JP5712672B2 - Blueberry cultivation method - Google Patents

Description

  The present invention relates to a blueberry cultivation method, and more particularly to a blueberry cultivation method for increasing the content of proanthocyanidins (hereinafter referred to as “PAC”) of blueberry seedlings grown by micropropagation.

  The physiological activity of blueberry leaves is known from Patent Documents 1, 2, 3, and 4. For example, Patent Document 1 discloses that blueberry leaves suppress the growth of hepatoma cells and leukemia cells and are effective in improving cancer. Patent Document 2 discloses that a processed product of blueberry leaves suppresses the production of hepatitis C virus (hereinafter referred to as “HCV”). According to Non-Patent Document 1, it is described that the anti-HCV active active ingredient of this blueberry leaf is PAC. Patent Document 3 discloses that the progression from precancerous lesions to liver cancer is suppressed by ingestion of blueberry leaves. Similarly, Patent Literature 4 discloses that fat accumulation in the liver is also suppressed by ingestion of blueberry leaves. It is disclosed in Non-Patent Document 1 that at least the anti-HCV active component of these physiologically active components of blueberry leaves is PAC.

  Regarding the micropropagation of blueberries, Patent Documents 5 and 6 are known. However, the micropropagation described in Patent Documents 5 and 6 is a technique for simply increasing the number of seedlings to be transplanted in an open field, and there is no suggestion regarding a cultivation method aimed at producing or harvesting seedlings containing a relatively high content of PAC. Absent.

  For example, in the micro-propagation cultivation method of Patent Document 5, blueberry buds (shoots differentiated into leaf buds) are aseptically cultured in a medium supplemented with a plant growth regulator (hereinafter referred to as “PGR”) to obtain multi-buds. Induce. Subsequently, the cells are divided and transplanted in the same composition medium, and the growth is repeated under aseptic conditions. The proliferated multi-buds are transferred into a medium without PGR to induce bud elongation under aseptic conditions. Cuttings are taken from the stretched shoots (shoots), cut into cell trays, and rooted under non-sterile conditions. After rooting, it continues to acclimatize in the culture room environment and further acclimatize in the outside air environment. Moreover, in the micro-propagation cultivation method of patent document 6, a stem genus plant, for example, a berry apex tissue piece of a blueberry, is settled on a PGR addition culture medium, and tissue culture | cultivation is carried out in a sealed state, and a multi-bud is obtained. The obtained polyblasts are propagated and made into healthy seedlings under aseptic or sterilization while controlling the ventilation of the container from an airtight state to an open state. A fixed length of cuttings is collected from the shoots that have become healthy seedlings, transplanted to a cell tray, and rooting is induced in a culture room environment. Rooted seedlings will acclimatize in full open air. The feature of Patent Document 6 is that it shifts to an aseptic or sterilized open environment at the latter stage of the multi-bud growth process, and makes it a healthy seedling. The seedlings are grown to facilitate the transition to rooting and acclimatization processes.

  On the other hand, regarding increasing polyphenols and anthocyanins by forced irradiation of light, Non-Patent Document 2 and Non-Patent Document 3 are known in plants different from blueberries. Non-Patent Document 2 describes the effect of LED irradiation on the polyphenol content in broccoli sprout. Further, according to Non-Patent Document 3, a simultaneous irradiation effect of a blue LED and a fluorescent lamp for improving anthocyanin production in red radish at the seedling stage is also known. However, there is no mention of increasing PAC in these documents. In addition, the plants targeted in Non-Patent Documents 2 and 3 are different plants at the family level from the blueberries targeted by the cultivation method of the present invention, and the methods described in these non-patent documents were applied to blueberries. Even so, it is not easy to find a cultivation method provided by the present invention for selectively increasing PAC.

  In plants, various genes involved in production of PAC or a precursor thereof, flavanone 3-hydroxylase (hereinafter referred to as F3H), leucoanthocyanidin oxygenase (hereinafter referred to as LDOX), dihydroflavonol 4-reductase ( Non-patent document 4 also discloses leucoanthocyanidin reductase (hereinafter referred to as LAR) and anthocyanidin reductase (hereinafter referred to as ANR). However, there is no mention of genes involved in light irradiation and leaf PAC production in blueberry artificial light cultivation. According to the knowledge of the present inventor, there are two types of genetically different LAR1, LAR1 and LAR2.

