KR101301866B1 - Primer set for detecting pathogenic bacteria and pathogenic virus in Brassicaceae, and method for detecting pathogens thereof using the same - Google Patents

Abstract

The present invention provides a primer capable of simultaneously detecting black rot and lettuce mosaic virus among cruciferous plant seed infectious pathogens and a detection method using the same. The primer set for detecting pathogens of the present invention can simultaneously detect two pathogens in cruciferous plant seeds distributed in Korea. Therefore, the present invention can quickly and accurately simultaneously detect pathogens of cruciferous plant seeds to confirm the contamination rate and to select non-contaminated healthy varieties.

Description

Primer set for detecting pathogenic bacteria and pathogenic virus in Brassicaceae, and method for detecting pathogens about using the same}

The present invention relates to primer sets, compositions, kits and methods for detecting infectious bacteria and viruses using the same.

Cruciferous crops mainly cultivated in Korea include radish, Chinese cabbage, lettuce, cabbage and turnip. The main seed infectious diseases of cruciferous crop are Xanthomonas Campestris pv. Campestris ( Xanthomonas) campestris pv. campestris Xcc ) and the Lettuce Mosaic Virus (LMV). Xcc , a black rot-causing bacterium, is widespread in cruciferous crops worldwide, causing significant damage every year. The disease occurs in humid conditions and occurs throughout the crop's growing season, mainly damaging the crop's ground. Turnips or radishes may also cause dry rot symptoms by violating fleshy roots. A common symptom on the pavement is a large V-shaped retirement at the edge of the leaf, and as the disease progresses the leaf veins turn black and later turn brown. Young crops germinated from seeds are dwarfed and withered. LMV, a filamentous single-stranded RNA virus belonging to the family Portyviridae, is also widespread in cruciferous crops around the world. Dropping causes economic damage to farms like Xcc . Most of the pathogens are transmitted by seeds. After infection, bacteria are present in cell gaps, and viruses are present in the nucleus of cells, making it difficult to control or treat diseases by chemical methods.

Therefore, it is possible to check the presence or absence of pathogen infection of seeds through the detection of pathogens from the seed state, and to disseminate only sterile seeds to prevent disease occurrence. Various methods have been tried and reported for detecting such pathogens. Commonly used selective culture medium to detect bacteria and enzyme-linked immunosorbent assay (ELISA) are used to detect viruses. However, such a detection method consumes a lot of test time and decreases the detection sensitivity, making it difficult to obtain reliable test results. As an alternative to these methods, PCR methods have been developed to amplify only specific genes of pathogens to visually detect the presence or absence of pathogens, and various modified PCR methods have been developed and used to increase detection sensitivity based on PCR methods.

Genetic diagnostic techniques developed so far have been reported to detect bacteria and viruses separately based on PCR methods, and SDT / RT-PCR (simple-direct tube RT-PCR) using seeds directly for PCR to reduce time and cost. PCR (Immunocapture RT-PCR), which combines immunological methods to remove PCR inhibitors and enhance sensitivity, has been developed and used for pathogen detection. This method is applied to the detection of various pathogens, and the multi-PCR method for detecting several virus and bacterial pathogens at the same time, the multi-IC / RT-PCR method with improved detection sensitivity, and the multi-real-time PCR (RT-PCR) Methods have been developed for several crops.

In particular, Cucumber Green Mottle Mosaic Virus (CGMMV), Zucchini green mottle mosaic virus (ZGMMV), and Kyuri green mottle mosaic virus (KGMMV) The same pathogen detection method has developed a VC / RT-PCR (virion captured RT-PCR) method that directly captures the virion of a virus and uses it for PCR, reducing the time and cost and increasing the detection sensitivity (Korean Patent Publication No. 10-2004). -0047336).

However, the developed methods up to now have the disadvantage of detecting different bacteria and viruses separately for bacteria and viruses, and the multiple IC / RT-PCR and multiple real-time PCR methods are expensive. It has a lot of disadvantages.

