KR101293743B1 - Primer set for detecting pathogenic bacteria and pathogenic virus in Cucurbitaceae, and method for detecting pathogens thereof using the same - Google Patents

Abstract

The present invention simultaneously detects leaf spot germs ( Xc ), fruit rot bacteria ( Aac ), cucumber green spot mosaic virus (CGMMV), Curie green spot mosaic virus (KGMMV) and zucchini green spot mosaic virus (ZGMMV) among gourd and crop seed infectious pathogens. Provided are primers and a detection method using the same. The primer set for detecting pathogens of the present invention can simultaneously detect five pathogens from gourds and crop seeds distributed in Korea. Accordingly, the present invention, in the watermelon and crops melon, watermelon, cucumber, pumpkin, melon, by simultaneously detecting the pathogens of the watermelon and crop seeds to check the contamination rate and to select seeds of healthy varieties uncontaminated, the complaints caused by seeds This can be useful for quickly resolving complaints.

Description

Primer set for detecting pathogenic bacteria and pathogenic virus in Cucurbitaceae, and method for detecting pathogens according using the same}

The present invention relates to primer sets, compositions, kits and methods for detecting infectious bacteria and viruses using the same.

There are 825 species of 118 genus plants around the world. The cultivars of watermelons in Korea are watermelon, melons, cucumbers, melons, and pumpkins. These crops are grown throughout the year in greenhouses and grown in farmhouses. It is raising high income. The planting area of gourds and crops has been steadily increasing since 2000, and as they are grown year-round, they are exposed to various pests caused by crop cultivation, resulting in the stable production of crops. In particular, in the case of virus and bacterial diseases that are transmitted as seeds, it is difficult to control and the developed drugs are inadequate. Viruses that cause problems in growing gourds and crops include Cucumber Green Mottle Mosaic Virus (CGMMV), Kyuri Green Mottle Mosaic Virus (KGMMV) and Zucchini Lavender Mosaic Virus (CGMMV), which are transmitted through seeds. Zucchini Green Mottle Mosaic Virus (ZGMMV) has been reported for eight species, including three rod-like viruses, three insect-borne filamentous viruses, and two spherical viruses. In addition, the seeds are spread by germs Leaf jeommunuibyeong bacteria have been reported:: (Aac Acidovorax avenae subsp citrulli .) (Xanthomonas cucurbitae Xc) and fruit rot fungi. These pathogens are a problem from the early stages of growth and, as a result, disrupt the harvest, causing significant economic damage. The best way to control the pathogens spread through these seeds is to grow with only healthy seeds.

Until now, bacteria and virus detection techniques have been reported based on PCR methods for separately detecting bacteria and viruses. Simple-direct tube RT-PCR (SDT / RT-PCR) method using seeds directly for PCR to reduce test time and cost, and IC / RT combining immunological methods to remove sensitivity and to increase sensitivity -PCR (Immunocapture RT-PCR) has been developed and used to detect pathogens. This method is applied to detection of various pathogens in various crops, multiple PCR method for detecting multiple virus and bacterial pathogens at the same time, multiple IC / RT-PCR method and multiple real-time PCR method with improved detection sensitivity. This was developed.

In particular, in the fruit crop seeds, the virion of the direct virus for the simultaneous detection of three gourd crop seed virus pathogens, i.e., nocturnal mosaic mosaic virus (CGMMV), zucchini nocturnal mosaic virus (ZGMMV), and curinobvan mosaic mosaic virus (KGMMV) The VC / RT-PCR (virion captured RT-PCR) method, which is a method for capturing and direct PCR, has been developed (Korean Patent Publication No. 2004-0047336).

However, the methods developed so far have the disadvantage of detecting bacteria and viruses separately, and the multiple IC / RT-PCR method and the multiple real-time-PCR (RT-PCR) method have disadvantages of high test cost.

Therefore, as a result of research to solve the above problems, a multi-RT-PCR method has been developed that can reduce the time and cost while simultaneously detecting bacteria and viruses as the present invention. The developed multi-RT-PCR method was applied to gourd and crop seeds in circulation to confirm its usefulness. It can be used for faster and more accurate diagnosis.

KR 10-2004-47336 A Summary & Claims KR 10-2009-38732 A Summary & Claims

An object of the present invention is to provide a primer set, a composition, and a kit capable of amplifying target sequences of leaf spot pathogens, fruit rot bacteria, cucumber albino mosaic virus, Curie albino mosaic virus, and zucchini albino mosaic virus, which are gourd and plant infectious pathogens. .

It is another object of the present invention to provide a method capable of detecting leaf spot pathogens, fruit rot bacteria, cucumber albino mosaic virus, Curie albino mosaic virus and Zucchini albino mosaic virus which are gourd and plant infectious pathogens.