JP2007-22929 JP2007-119398A JP 2008-174479 A JP2008-189631 JP2003-304765A JP2008-220242

Takeshita M. et al. et al. “Proanthocyanidin from Blueberry Leaves Suppresses Expression of Subgenetic Hepatitis C Virus RNA” The Journal of Biological Chemistry 2 (2) Tomoo Maeda et al. "Effect of supplementary light quality on growth and polyphenol content of broccoli sprout" Plant Environmental Engineering 20 [2] 83-89 (2008) Mayuko Iwai et al. “Effects of simultaneous irradiation of blue LED and fluorescent lamp on the improvement of anthocyanin production in red radish at the seedling stage” Plant Environmental Engineering 21 [2] 51-58 (2009) Jochen Bogs. et al. “The Grapevine Transcription Factor VvMYBPA1 Regulates Proanthocyanidin Synthesis Fruit Development”, Plant Physiology, March 2007. 143, pp. 1347-1361

  An object of the present invention is to provide a blueberry cultivation method for increasing the PAC content of blueberry seedlings grown by micropropagation.

  Another object of the present invention is to provide a blueberry cultivation method that enables early harvesting and multi-yearly harvesting by obtaining a PAC content close to the leaves of mature trees grown in the open field at the seedling stage.

  As a result of intensive studies to solve the above-mentioned problems, the inventors of the present invention include a high-content PAC that is close to the PAC content in the leaves of blueberry adult trees grown in the open field by irradiating blueberry seedlings with light under specific conditions. The inventors have found that seedlings can be produced and have reached the present invention.

This invention based on the said knowledge is characterized by including the following aspects.
Item 1: A method of cultivating a blueberry seedling by increasing the PAC content contained in the seedling by irradiating a blueberry seedling with light comprising a fluorescent lamp and / or LED as PAC increasing irradiation.
Item 2: The method according to Item 1, wherein the seedling is derived from a multi-budlet grown by micropropagation.
Item 3: The method according to Item 1 or 2 comprising the following steps.
(1) Cut cuttings from multi-shoots, cut the collected cuttings into a cell tray, induce rooting from cuttings under high-humidity atmosphere and light irradiation in an artificial weather machine, and gradually increase the humidity. Raising seedling stage to acclimate seedlings after rooting by reducing to normal humidity (2) Growth stage in which acclimatized seedlings are grown under light irradiation in a substantially closed environment (3) PAC content of grown seedlings PAC increasing stage to increase under light irradiation Item 4: The light irradiation in the seedling raising stage is intermittent irradiation with a fluorescent lamp and / or LED, and the irradiation intensity at the time of irradiation is 20-50 μmol · m ⁻² · s ⁻¹ , Item 4. The method according to Item 3, wherein the intermittent irradiation is repeated at least once in the light period and the dark period, and the irradiation period is 30 to 60 days.
Item 5: Light irradiation in the growth stage is continuous irradiation with a fluorescent lamp and / or LED, and the irradiation intensity is 20 to 50 μmol · m ⁻² · s ⁻¹ . Item 4. The method according to Item 3, wherein the irradiation period is at least 20 days.
Item 6: The light irradiation in the PAC increasing step is continuous irradiation with a fluorescent lamp and / or LED, the irradiation intensity is 60 to 300 μmol · m ⁻² · s ⁻¹ , and the irradiation period is 4 to 12 days the method of.
Item 7: The method according to Item 6, wherein the light irradiation in the PAC increasing step is an LED alone, and the LED is a blue or red alone or a combination thereof.
Item 8: The method according to Item 7, wherein the blue irradiation of the LED has an irradiation intensity of 100 to 300 μmol · m ⁻² · s ⁻¹ and an irradiation period of 4 to 12 days.
Item 9: The method according to Item 7, wherein the red irradiation of the LED has an irradiation intensity of 60 to 90 μmol · m ⁻² · s ⁻¹ and an irradiation period of 4 to 12 days.
Item 10: Light irradiation at the seedling stage is intermittent irradiation with a fluorescent lamp every 12 hours, the irradiation intensity is 30 μmol · m ⁻² · s ⁻¹ , the irradiation period is 30 to 60 days, and the growth stage The irradiation with light is continuous irradiation with a fluorescent lamp, the irradiation intensity is 20 to 50 μmol · m ⁻² · s ⁻¹ , the irradiation period is 20 to 30 days, and the light irradiation at the PAC increasing stage is fluorescence. Item 4. The method according to Item 3, wherein the irradiation is continuous irradiation with a lamp and a red LED, the irradiation intensity is 60 to 200 μmol · m ⁻² · s ⁻¹ , and the irradiation period is 4 to 12 days.
Item 11: Light irradiation at the seedling stage is intermittent irradiation with a fluorescent lamp every 12 hours, irradiation intensity is 20 to 50 μmol · m ⁻² · s ⁻¹ , and irradiation period is 30 to 60 days, The light irradiation in the growth stage is continuous irradiation with a fluorescent lamp, the irradiation intensity is 20 to 50 μmol · m ⁻² · s ⁻¹ , the irradiation period is 20 to 30 days, and the light irradiation in the PAC increasing stage. Is the continuous irradiation with a fluorescent lamp and a blue LED, the irradiation intensity is 100 to 300 μmol · m ⁻² · s ⁻¹ and the irradiation period is irradiation for 4 to 12 days.
Item 12: The method according to any one of Items 1 to 11, wherein the blueberry is a rabbit eye blueberry.
Item 13: The method of Item 12, wherein the rabbit eye blueberry is “Kunisato 35”.
Item 14: The method according to claim 1, wherein the light irradiation conditions are selected using as an index at least one expression intensity selected from the group consisting of genes F3H, DFR, LDOX, and ANR.
Item 15: A method for cultivating a blueberry by returning a seedling obtained by harvesting PAC-enriched branches and leaves to the growth stage, increasing the PAC content of the grown branches and leaves, and repeating harvesting.