Therefore, as a result of the study to solve the above problems, a multi-RT-PCR method has been developed that can reduce the time and cost while simultaneously detecting bacteria and viruses. The developed multi-RT-PCR method has been applied to cruciferous plant seeds in circulation, which can be used for screening infectious pathogens, analyzing the infection rate of pneumococcal seeds related to health, and for quicker and more accurate diagnosis in agricultural fields. .

An object of the present invention is to develop an xanthomonas campestris pv. Provided are primer sets, compositions, and kits that can simultaneously amplify target sequences capable of detecting Campestris and lettuce mosaic viruses.

Another object of the present invention is xanthomonas campestris pv. Provided are methods for detecting Campestris and Lettuce Mosaic Virus.

One embodiment of the present invention comprises a first primer set consisting of oligonucleotides of SEQ ID NO: 1 and 2; And a second primer set selected from the group consisting of a second primer set consisting of oligonucleotides of SEQ ID NOs: 3 and 4. Xanthomonas campestris pv. Campestris ( Xanthomonas) campestris pv . A primer set for amplifying the target sequence of campestris ( Xcc ) and the target sequence of Lettuce Mosaic Virus (LMV) is provided.

In the present specification, a 'primer' is a nucleic acid sequence having a free 3 'hydroxyl group, which may form a base pair and a base pair of complementary nucleic acids, and a starting point for strand copying of a nucleic acid template. It refers to a nucleic acid sequence that functions from. Primers can initiate DNA synthesis in the presence of different four nucleotide triphosphates and reagents for polymerization with DNA polymerase or reverse transcriptase, at appropriate buffers and temperatures.

The oligonucleotide of SEQ ID NO: 1 is a forward primer capable of specifically binding to the base sequence (SEQ ID NO: 5) of the exon portion of HrpF, which is a pathogenic factor expression gene of Xcc , wherein the oligonucleotide of SEQ ID NO: 2 It is a reverse primer capable of specifically binding to the exon of HrpF , a pathogenic factor expression gene of Xcc .

The oligonucleotide of SEQ ID NO: 3 is a forward primer that can specifically bind to the envelope protein gene (SEQ ID NO: 6) of the LMV, the oligonucleotide of SEQ ID NO: 4 can specifically bind to the envelope protein gene of the LMV That is the reverse primer.

The primer set specifically amplifies some genes of Xcc and LMV among 12 major seed infectious diseases (Table 1), which are a problem in cruciferous plants, especially cruciferous crops, and can determine the presence of Xcc and LMV. Target sequences can be synthesized.

The cruciferous plants may include radish, cabbage, lettuce, cabbage, rapeseed, gat, turnip, and kohlrabi, which are used as crops, but are not limited thereto, and as cruciferous plants, all plants to which Xcc and LMV can be infected. Applicable to

The first primer set and the second primer set may be used alone according to Xcc and LMV detection purposes, and may be used together to simultaneously detect Xcc and LMV.

In addition, one embodiment of the present invention, the first primer set, consisting of oligonucleotides of SEQ ID NO: 1 and 2; And it provides a composition for amplifying the target sequence of LMV and the target sequence of Xcc comprising any one primer set selected from the group consisting of oligonucleotides of SEQ ID NO: 3 and 4, the second primer set.

In addition, the composition may include a solution for stabilizing and preserving the oligonucleotide and a reagent necessary for amplification.

In addition, one embodiment of the present invention, the first primer set, consisting of oligonucleotides of SEQ ID NO: 1 and 2; And it provides a primer kit for amplifying the target sequence of LMV and the target sequence of Xcc comprising any one primer set selected from the group consisting of oligonucleotides of SEQ ID NO: 3 and 4, the second primer set.

In addition, the kit may include a reagent required for nucleic acid amplification and a reagent required for detection in addition to the oligonucleotide.

In addition, one embodiment of the present invention comprises the steps of amplifying a target sequence using a primer set consisting of oligonucleotides of SEQ ID NOS: 1 to 4 as a template using DNA derived from a cruciferous plant; And provides a method for determining on the basis of the presence or absence of the amplification product, wherein the cruciferous present Xcc and at least one of Xcc and LMV of one, cruciferous plants, which comprises determining one or more presence LMV in the plant.