One embodiment of the invention is a first primer set consisting of oligonucleotides of SEQ ID NOS: 1 and 2, oligonucleotides of SEQ ID NO: 5 and 6, consisting of oligonucleotides of SEQ ID NOs: 3 and 4 Any one or more primers selected from the group consisting of a fourth primer set consisting of a third primer set, oligonucleotides of SEQ ID NOs: 7 and 8, and a fifth primer set consisting of oligonucleotides of SEQ ID NOs: 9 and 10 target sequence: (CGMMV cucumber Green Mottle mosaic virus), leaf jeommunuibyeong bacteria including a set target sequence, cucumber copperas mosaic virus:: (Aac Acidovorax avenae subsp citrulli .) target sequence, fruit rot bacteria (Xanthomonas cucurbitae Xc) , Target Sequence and Zucchini Alveolar Mosaic by Kyuri Green Mottle Mosaic Virus (KGMMV) It provides a primer set for amplifying a target sequence of: (ZGMMV Zucchini Green Mottle Mosaic Virus) bus.

In the present specification, a 'primer' is a nucleic acid sequence having a free 3 'hydroxyl group, which may form a base pair and a base pair of complementary nucleic acids, and a starting point for strand copying of a nucleic acid template. It refers to a nucleic acid sequence that functions from. Primers can initiate DNA synthesis in the presence of different four nucleotide triphosphates and reagents for polymerization with DNA polymerase or reverse transcriptase, at appropriate buffers and temperatures.

The oligonucleotide of SEQ ID NO: 1 is a forward primer capable of specifically binding to the base sequence (SEQ ID NO: 11) of the exon portion of rpoD, which is a gene encoding RNA polymerase, a unique pathogenic expression gene present in Xc . Oligonucleotide of SEQ ID NO: 2 is a reverse primer capable of specifically binding to the base sequence (SEQ ID NO: 11) of the exon portion of rpoD, a gene encoding RNA polymerase, a unique pathogenic expression gene present in Xc .

The oligonucleotide of SEQ ID NO: 3 is a forward primer that can specifically bind to the base sequence (SEQ ID NO: 12) of the exon portion of pilT , a gene encoding ATPase, a unique pathogenic expression gene present in Aac , Oligonucleotide of 4 is a reverse primer capable of specifically binding to the base sequence (SEQ ID NO: 12) of the exon portion of pilT , a gene encoding ATPase, a unique pathogenic expression gene present in Aac .

The oligonucleotide of SEQ ID NO: 5 is a forward primer that can specifically bind to the nucleotide sequence (SEQ ID NO: 13) of a gene encoding an RNA replicaase present in CGMMV , wherein the oligonucleotide of SEQ ID NO: 6 is present in CGMMV It is a reverse primer capable of specifically binding to the nucleotide sequence (SEQ ID NO: 13) of the gene encoding the RNA replicaase.

The oligonucleotide of SEQ ID NO: 7 is a forward primer that can specifically bind to the nucleotide sequence (SEQ ID NO: 14) of the coat protein gene of KGMMV, the oligonucleotide of SEQ ID NO: 8 is a nucleotide sequence of the coat protein gene of KGMMV ( Reverse primer capable of specifically binding to SEQ ID NO: 14).

The oligonucleotide of SEQ ID NO: 9 is a forward primer that can specifically bind to the base sequence (SEQ ID NO: 15) of the envelope protein gene of ZGMMV, the oligonucleotide of SEQ ID NO: 10 is the base sequence of the envelope protein gene of ZGMMV ( Reverse primer capable of specifically binding to SEQ ID NO: 15).

The primer set specifically amplifies only the genes in Xc, Aac, CGMMV , KGMMV or ZGMMV among eight major seed infectious diseases in plants and plants, in particular in the plantation of the plant, such as Xc, Aac, CGMMV , KGMMV or A target sequence capable of determining the presence or absence of ZGMMV can be synthesized.

The foil and the plant there may be included such as watermelon is used as a crop, melon, cucumber, cantaloupe and pumpkin, not limited to this and is applicable to Xc, Aac, CGMMV, every night and plants that can be infected KGMMV or ZGMMV Do.

The first primer set, the second primer set, the third primer set, the fourth primer set, and the fifth primer set may be used alone according to Xc , Aac , CGMMV , KGMMV and ZGMMV detection purposes, and Xc , Aac , CGMMV , KGMMV and ZGMMV can be used together to detect simultaneously.

