in were finally selected.

The final primer combination and the size of the PCR product are shown in Table 3.

<Table 3> Primer Combination for Diagnosis of the Final Selected Cucurbita Virus

Combination number Forward primer Reverse primer Reaction Product Size (bp) 6 SEQ ID NO: 4 SEQ ID NO: 7 476 11 SEQ ID NO: 3 SEQ ID NO: 8 447 14 SEQ ID NO: 2 SEQ ID NO: 9 609

According to the present invention, the detection limit is more than 1,000 times higher than that of the diagnostic method using antiserum, and detection of all strains of cucumber nocturnal mosaic virus known to date is possible. In addition, there is no non-specific reaction with other related viruses that occur in gourd crops, which makes it possible to more accurately diagnose the infection of cucumber nocturnal mosaic virus.

1 is a position diagram of cucumber nocturnal mosaic virus primer

Figure 2 is a RT-PCR photograph of the cucumber noban half-mosaic virus according to the primer combination

(Lane 1: 5/6, Lane 2: 4/6, Lane 3: 3/6, Lane 4: 2/6, Lane 5: 1/6, Lane 6: 4/7, Lane 7: 3/7, Lane 8: 2/7, Lane 9: 1/7, Lane 10: 4/8, Lane 11: 3/8, Lane 12: 2/8, Lane 13: 1/8, Lane 14: 2/9, Lane 15: 1/9, Lane 16: 2/10, Lane 17: 1/10)

3 is a RT-PCR photograph of the combination of the first selected primers and the other four viruses that occur in the gourd crops

(Lane 1,6,11,16: CMW, Lane 2,7,12,17: WMV2, Lane 3,8,13,18: ZYMV, Lane 4,9,14,19: CGMMV, Lane 5,10, 15,20: KGMMV)

<110> RURAL DEVELOPMENT ADMINISTRATION <120> Specific Primers for Detection of Cucumber green mottle mosaic virus <160> 10 <170> KopatentIn 1.71 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 1 tgatcttaca aaacacct 18 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 2 atggaacgta ccggaatc 18 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 3 aatcggaggt tggactctgc ttctg 25 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 4 aatccgatca cacctagcaa a 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 5 ctgagtcgct taacgctgta 20 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 6 agaattactg cccataga 18 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 7 taagctttcg aggtggtag 19 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 8 gactctatta aattatctat ctc 23 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 9 aattaagtaa agtcctgacg 20 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 10 tggaggttta gaatgccgct tac 23

Claims (7)

A primer selected from any one of the nucleotide sequences represented by SEQ ID NOs: 2 to 4 and 7 to 9, and complementary nucleotide sequences thereof. delete delete A nucleic acid fragment selected from any one of a nucleotide sequence represented by SEQ ID NOs: 2 to 4 and a complementary nucleotide sequence thereof which reacts species-specificly with the cucumber novan half-molecule virus; In combination with any one of the nucleic acid fragments selected above, a nucleic acid fragment selected from any one of a nucleotide sequence represented by SEQ ID NOS: 7 to 9 and a complementary nucleotide sequence thereof, which is species-specifically reacted with a cucumber noduban mosaic virus. Primer composed. delete delete A method for detecting cucumber novan half-molecule virus from a product obtained by a polymerase chain reaction by using a nucleic acid fragment and a combination selected from claim 1 or 4 as a primer and adding the primer to an unknown virus genome.