The present invention is any one selected from the group consisting of a first primer set consisting of oligonucleotides of SEQ ID NOs: 1 and 2, and a primer set consisting of oligonucleotides of SEQ ID NOs: 3 and 4, using DNA derived from a cruciferous plant as a template. Amplifying using a primer set of.

The DNA derived from the cruciferous plants means all kinds of DNAs obtained from plants such as gDNA isolated from cruciferous plants and cDNA obtained from RNA isolated from cruciferous plants.

The amplification may be a polymerase chain reaction (PCR) using a polymerase chain enzyme, for example, RT-PCR using a cDNA. In addition, it may be multiple RT-PCR to determine the presence of various genes in a single PCR.

Determining the presence of one or more of Xcc and LMV in cruciferous plants is based on the presence of amplification products by primer sets.

When multiple RT-PCRs are performed with the above primers, Xcc and LMV can be detected by one RT-PCR. RT-PCR is a method introduced to analyze RNA by P. Seeburg (Cold Spring Harb Symp Quant Biol 1986, Pt 1: 669-677), and cDNA obtained by reverse transcription of mRNA is amplified and analyzed by PCR. At this time, in the amplification step, a pair of primers prepared specifically to identify Xcc or LMV is used. Multiple RT-PCR refers to a PCR method of simultaneously amplifying several fragments using multiple primers instead of one primer. By checking the band pattern by electrophoresis after multiple RT-PCR, it is possible to easily diagnose the presence of Xcc or LMV.

Xcc When present, the amplification product of the target sequence amplified by the primers of SEQ ID NOS: 1 and 2 may be 617 bp (hereinafter also referred to as X band). In addition, the amplification product of the target sequence amplified by the primers of SEQ ID NOS: 3 and 4 in the presence of LMV may be 298bp (hereinafter also referred to as L band).

Therefore, when the X band appears as a result of the amplification, it can be determined that Xcc is infected with the cruciferous plant, and it can be determined that LMV is infected with the cruciferous plant when the L band appears. In addition, when both bands appear at the same time, it can be determined that the cruciferous plants infected with Xcc and LMV at the same time (see Figs. 1 to 5).

In order to obtain the DNA derived from the cruciferous plant, RNA may be extracted from the plant, and the cDNA may be synthesized using a random primer and a reverse transcriptase.

In the amplification, the annealing temperature may be 53 ° C to 57 ° C, more preferably 55 ° C.

The cruciferous plants may include radish, cabbage, lettuce, cabbage, rapeseed, gat, turnip, and kohlrabi, which are used as crops, but are not limited thereto, and as cruciferous plants, all plants to which Xcc and LMV can be infected. Applicable to

In addition, RNA samples can be obtained from cruciferous plants, preferably from seeds infected with Xcc pathogens and LMV viruses.

Since the primer set of the present invention can be amplified by only 1 ng of pathogen RNA, its sensitivity is very high and its specificity is high because it does not interact with other pathogens, and thus is very useful for diagnosing a very small number of pathogen infections present in the seeds of cruciferous crops. It was confirmed (see FIG. 2).

The target sequence according to the present invention and a primer set for amplifying the same, and a detection method using the same, are used in a variety of 120 varieties of cruciferous plants (10 turnips, 50 lettuce, 20 radish, 20 cabbage, 20 cabbage, 20 varieties) in Korea. It can be used to detect seed infectious diseases Xcc and LMV at the same time. Therefore, it can be useful for promptly resolving the cause of disputes by using soundness test of seed of seed, measurement of seed pollution rate, and inspection result in case of complaints caused by seed dispute between farmer and company. have. In addition, by applying molecular biological technology to detect cruciferous plant seed infectious diseases, it can contribute to income improvement through the dissemination of healthy seeds to farmers.

)이다.
도 4는 무 20품종(A)와 배추 20품종(B) 그리고 양배추 20품종(C)를 이용하여 종자로부터 RNA를 추출한 후 PCR을 수행하여 병원균을 검출한 결과(

)이다.
도 5는 상추 40품종 종자를 이용하여 종자로부터 RNA를 추출한 후 PCR을 수행하여 병원균을 검출한 결과(

)와 두 가지 병원균을 동시에 검출한 결과(

)이다.Figure 1 is a target sequence of the present invention for 12 seed infectious diseases by electrophoresis after PCR amplification using Xcc-NF and Xcc-NR, and LMV-F and LMV-R.
Figure 2 is the RNA extracted from cruciferous seed infectious bacteria Xcc and LMV to measure the concentration, dilution 10-fold dilution method to perform PCR for each concentration and then measured the detection sensitivity by electrophoresis.
3 is a result of detecting the pathogens by PCR after extracting RNA from the seed using 10 varieties of turnip (A) and 10 varieties of lettuce (B).