In addition, one embodiment of the present invention, the first primer set, consisting of oligonucleotides of SEQ ID NO: 1 and 2; A second primer set, consisting of oligonucleotides of SEQ ID NOs: 3 and 4; A third primer set, consisting of oligonucleotides of SEQ ID NOs: 5 and 6; A fourth primer set, consisting of the oligonucleotides of SEQ ID NOs: 7 and 8; And one or more primer sets selected from the group consisting of a fifth primer set consisting of oligonucleotides of SEQ ID NOs: 9 and 10, a target sequence of Xc , a target sequence of Aac , a target sequence of CGMMV, a target sequence of KGMMV, and It provides a composition for amplifying the target sequence of ZGMMV.

In addition, the composition may include a solution for stabilizing and preserving the oligonucleotide and a reagent necessary for amplification.

In addition, one embodiment of the present invention, the first primer set, consisting of oligonucleotides of SEQ ID NO: 1 and 2; A second primer set, consisting of oligonucleotides of SEQ ID NOs: 3 and 4; A third primer set, consisting of oligonucleotides of SEQ ID NOs: 5 and 6; A fourth primer set, consisting of the oligonucleotides of SEQ ID NOs: 7 and 8; And one or more primer sets selected from the group consisting of a fifth primer set consisting of oligonucleotides of SEQ ID NOs: 9 and 10, a target sequence of Xc , a target sequence of Aac , a target sequence of CGMMV, a target sequence of KGMMV, and Provided are kits for amplifying the target sequence of ZGMMV.

In addition, the kit may include a reagent required for nucleic acid amplification and a reagent required for detection in addition to the oligonucleotide.

In addition, an embodiment of the present invention comprises the steps of amplifying a target sequence using a primer set consisting of oligonucleotides of SEQ ID NOs: 1 to 10 as a template with DNA derived from gourd and plant; And on the basis of the presence or absence of the amplification product, the foil and the plant in the Xc, Aac, CGMMV, KGMMV and Xc, Aac of, foil and the plant comprising the step of determining a selected one or more of the presence or absence from the group consisting of ZGMMV, Provided are methods for determining the presence or absence of one or more selected from the group consisting of CGMMV, KGMMV, and ZGMMV.

The present invention uses a DNA derived from a gourd and a plant as a template, a first primer set composed of oligonucleotides of SEQ ID NOs: 1 and 2, a second primer set composed of oligonucleotides of SEQ ID NOs: 3, 4, and a sequence. From a group consisting of a third primer set consisting of oligonucleotides of numbers 5 and 6, a fourth primer set consisting of oligonucleotides of SEQ ID NOs: 7 and 8 and a fifth primer set consisting of oligonucleotides of SEQ ID NOs: 9 and 10 Amplifying using any one selected primer set.

The DNA derived from the gourd and plant means not only gDNA isolated from the gourd and the plant, but also all kinds of DNA obtainable from the plant, such as cDNA obtained from the RNA isolated from the gourd and the plant.

The amplification may be a polymerase chain reaction (PCR) using a polymerase chain enzyme, for example, RT-PCR using a cDNA. In addition, there may be multiple RT-PCR to determine the presence of various genes in a single PCR.

The step of determining the presence or absence of at least one selected from the group consisting of Xc , Aac , CGMMV, KGMMV and ZGMMV in the gourd and plant is based on the presence of the amplification product by the primer set.

When performing multiple RT-PCR with the primer, it is possible to detect Xc , Aac , CGMMV, KGMMV or ZGMMV with one RT-PCR. RT-PCR is a method introduced to analyze RNA by P. Seeburg (Cold Spring Harb Symp Quant Biol 1986, Pt 1: 669-677), and cDNA obtained by reverse transcription of mRNA is amplified and analyzed by PCR. In this amplification step, a pair of primers prepared specifically to identify Xc , Aac , CGMMV, KGMMV or ZGMMV are used. Multiple RT-PCRs amplify several fragments simultaneously using multiple primers rather than one primer. PCR method to make. By confirming the band pattern by electrophoresis after multiple RT-PCR, it is easy to diagnose whether Xc , Aac , CGMMV, KGMMV or ZGMMV infection.

In the presence of Xc, the amplification product of the target sequence amplified by the primers of SEQ ID NOS: 1 and 2 may be 628 bp (hereinafter also referred to as X band). In the presence of Aac, the amplification product of the target sequence amplified by the primers of SEQ ID NOs: 3 and 4 may be 241 bp (hereinafter also referred to as A band). CGMMV When present, the amplification product of the target sequence amplified by the primers of SEQ ID NOs: 5 and 6 may be 723 bp (hereinafter also referred to as C band). The amplification product of the target sequence amplified by the primers of SEQ ID NOs: 7 and 8 in the presence of KGMMV may be 510 bp (hereinafter also referred to as K band). In addition, the amplification product of the target sequence amplified by the primers of SEQ ID NOs: 9 and 10 in the presence of ZGMMV may be 434bp (hereinafter also referred to as Z band).