In the present invention, the following terms are used in the following meanings.
1. Raising seedling stage: This is a stage in which cuttings collected from the proliferated polyblasts are cut into cultured soil to induce rooting and the rooted seedlings are acclimatized.
2. Growth stage: A stage in which a seedling that has been nurtured is irradiated with a fluorescent lamp and / or LED to grow into a seedling.
3. PAC increase step: A step of irradiating a grown seedling with a fluorescent lamp and / or LED to increase the PAC content of the seedling.

The present invention has the following effects or advantages.
(1) By light irradiation, in particular, PAC increasing irradiation, blueberry seedlings having a high PAC content close to the leaves of mature trees grown in the open field can be obtained as shown in FIGS. 7B and 9B.
(2) High PAC-containing seedlings can be harvested in a short cycle of 2 to 3 months by artificially cultivating the seedlings grown by micropropagation.
(3) Since it is not controlled by the weather etc. by cultivation in an artificial closed environment, stable year-round harvesting is possible.
(4) Due to cultivation in a substantially closed environment, unlike the open field cultivation, the harvested blueberry seedlings are not contaminated by residual pesticides or pathogens.
(5) Moreover, suitable light irradiation conditions can be easily designed by using the strength of expression of a specific gene involved in PAC production as an index.

  It is a flowchart which shows the cultivation method of the blueberry of this invention.   It is a photograph which shows the blueberry seedling immediately after transplanting to a cell tray.   It is a photograph which shows the blueberry seedling rooted by seedling irradiation.   It is a photograph which shows the blueberry seedling immediately before PAC increase irradiation.   It is a photograph which shows the PAC increase irradiation in an artificial weather machine.   It is a photograph showing a blueberry seedling just before harvesting.   The graph which shows the measurement result of the bioactive component in the blueberry seedling cultivated under fixed light irradiation conditions and the blueberry adult tree of the open field cultivation, (A) The measurement result of total polyphenol content, (B) The measurement result of total PAC content It is.   It is a graph which shows the measurement result of the total anthocyanin content in the blueberry seedling cultivated on fixed light irradiation conditions.   The graph which shows the measurement result of the bioactive component in the blueberry seedling cultivated under the light irradiation conditions different from FIG.7 and FIG.8, and the blueberry adult tree of an open field cultivation, (A) The measurement result of a total polyphenol content, (B) It is a measurement result of a total PAC content.   It is a graph which shows the measurement result of the total anthocyanin content in the blueberry seedling cultivated on the light irradiation conditions different from FIG.7 and FIG.8.   It is the graph which plotted the data of FIG. 7 (B) and FIG. 8 with time.   It is a block diagram which shows the typical gene which is concerned in the PAC production pathway containing PAC or its precursor.   It is a graph which shows the measurement result of the strength of the gene expression shown in FIG. 12 in the blueberry leaf cultivated on fixed light irradiation conditions.