)to be.
4 is a result of detecting the pathogen by PCR after extracting RNA from the seed using 20 varieties (A) and 20 varieties of Chinese cabbage (B) and 20 varieties of cabbage (C) (

)to be.
5 is a result of detecting the pathogen by PCR after extracting RNA from the seeds using 40 varieties of lettuce (

) And two pathogens at the same time (

)to be.

Hereinafter, the present invention will be described in more detail the simultaneous detection of seed infectious pathogens of cruciferous crops.

Example  One : Test virus and bacteria

The bacteria Xcv , Ecc , Cmm , Xcc , and Pst was distributed and used by RDA Gene bank, and viruses LMV, MNSV, SqMV, CGMMV, KGMMV, PMMoV, and TMGMV were distributed and used by RDA NAAS. (Table 1). And each pathogen was stored in -80 ℃ cryogenic freezer used for the experiment.

Types of Pathogens and Where to Buy Pathogen Sale agency Xanthomonas campestris pv. campestris KACC10377
( Xcc KACC10377) RDA Genebank Xanthomonas campestris pv. vesicatoria KACC11157
( Xcv KACC11157) RDA Genebank Clavibacter michiganensis subsp. michiganensis KACC20779
( Cmm KACC20779) RDA Genebank Erwinia carotovora subsp. carotovora KACC13966
( Ecc KACC13966) RDA Genebank Pseudomonas syringae pv. tomato KACC10560
( Pst KACC10560) RDA Genebank Lettuce Mosaic Virus 53 (LMV 53) RDA NAAS Pepper Mild Motle Virus PAP1 (PMMoV PAP1) RDA NAAS Tobacco Mild Green Mosaic Virus-Kr PV-0429
(TMGMV-Kr PV-0429) RDA NAAS Cucumber Green Mottle Mosaic Virus CO8004
(CGMMV CO8004) RDA NAAS Kyuri Green Mottle Mosaic Virus-C1 PV-0002
(KGMMV-C1 PV-0002) RDA NAAS Melon Necrotic Spot Virus 60
(MNSV 60) RDA NAAS Squash Mosaic Virus S23
(SqMV S23) RDA NAAS

Example  2 : Pathogen detection specific primer  making

Two sets of primers for detecting seed transmission virus (one species) and bacteria (one species) occurring in cruciferous crops were prepared (Table 2). Primer production program was used as a primer-blast ( http://www.ncbi.nlm.nih.gov/tools/primer-blast/ ) available from the NCBI homepage. Each primer selected a combination that can be used for multiple RT-PCR without the interference between primers in the simultaneous diagnosis of two bacteria and viruses.

Pathogen detection primer  set Detection pathogens Primer name Gene sequence (5'-3 ') Amplification  size( bp ) And sequence Xcc Xcc-N-F (SEQ ID NO: 1) CCGTAGCACTTAGTGCAATG 617
(SEQ ID NO: 7) Xcc-N-R (SEQ ID NO: 2) GCATTTCCATCGGTCACGATTG LMV LMV-F (SEQ ID NO: 3) ACAAGAAGAAACCGTATATGCC 298
(SEQ ID NO: 8) LMV-R (SEQ ID NO: 4) GCCAACACACGCCTTTAGTG

Example  3: Total RNA  Separation and primer  Specificity check

(1) from bacteria and viruses total RNA  extraction

RNA extraction from bacterial and cultured virus infected strains cultured in Nutrient agar plates was performed using the NucleoSpin ^® RNA II kit (Macherey-Nagel, Germay). The extracted RNA was quantified using Qubit ^® fluorometer (Invitrogen, USA).