Therefore, when the X band appears, it is determined that Xc is infected with gourd and plants, when A band appears, it is determined that Aac is infected with gourd and plants, and when C band appears, CGMMV is infected with gourd and plants. When it is determined that the K-band appears, it is determined that KGMMV is infected with the gourd and plants, and when the Z-band appears, it can be determined that ZGMMV is infected with the gourd and plants. In addition, when five bands appear at the same time, Xc , Aac , CGMMV, KGMMV or ZGMMV can be determined as the infected plants and plants (see FIGS. 3 to 7).

In order to obtain DNA derived from the gourd and the plant, RNA may be extracted from the plant and synthesized using cDNA using a random primer and a reverse transcriptase.

In the amplification, the annealing temperature may be 59 ° C to 62 ° C, more preferably 60 ° C.

The watermelon and plants may include, but are not limited to, watermelons, melons, cucumbers, melons, pumpkins, and pumpkins used as crops, and may be applied to all watermelons and plants in which Xc , Aac , CGMMV, KGMMV, or ZGMMV may be infected with seeds. Applicable

RNA samples can also be obtained from gourds and plants, preferably from seeds of plants infected with Xc , Aac , CGMMV, KGMMV or ZGMMV.

Since the primer set of the present invention can be amplified by only 1 ng of pathogen RNA, the sensitivity is very high, and because it does not interact with other pathogens, the specificity is also high. It was found to be very useful (see FIG. 2).

The target sequence according to the present invention and a primer set for amplifying the same, and a detection method using the same are 100 kinds of seeds and crops (27 pumpkins, 18 watermelons, 14 cucumbers, 22 melons, 19 melons) distributed in Korea. With respect to seed infectious diseases Xc, Aac, CGMMV , KGMMV and ZGMMV can be used to specifically detect simultaneously. Therefore, it can be used to test the integrity of the seed and analysis of infection rate of seed infectious pathogens, and to quickly resolve the cause of the dispute in case of complaints related to the integrity of the seed. In addition, it is possible to spread healthy seeds to farmers and contribute to income improvement through the practical use of the detector method for the detection of gourd and crop seed infectious diseases using molecular biological technology.

)와 단일 병원균을 검출한 결과(↙)이다.
도 4는 수박 18품종 종자로부터 RNA를 추출한 후 PCR을 수행하여 동시에 병원균을 검출한 결과(

)와 단일 병원균을 검출한 결과(↙)이다.
도 5는 오이 14품종 종자로부터 RNA를 추출한 후 PCR을 수행하여 동시에 병원균을 검출한 결과(

)와 단일 병원균을 검출한 결과(↙)이다.
도 6은 호박 27품종 종자로부터 RNA를 추출한 후 PCR을 수행하여 동시에 병원균을 검출한 결과(

)와 단일 병원균을 검출한 결과(↙)이다.
도 7은 참외 19품종 종자로부터 RNA를 추출한 후 PCR을 수행하여 동시에 병원균을 검출한 결과(

)와 단일 병원균을 검출한 결과(↙)이다.1 is a target sequence of the present invention Xc-F and Xc-R, Aac-F and Aac-R, CGMMV-F and CGMMV-R, KGMMV-F and KGMMV-R in 12 seed infectious diseases, PCR amplification using ZGMMV-F and ZGMMV-R followed by electrophoresis.
Figure 2 is extracted from RNA and gourd seeds infectious bacteria Xc , Aac , CGMMV, KGMMV and ZGMMV to measure the concentration, diluting 10-fold dilution method was carried out by PCR for each concentration and then measured the detection sensitivity by electrophoresis.
3 is a result of detecting the pathogens by performing RNA after extracting RNA from the melon 22 varieties seeds (

) And the detection of a single pathogen ( ↙ ).
4 is a result of detecting the pathogens by performing PCR after extracting RNA from the seed of 18 varieties of watermelon (

) And the detection of a single pathogen ( ↙ ).
5 is a result of detecting the pathogen by PCR after extracting RNA from the 14 varieties of cucumber seeds (

) And the detection of a single pathogen ( ↙ ).
6 is a result of detecting the pathogens at the same time by performing RNA after extracting RNA from 27 varieties of pumpkin seeds (

) And the detection of a single pathogen ( ↙ ).
7 is a result of detecting the pathogen by PCR after extracting RNA from the 19 varieties of melon seeds (

) And the detection of a single pathogen ( ↙ ).

Hereinafter, the method for simultaneous detection of seed infectious pathogens of gourds and crops of the present invention will be described in detail.

< Example  1> Test virus and bacteria

Bacteria Xc , Aac , CGMMV , Xcc and Pst were distributed from RDA Gene bank and viruses LMV, MNSV, SqMV, CGMMV, KGMMV, KGMMV and ZGMMV Virus infection strains were distributed at the RDA NAAS and Xc , Aac and ZGMMV were purchased from Agdia, USA (Table 1). And each pathogen was stored in -80 ℃ cryogenic freezer and used for the experiment.