The plant targeted by the cultivation method of the present invention is blueberries. Blueberry is an Ericaceae Vaccinium plant. Vaccinium plants are further classified into 10 sections. Of these, the fruits are used in four sections, including bilberry, cranberry, bilberry, blueberry, and the like: cyanococassetsu, mirtylus, oxicocassetsu, bitesuidia, and baccinium.
Blueberry, is an American native deciduous or evergreen shrubs or semi-tall fruit trees belonging to the Saianokokasu clause of the genus Vaccinium (Cyanococcus). There are many species of blueberries, roughly divided into six species, but the following three are important for fruit gardening.
(1) Highbush blueberry ( V. corymbosum L.): O'neill, Sharp Blue, Georgia Gem, Flounder, Leveley, Spartan, Darrow, Duke, Berkeley, Harrison, etc. (2) Rabbiteye blueberry (Rabbiteyer blueberry) , V. ashei Reade): Woodard, Garden Blue, Tiff Blue, Home Bell, Meyer, etc.
(3) Lowbush blueberry (Lowbush blueberry, V. angustifolium Aiton, V. myrtilloides Michaux): Signature, Bronzewick, Bromidon, etc.

  Blueberries were originally improved from wild species by the US Department of Agriculture or State University since the beginning of the 20th century. Varietal improvement has been promoted with the goal of producing fresh fruit mainly from the viewpoint of easy cultivation and large and sweet fruits. Today, it is grown all over the world. The blueberry used in the present invention is not particularly limited in terms of its type, origin, origin, etc.

  Preferred varieties include Southern rabbit eyes, especially red pearls, branch leaves of the new cultivar “Kunisato 35” (“Seedling Method” variety registration application number: No. 23433) by the present inventors, etc. High and suitable for the seedling of the present invention. For example, under the specific light irradiation conditions in FIG. 7 (B), the “Kunisato 35” seedling shows a high total PAC content comparable to that of blueberry leaves of mature trees grown in the open field. In addition, as shown in FIG. 9B, the red pearl seedlings have the same total PAC content as that of mature trees grown in the open field. It should be noted that in FIGS. 7B and 9B, the southern rabbit eye shows a higher total PAC amount than the high bush Berkeley, which is the main variety of blueberries.

Next, preferred embodiments of the present invention will be described in detail with reference to the drawings. FIG. 1 shows the steps (steps; S1, S2, S3, S4, S5, S6) of the blueberry cultivation method of the present invention. Of these, S1 and S2 are the previous stages of the present invention, and S3 to S6 are the stages of the present invention.
(1) Multiblast induction stage (S1):
S1 is a step of inducing blueberry polyblasts. In the present invention, the “multi-bud” refers to those having a bud count of approximately 10 or more. In S1, a tissue piece of a blueberry shoot apex is cultured in a medium containing a saccharide, PGR, and a support.

  As a basic medium used for tissue culture, Woody Plant medium (WP medium), Murashige & Skog medium (MS medium) widely used for tissue culture of plants, a combination of these mediums, or a medium whose composition is modified. Can be mentioned. Preferably, an MW medium (MS medium 1: WP medium 1) in which MS medium and WP medium are combined is used.

  Sugar, PGR, and support are added to the basic medium. Examples of sugars include sugars such as sucrose, glucose, fructose, galactose, lactose and sorbitol, and sugar alcohols such as maltose and mannitol. These sugars may be used alone or in any combination of two or more.

  PGR includes naphthalene acetic acid (NAA), indole-3-acetic acid (IAA), indole-3-butyric acid (IBA), 2,4-cyclophenoxyacetic acid (CPA), indole-3-propionic acid (IPA), benzofuran Auxins such as -3-acetic acid (BFA), phenylacetic acid (PA), and derivatives thereof; and benzyladenine (BA), kinetin, zeatin, 2-isopentenyladenine (2IP), (2-chloro-4 -Cytokinins such as (pyridyl) -3-phenylurea (4PU). These may be used alone or in any combination of two or more. Preferably zeatin is used.

  The support is a component necessary for immobilizing the medium. Usually, a base used for a solid medium, for example, a gelling agent such as agar or gellan gum is used. The use of agar is common.