(2) made Primer PCR  Establish condition

100 ng of the extracted RNA was diluted to 100, 10, 1, and 0.1 ng by 10-fold dilution, respectively, and then used for PCR sensitivity test. Primer specificity was confirmed after -PCR.

A specifically synthesized primer set (Table 2) was used. Multiple RT-PCR was performed with slight modifications to the conditions of the RobusT ^™ I RT-PCR kit (Finnzymes, Filand). PCR conditions for the specificity assay used 2 μl of template RNA in 50 μl of RNA extracted from each pathogen using an extraction kit. 1 μl 5 ', 3'-primer (10 μM), 5 μl 10x buffer, 1 μl dNTP mixture (2.5 mM), 2.5 μl MgCl ₂ (50 mM), 1 μl AMV RT Taq polymerase, 2 μl The total volume was adjusted to 50 μl by addition of DNA Taq polymerase and DEPC DW. PCR temperature conditions were set annealing temperature (48 ℃, 50 ℃, 53 ℃, 55 ℃, 58 ℃) and reverse transcription reaction at 42 ℃ 60 minutes and denatured 94 ℃ 2 minutes, then 30 ℃ 94 94 Forty seconds were repeated for 30 seconds at annealing temperature and 1 minute at 72 ° C., and then finally reacted at 72 ° C. for 10 minutes. After the PCR reaction, the reaction product was mixed with 6x LoddingSTAR (DYNE bio, Korea) staining reagent and 10 μl was used for electrophoresis.

(3) manufactured multiple RT - PCR of primer  Confirm specificity and detection sensitivity

The base sequence of the exon portion of hrpF , a unique pathogenic factor expression gene of Xcc , and the LMV case, the base sequence of the envelope protein gene is searched using the NCBI homepage, and the size of the amplification product is considered so that the amplification products can be distinguished by a constant size. Primers were synthesized (Table 2).

Xcc , a cruciferous plant seed infectious pathogen, among the pathogens listed in Table 1 using the synthesized primers And extracting RNA from LMV and setting the annealing temperatures to 48 ° C., 50 ° C., 53 ° C., 55 ° C., and 58 ° C., respectively, based on the primer sequences listed in Table 2. The same amount of RNA extracted from various viruses and bacteria In the mixed sample, the synthesized primer set was put in the result of RT-PCR, and when it was set at 50 ° C, Xcc was not amplified, and at 58 ° C, LMV was not amplified. In addition, the amplification products were confirmed to bind and amplify nonspecifically at the annealing temperature of 48 ℃ and 53 ℃. The reason why the non-specific amplification product was made is that the annealing temperature is low, and it is presumed that the primer was amplified by nonspecific binding to a portion other than the target gene portion during the annealing process. However, after the temperature was increased to 55 ° C and PCR was amplified using NucleoSpin ^® Extract II kit (Macherey-Nagel, Germay), all pathogens were specific after electrophoresis on agarose gel. It was confirmed that the amplification. In addition, after performing multiple RT-PCR with annealing temperature set to 55 ° C, the amplification product was separated and purified, and then the cDNA interaction of pathogens produced at each primer and reverse transcription step was observed even in electrophoresis on agarose gel. PCR was performed without the specific target sequence was amplified specifically (Fig. 1).

In addition, the electrophoresis and agarose gel concentration conditions were performed under various conditions, but the amplification products were clearly distinguished by size when the agarose gel concentration was 1.5% and the result was performed at 110 volts for 90 minutes.

Therefore, as a result of this, the optimum annealing temperature for performing multiple RT-PCR was determined to be 55 ° C. PCR amplification products were confirmed up to 1 ng in the result of RT-PCR with an annealing temperature set at 55 ° C. and RNA extracted from each pathogen was diluted from 100 ng to 0.1 ng using a 10-fold dilution method (FIG. 2). Therefore, the minimum concentration of the pathogen detection limit was determined to be 1 ng.