Types of Pathogens and Where to Buy Pathogen Sales Agency and Purchasing Company Xanthomonas campestris pv. campestris KACC10377
( Xcc KACC10377) RDA Genebank Xanthomonas campestris pv. vesicatoria KACC11157
(Xc KACC11157) RDA Genebank Clavibacter michiganensis subsp. michiganensis KACC20779 (CGMMV KACC20779) RDA Genebank Erwinia carotovora subsp. carotovora KACC13966
( Aac KACC13966) RDA Genebank Pseudomonas syringae pv. tomato KACC10560
( Pst KACC10560) RDA Genebank Xanthomonas cucurbitae ATCC23378
( Xc ATCC23378) Agdia ^® USA Acidovorax avenae subsp. citrulli ATCC29625
( Aac ATCC29625) Agdia ^? USA Lettuce Mosaic Virus 53 (LMV 53) RDA NAAS Pepper Mild Motle Virus PAP1 (KGMMV PAP1) RDA NAAS Tobacco Mild Green Mosaic Virus-Kr PV-0429
(ZGMMV-Kr PV-0429) RDA NAAS Cucumber Green Mottle Mosaic Virus CO8004
(CGMMV CO8004) RDA NAAS Kyuri Green Mottle Mosaic Virus-C1 PV-0002
(KGMMV-C1 PV-0002) RDA NAAS Melon Necrotic Spot Virus 60 (MNSV 60) RDA NAAS Squash Mosaic Virus S23 (SqMV S23) RDA NAAS Zucchini Green Mottle Mosaic Virus (ZGMMV) Agdia ^? USA

< Example  2> Pathogen detection specific primer  making

Five sets of primers for detecting seed transmission viruses (three species) and bacteria (two species) occurring in gourds and crops were prepared (Table 2). Primer preparation program was used as a primer-blast ( http://www.ncbi.nlm.nih.gov/tools/primer-blast/ ) available from the NCBI homepage. Each primer selected a combination that can be used for multiple RT-PCR without the interference between primers when the five bacteria and viruses are diagnosed at the same time.

Pathogen detection primer  set Detection pathogens Primer name Gene sequence (5'-3 ') Amplification
size( bp ) Xc Xc-F (SEQ ID NO: 1) CGGAGCAGATCGAAGACATC 628
(SEQ ID NO: 11) Xc-R (SEQ ID NO: 2) CCGTTCTTGGCATACACCTT Aac Aac-F (SEQ ID NO: 3) CAAGGGTTTTTCGTGGACAT 241
(SEQ ID NO: 12) Aac-R (SEQ ID NO: 4) CCTCGATCTCGAAGGAGAAG CGMMV CGMMV-F (SEQ ID NO: 5) TTCATGGTTAAGCGTGTGGA 723
(SEQ ID NO: 13) CGMMV-R (SEQ ID NO: 6) GGAAGCGAGCAACTCAGAGA KGMMV KGMMV-F (SEQ ID NO: 7) GCTGAGAGTTTGTCGGAGGA 510
(SEQ ID NO: 14) KGMMV-R (SEQ ID NO: 8) CACACGAGACCAAAAGCAGA ZGMMV ZGMMV-F (SEQ ID NO: 9) TATTCGTTCGCTTCCTGCTT 434
(SEQ ID NO: 15) ZGMMV-R (SEQ ID NO: 10) CGAGACCAAAAGCAGATTCA

< Example  3> Total RNA  Separation and primer  Specificity check

<3-1> from bacteria and viruses total RNA  extraction

RNA was extracted from bacteria cultured in a Nutrient agar plate and virus infected strains using the NucleoSpin ^® RNA II kit (Macherey-Nagel, Germay). The extracted RNA was quantified using Qubit ^® fluorometer (Invitrogen, USA).

<3-2> produced Primer PCR  Establish condition

100 ng of the extracted RNA was quantified and diluted to 10, 1, 0.1 and ng, respectively, by 10-fold dilution, and used for PCR sensitivity test. Primer specificity was confirmed after multiple RT-PCR.

Multiple RT-PCR performance was performed using a specifically synthesized primer set (Table 2) and slightly modified conditions of RobusT ^™ I RT-PCR kit (Finnzymes, Filand). PCR conditions for the specificity assay used 2 μl of template RNA in 50 μl of RNA extracted from each pathogen using an extraction kit. 1 μl 5 ', 3'-primer (10 μM), 5 μl 10x buffer, 1 μl dNTP mixture (2.5 mM), 2.5 μl MgCl ₂ (50 mM), 1 μl avian myoblastosis virus (AMV) RT Taq polymerase, 2 μl DNA Taq polymerase and DEPC DW (diethyl pyrocarbonate distilled water) were added to adjust the total volume to 50 μl. PCR temperature conditions were set annealing temperature (50 ℃, 53 ℃, 55 ℃, 58 ℃, and 60 ℃) subjected to reverse transcription reaction at 42 ℃ for 60 minutes, denatured 94 ℃ 2 minutes, and then at 30 ℃ 94 Forty seconds were repeated for 30 seconds at annealing temperature and 1 minute at 72 ° C., followed by reaction at 72 ° C. for 10 minutes. After the PCR reaction, the reaction product was mixed with 6x LoddingSTAR (DYNE bio, Korea) staining reagent and 10 μl was used for electrophoresis.

<3-3> produced multiple RT - PCR of primer  Confirm specificity and detection sensitivity

Xc and Aac represent the sequences of the exon portions of rpoD and pilT , the unique pathogenic factor expression genes, CGMMV represents the sequences of RNA replicaase genes, and KGMMV and ZGMMV represent the sequences of the envelope protein genes. The primer was synthesized in consideration of the size of the amplification products so as to search by using the homepage and the amplification products can be distinguished with a certain size (Table 2).

Using the synthesized primers, RNAs of Xc , Aac , CGMMV, KGMMV and ZGMMV, which are bacillus and crop seed infectious pathogens, were extracted from the pathogens listed in Table 1, and the annealing temperature was 50 ° C and 53 based on the primer sequences of Table 2. It set to ° C, 55 ° C, 58 ° C, and 60 ° C, respectively. In the same amount of RNA extracted from various viruses and bacteria, RT-PCR was carried out with the primer set (Table 2) synthesized in the mixed sample. When the annealing temperature was set to 50 ° C., Xc was not amplified and 55 ° C. Aac and CGMMV were not amplified at, and KGMMV and ZGMMV were not amplified at 58 ° C., respectively. In addition, the amplification products were confirmed to bind and amplify non-specifically at the annealing temperature of 50 ℃, 53 ℃, and 55 ℃ conditions. The reason why the non-specific amplification product was made is because the annealing temperature is low, and it is considered that the primer was amplified by nonspecific binding to a portion other than the target gene portion during the annealing process. On the other hand, after the annealing temperature was carried out at 60 ℃, PCR amplification products were isolated and purified by NucleoSpin ^® Extract II kit (Macherey-Nagel, Germay) and electrophoresis, it was confirmed that all pathogens are specifically amplified. In addition, after performing multiple RT-PCR with annealing temperature set to 60 ° C, the amplification products were separated, purified, and electrophoresed, and the cDNAs of the pathogens produced at each primer and reverse transcription were PCR-free without mutual interference. As a result, each target sequence was amplified (FIG. 1).

In addition, when electrophoresis was performed for 90 minutes at 110 volts at 5% agarose gel concentration, amplification products were clearly distinguished by size.

From these results, the optimal annealing temperature for performing multiple RT-PCR was determined at 60 ° C, and RT-PCR was performed with a sample diluted from 100 ng to 0.1 ng of RNA extracted from each pathogen by using a 10-fold dilution method. As a result, PCR amplification products could be confirmed up to 1 ng (FIG. 2). Therefore, the pathogen detection minimum sensitivity was determined to be 1 ng.

< Experimental Example  1> Night crop  Pathogen detection from seeds

<1-1> Seed Extraction From buffer RNA  extraction

Extraction buffer for detecting pathogens in seeds was mixed with 286.5 g of Guanidine-hydrochlorid, 25 ml of 4 M NaAC buffer (pH 5.2), 4.65 g of EDTA, and 12.50 g of PVP-10. Melted well. 30 ~ 50 grain samples were put in a zipper bag and seeded well by a pestle. After adding 30 ml of extraction buffer to the crushed sample, it was left to stand at room temperature for 1 hour. After 1 hour, 0.3 ml of the supernatant was centrifuged at 13,000 rpm and used for RNA extraction. RNA extraction was performed using the NucleoSpin ^® Plant kit (Macherey-Nagel, Germany).

<1-2> multiple RT - PCR  Condition

Multiple RT-PCR performance was performed by slightly modifying the conditions of the specifically synthesized primer set (Table 2) and the RobusT ^™ I RT-PCR kit (Finnzymes, Filand). It was performed by dividing into two PCR conditions for assay and PCR conditions for detecting pathogens in seeds. PCR conditions for assaying the specificity of the primers were 2 μl of template RNA in 50 μl of RNA extracted from each pathogen using an extraction kit, while PCR conditions for detection of pathogens in seeds were 5 μl in 50 μl of extracted RNA. Was used. The remaining PCR reaction solution conditions were performed under the same conditions as follows.