Example  4 : Crucifixion  Made from seeds Primer  Pathogen detection using

(1) seed extraction From buffer RNA  extraction

Extraction buffer for detecting pathogens in seeds was prepared by mixing 286.5g of Guanidine-hydrochlorid, 25ml of 4M NaAC buffer (pH 5.2), 4.65g of EDTA, and 12.50g of PVP-10. . 1 g of seed samples were placed in a zipper bag and the seeds were crushed well. The crushed seed sample was placed in a 2 ml tube, 1 ml of extraction buffer was added, mixed well, and left for 1 hour. After 1 hour, 0.3 ml of the supernatant was centrifuged at 13,000 rpm and used for RNA extraction. RNA extraction was extracted using the NucleoSpin ^® Plant kit (Macherey-Nagel, Germay).

(2) multiple RT - PCR  Condition

A specifically synthesized primer set (Table 2) was used. Multiple RT-PCR was performed with slight modifications to the conditions of the RobusT ^™ I RT-PCR kit (Finnzymes, Filand). Detailed reaction composition and PCR conditions were used to detect pathogens in PCR and seeds to test for specificity of primers. The PCR conditions were divided into two. PCR conditions for specificity assays were performed using 2 μl of template RNA in 50 μl of RNA extracted from each pathogen using an extraction kit, while PCR conditions for detecting pathogens in seeds were 5 μl in 50 μl of extracted RNA. It was. The remaining PCR reaction solution conditions were performed under the same conditions as follows.

1 μl 5 ', 3'-primer (10 μM), 5 μl 10x buffer, 1 μl dNTP mixture (2.5 mM), 2.5 μl MgCl ₂ (50 mM), 1 μl AMV RT Taq polymerase, 2 μl DNA Taq polymerase and DEPC DW were added to adjust the total volume to 50 μl. PCR temperature conditions were set to 48 ℃, 50 ℃, 53 ℃, 55 ℃, and 58 ℃ annealing temperature was subjected to reverse transcription reaction at 42 ℃ 60 minutes, denatured at 94 ℃ 2 minutes, and then 30 seconds at 94 ℃ After repeating 40 times in a process of 1 minute at 72 ℃, 30 seconds at a temperature, and finally reacted for 10 minutes at 72 ℃. After the PCR reaction, the reaction product was mixed with 6x LoddingSTAR (DYNE bio, Korea) staining reagent and 10 μl was used for electrophoresis.

Amplification of the pathogen gene of the present invention preferably uses a PCR (polymease chain reaction). Methods for performing general PCR are well known in the art. Specifically, the PCR reaction can be carried out using a PCR reaction solution containing various components known to be necessary for the PCR reaction in the art. The PCR reaction solution contains genomic DNA derived from the cabbage to be analyzed, the primer set of the present invention, an appropriate amount of DNA polymerase (eg, Taq polymerase), a dNTP mixture, a PCR buffer and water. . The PCR buffer contains KCl, Tris-HCl and MgCl ₂ .

The amplified product in the present invention is confirmed by electrophoresis. In the present invention, the gel used during electrophoresis may be a gel that can be used in electrophoresis, and agarose gel may be used as a representative example.

(3) production and sale Crucifixion  Made from seeds Primer  Pathogen detection using

The developed PCR detection method is applied to the turnip (10 varieties), lettuce (50 varieties), radish (20 varieties), cabbage (20 varieties) and cabbage (20 varieties) seeds of cruciferous plants that are actually produced and sold. Investigate. When extracting RNA from seeds When seed surface is coated with chemicals When seeding is carried out by direct grinding of RNA and PCR is performed, the coated chemicals may inhibit the PCR reaction. Rinse and dry for one day, and then extracted using the RNA extraction method.

The same size as the amplified fragment of LMV in two amplified fragments of positive control in four kohlrabi seeds, 20 varieties of lettuce seeds, 5 varieties of radish seeds, 6 varieties of cabbage seeds and 4 varieties of cabbage seed samples. DNA fragments amplified were identified. In eight lettuce seed samples, amplified DNA fragments of the same size as the amplified fragments of two pathogens were identified to confirm that both pathogens were detected at the same time (FIGS. 1, 2, and 3). To verify whether amplified DNA is identical to the gene sequence of LMV, NucleoSpin ^? Amplified fragments were extracted using the ExtractII kit (Macherey-Nagel, Germay), and sequencing was performed. As a result of examining the homology of the nucleotide sequences analyzed using the NCBI Blast program, it was confirmed that the detected pathogen was LMV showing 100% homology with the nucleotide sequence of the LMV. Therefore, it was confirmed that the developed RT-PCR method successfully detected RT-PCR without interfering with cDNA of seeds and specifically detected LMV. The contamination rates of LMV in kohlrabi, lettuce, radish, cabbage and cabbage varieties were 40%, 40%, 25%, 30% and 20%, respectively.