1 μl 5 ', 3'-primer (10 μM), 5 μl 10x buffer, 1 μl dNTP mixture (2.5 mM), 2.5 μl MgCl ₂ (50 mM), 1 μl AMV RT Taq polymerase, 2 The total volume was adjusted to 50 μl by the addition of μl DNA Taq polymerase and DEPC DW. PCR temperature conditions were set the annealing temperature to 50 ℃, 53 ℃, 55 ℃, 58 ℃, and 60 ℃, the reverse transcription reaction at 42 ℃ 60 minutes, denatured at 94 ℃ 2 minutes, 30 seconds at 94 ℃, After repeating 40 times in a process of 1 minute at 30 seconds and 72 ℃ at the annealing temperature, and finally reacted for 10 minutes at 72 ℃. After the PCR reaction, the reaction product was mixed with 6x Lodding STAR (DYNE bio, Korea) staining reagent and 10 μl was used for electrophoresis.

It is preferable to use PCR for amplifying the pathogen gene of the present invention. Methods for performing general PCR are well known in the art. Specifically, the PCR reaction can be carried out using a PCR reaction solution containing various components known to be necessary for the PCR reaction in the art. The PCR reaction solution includes genomic DNA derived from the seed to be analyzed, the primer set of the present invention, an appropriate amount of DNA polymerase (eg, Taq polymerase), a dNTP mixture, a PCR buffer and water. . The PCR buffer contains KCl, Tris-HCl and MgCl ₂ .

In the present invention, the amplified product is confirmed by electrophoresis, and the gel used during electrophoresis may be a gel which can be used in electrophoresis, and agarose gel may be used as a representative example.

<1-3> Produced from the gourd and seeds in circulation Primer  Pathogen detection using

The developed PCR detection method was applied to the seed samples of watermelon and crop melon (22 varieties), watermelon (18 varieties), cucumbers (14 varieties), pumpkins (27 varieties) and melon (19 varieties), which are actually produced and sold. It was. In the case of the coated seed, the coating material may inhibit the PCR reaction, so that the seed was washed well with sterile distilled water, dried for one day, and then extracted using RNA extraction. In 22 melon seed samples, pathogens were detected in 21 cultivars except for one cultivar when compared to the size of amplified fragments of positive control pathogens. Two or more pathogens were simultaneously detected in 12 varieties and a single pathogen was detected in 9 varieties (FIG. 3). To verify that the amplified DNA is identical to the control pathogen, the amplified fragments were extracted from randomly selected samples 1, 8 and 15 using the NucleoSpin ^® ExtractII kit (Macherey-Nagel, Germay). The base sequence was analyzed by request. NCBI Blast homology examination of the nucleotide sequence analysis using the program results In 1 sample showed a base sequence with homology of 100% of Xc and Aac pathogens in the control group in the control group In one five samples of the base sequence and 100% of Aac pathogens Homology showed homology of 100% with CGMMV and Xc pathogens of control group in sample 15 and confirmed that the detected pathogens were pathogens of control group. Therefore, it was confirmed that the developed RT-PCR method successfully performed RT-PCR without interfering with the cDNA of the seed to specifically detect the pathogen of the control group.

As a result of detecting pathogens using 18 watermelon varieties, two or more pathogens were simultaneously detected in two varieties and a single pathogen was detected in six varieties (FIG. 4). Similar results three times the sample by analyzing the genes examined for homology of the amplified fragment was confirmed that show homology Aac and 100% was detected Aac specifically times 17 samples of KGMMV and ZGMMV 100% Homology showed that the pathogen was specifically detected at the same time.

In the PCR detection results using 14 cucumber varieties, two or more pathogens were simultaneously detected in three varieties and a single pathogen was detected in three varieties (FIG. 5). The resulting sample twice irradiated with homology to analyze the gene fragment amplified similarly had confirmed that show homology Aac and 100% was detected Aac specifically times 14 samples of KGMMV and Aac and 100% Homology showed that the pathogen was specifically detected at the same time.

As a result of PCR detection using 27 pumpkin varieties of seed samples in the same method, two or more pathogens were simultaneously detected in seven varieties and a single pathogen was detected in seven varieties (FIG. 6). Similar results once the sample by analyzing the genes examined for homology of the amplified fragment was confirmed that show homology Aac and 100% was detected Aac specifically times 20 samples of KGMMV and Aac and 100% Homology showed that the pathogen was specifically detected at the same time.

Finally, in the PCR detection results using 19 melon varieties seed samples, two or more pathogens were simultaneously detected in four varieties and a single pathogen was detected in ten varieties (FIG. 7). Similarly, the analysis of the genes of the amplified fragments revealed that homologous sample 10 was 100% homologous to KGMMV, indicating that KGMMV was specifically detected. Homology showed that the pathogen was specifically detected at the same time.

Pathogen detection results were detected in 21 of 22 melon varieties, 8 of 18 watermelon varieties, 6 of 14 cucumber varieties, and 15 of 27 pumpkin varieties. Among the 19 varieties, 14 varieties showed pathogen detection results. The infection rates of seed infectious pathogens of each crop were 95%, 44%, 43%, 56% and 74%, respectively. Existing multiple PCR methods are developed by bacteria and viruses, respectively, and the PCR is performed separately to detect bacteria and viruses, which requires a lot of time and money.However, if the multiple PCR method developed in this experiment is applied, bacteria and viruses are used. Simultaneous detection will allow for efficient detection of seed infection pathogens, saving time and money.

Attach an electronic file to a sequence list

Claims (12)

First primer set, consisting of oligonucleotides of SEQ ID NOs: 1 and 2
Second primer set, consisting of oligonucleotides of SEQ ID NOs: 3 and 4
Third primer set, consisting of oligonucleotides of SEQ ID NOs: 5 and 6
A fourth primer set consisting of the oligonucleotides of SEQ ID NOs: 7 and 8 and
Target sequence, fruit rot fungus of: (Xc Xanthomonas cucurbitae) (Acidovorax avenae subsp citrulli SEQ ID NO: 9 and 10 oligonucleotide, leaf jeommunuibyeong bacteria containing all the primer sets of the group consisting of the fifth primer sets, consisting of the nucleotides of: Target sequence of Aac ), target sequence of Cucumber Green Mottle Mosaic Virus (CGMMV), target sequence of Kyuri Green Mottle Mosaic Virus (KGMMV) and Zucchini Green Mottle Mosaic Virus : Primer set for amplifying the target sequence of ZGMMV). First primer set, consisting of oligonucleotides of SEQ ID NOs: 1 and 2
Second primer set, consisting of oligonucleotides of SEQ ID NOs: 3 and 4
Third primer set, consisting of oligonucleotides of SEQ ID NOs: 5 and 6
A fourth primer set consisting of the oligonucleotides of SEQ ID NOs: 7 and 8 and
Target sequence of leaf spot bacterium ( Xc ), target sequence of fruit rot bacterium ( Aac ), cucumber green plate mosaic, including all primer sets of the group consisting of the fifth primer set consisting of oligonucleotides of SEQ ID NOs: 9 and 10 A composition for amplifying a target sequence of a virus (CGMMV), a target sequence of Curie Alveolar Mosaic Virus (KGMMV) and a target sequence of Zucchini Alveolar Mosaic Virus (ZGMMV). First primer set, consisting of oligonucleotides of SEQ ID NOs: 1 and 2
Second primer set, consisting of oligonucleotides of SEQ ID NOs: 3 and 4
Third primer set, consisting of oligonucleotides of SEQ ID NOs: 5 and 6
A fourth primer set consisting of the oligonucleotides of SEQ ID NOs: 7 and 8 and
Target sequence of leaf spot bacterium ( Xc ), target sequence of fruit rot bacterium ( Aac ), cucumber green plate mosaic, including all primer sets of the group consisting of the fifth primer set consisting of oligonucleotides of SEQ ID NOs: 9 and 10 Kit for amplifying the target sequence of the virus (CGMMV), the target sequence of Curie Alveolar Mosaic Virus (KGMMV) and the target sequence of Zucchini Alveolar Mosaic Virus (ZGMMV). delete delete Amplifying a target sequence using a DNA derived from gourd and crop as a template and using the primer set of claim 1 as a primer; And
On the basis of the presence or absence of the amplification product, during the night and crops Xc, Aac, CGMMV, KGMMV and wherein foil and a plant including the step of determining a selected one or more of the presence or absence from the group consisting of ZGMMV Xc, Aac, CGMMV , KGMMV and ZGMMV. A method for determining the presence or absence of one or more selected from the group consisting of. 7. The method of claim 6, wherein the gourd and crop is one or more selected from the group consisting of pumpkin, watermelon, cucumber, melon, melon. The method of claim 6, wherein said amplification is polymerase chain reaction (PCR). The method of claim 8, wherein said amplification is RT-PCR. 10. The method of claim 8 or 9, wherein in the amplification, the annealing temperature is 58 ° C to 62 ° C. The method of claim 6, wherein the determining comprises: Xc, Aac , CGMMV, KGMMV corresponding to the one or more target sequences in the plant when one or more target sequences of Xc, Aac , CGMMV, KGMMV, and ZGMMV are amplified. And when at least one of ZGMMV is present and at least one target sequence of Xc, Aac , CGMMV, KGMMV, and ZGMMV is not amplified, Xc, Aac , CGMMV, Determining that at least one of KGMMV and ZGMMV is absent. The method of claim 6, wherein the plant is a seed.

Images