Each of the non-seed and cabbage seed sample of the first breed has confirmed that the amplified DNA fragment into the same size as the amplified fragment of Xcc (FIG. 4) irradiated with homology to analyze the gene of the amplified fragment result of Xcc base sequence 100% It was confirmed that Xcc was specifically detected by showing homology with. The detection efficiency of Xcc in radish and Chinese cabbage varieties was 5%. The lower pollution rate compared to LMV shows that seed contamination by viruses rather than bacteria is more serious. In particular, the DNA fragments amplified to the same size as the amplified fragments of LMV and Xcc in eight varieties of the sample of 50 lettuce varieties (Fig. 5), the analysis of the genes of the amplified fragments were examined for homology and LMV and It was confirmed that LMV and Xcc were specifically detected by showing 100% homology with the base sequence of Xcc .

Simultaneous detection means that the developed PCR method can successfully detect two pathogens in a complex infected seed sample. The detection efficiency was 16%, suggesting applicability to more varieties of seed samples. Existing multiple PCR methods were developed by bacteria and viruses, respectively, and because PCR was performed separately to detect bacteria and viruses, time and cost were doubled. However, if the multiple PCR method developed in this experiment is applied, The virus can be detected at the same time, effectively saving the time and cost of seed infection pathogens.

Attach an electronic file to a sequence list

Claims (12)

A first primer set, consisting of oligonucleotides of SEQ ID NOs: 1 and 2; And
Xanthomonas campestris pv. Comprising all primer sets from the group consisting of the second primer set, consisting of oligonucleotides of SEQ ID NOs: 3 and 4. A primer set for amplifying the target sequence of Xanthomonas campestris pv.campestris ( Xcc ) and the target sequence of Lettuce Mosaic Virus (LMV). A first primer set, consisting of oligonucleotides of SEQ ID NOs: 1 and 2; And
Xanthomonas campestris pv. Comprising all primer sets from the group consisting of the second primer set, consisting of oligonucleotides of SEQ ID NOs: 3 and 4. A composition for amplifying the target sequence of Campantris ( Xanthomonas campestris pv. Campestris : Xcc ) and the target sequence of Lettuce Mosaic Virus (LMV). A first primer set, consisting of oligonucleotides of SEQ ID NOs: 1 and 2; And
Xanthomonas campestris pv. Comprising all primer sets from the group consisting of the second primer set, consisting of oligonucleotides of SEQ ID NOs: 3 and 4. Kit for amplifying target sequences of Xanthomonas campestris pv. Campestris ( Xcc ) and target sequences of Lettuce Mosaic Virus (LMV). delete delete Amplifying a target sequence using a DNA derived from a cruciferous plant as a template and using the primer set of claim 1 as a primer; And
Method based on the presence or absence of the amplification product, determining the presence cruciferous Xcc Xcc and LMV and at least one of the one, cruciferous plants, which comprises determining the presence of one or more plants in the LMV or not. 7. The method of claim 6, wherein the cruciferous plant is at least one selected from the group consisting of radish, cabbage, lettuce, cabbage, rapeseed, fresh, turnip, and kohlrabi. The method of claim 6, wherein said amplification is polymerase chain reaction (PCR). The method of claim 8, wherein said amplification is RT-PCR. The method of claim 8 or 9, wherein in the amplification, the annealing temperature is between 53 ° C. and 57 ° C. 11. The method of claim 6, wherein the determining comprises determining that when one or more target sequences of the Xcc and LMV are amplified, one or more of Xcc and LMV corresponding to the one or more target sequences are present in the plant, If one or more target sequences of the Xcc and LMV are not amplified, determining that at least one of Xcc and LMV corresponding to the one or more target sequences is not present in the plant. The method of claim 6, wherein the plant is a seed.

Images