The concentration of these components in the medium varies depending on the species of blueberries and cannot be specified unconditionally. For example, when using an MW medium, the concentration of saccharide (preferably sucrose) is 1 to 10% by weight, preferably 2 to 2%. 3 wt%; PGR (preferably zeatin) concentration of 1 to 10 mg · L ⁻¹ , preferably 2 to 5 mg · L ⁻¹ ; Support (preferably agar) concentration of 0.8 to 2 wt%, preferably Is 0.8 to 1.0% by weight. These ratios mean the total amount of sugars, PGRs or supports when used in combination of two or more.

  Furthermore, an antibiotic such as PPM (Plant Preservative Mixture, trade name, manufactured by Nacalai Tesque Co., Ltd.) can be added to these media as other components in order to prevent the generation of mold. The concentration of PPM is about 0.1 to 0.5% by weight, preferably about 0.1 to 0.3% by weight of the medium. The medium is sterilized and used under aseptic conditions.

  The shoot tip culture is performed under strictly controlled airtight chain system and aseptic conditions such as an artificial weather machine. Specifically, a tissue piece at the top of a blueberry shoot is grafted onto a medium prepared in a sterilized state in a container, and the occurrence of multi-buds is induced in an artificial weather machine.

As the tissue piece at the top of the shoot, one obtained from, for example, an annual branch of blueberries grown in a field and sterilized is used. There is no particular limitation on the sterilization method. For example, after washing with running water and ultrapure water, it is immersed in a 5% sodium hypochlorite solution and then washed with sterile distilled water. In the shoot tip culture, the temperature is 20 to 25 ° C., the humidity is 100% RH, the light period is 12 to 16 hours, the dark period is 8 to 12 hours, and the light period and the dark period are alternately performed within 24 hours. desirable. The photon number of the illumination used in the light period is not particularly limited, but is usually adjusted within the range of irradiation intensity of 5 to 20 μmol · m ⁻² · s ⁻¹ . The culture is performed until the number of buds is approximately 10. The period is slightly different depending on the type of blueberry, so it cannot be specified, but is usually about 2 to 5 months.

(2) Multi-bud growth stage (S2):
S2 is a stage in which the multiblasts obtained in S1 are grown. In S2, the multiblasts obtained in S1 are dividedly planted in a medium and cultured. In split-planting, the shoots are divided into about 2 to 10 so as to be 0.5 to 0.2 g, and this is planted in a medium. Repeat this step several times if necessary.

For culture, the same basic medium as that used in S1 can be used, but it is preferable not to add antibiotics to the medium. Saccharides are not necessarily required, and are used in the range of 0 (no addition) to 10% by weight. As the sugar, sucrose is preferable. The PGR used in S1 can also be used. Preferably, at least one selected from the group consisting of zeatin, kinetin, 2IP and BA is used in a ratio of 0.1 to 10 mg · L ⁻¹ as a total amount. More preferably, the use of zeatin alone, particularly at a ratio of 2 to 5 mg · L ⁻¹ , is effective. As the support, those used in S1 can be used. Preferably, agar is used at a ratio of about 0.8 to 2% by weight.

  In the initial stage of transplantation, the strain divided and transplanted in S2 is cultured under airtight conditions and aseptic conditions in the same manner as in S1, but the air replacement in the container is constantly released from the airtight state from the beginning to the end of the culture. It is preferable to culture while controlling ventilation so as to increase to a state stepwise or continuously. More specifically, by repeating the growth by split transplantation, until the stage where the shoots become a culture environment and grow at a constant rate, it is in a sterile and airtight state, and ventilation is started at the final stage of growth. Then, the cells are cultured for a certain period of time, usually for about one month under ventilation conditions. That is, in the S2 multi-bud growth step, the growth by split transplantation is repeated about 2 to 3 times. The culture in the “growth stage” is desirably performed in an airtight state under aseptic conditions, as in the above-described multiblast induction step (S1).

The culture in this step can be performed under substantially the same conditions. Specifically, the temperature condition is 20 to 25 ° C., the illumination condition is irradiation intensity 20 to 50 μmol · m ⁻² · s ⁻¹ , and the irradiation time is 12 to 16 hours. Although not limited, the “growth stage” requires a period of time until the shoots are grown and then become a grown culture environment and grow at a constant rate. Although it does not restrict | limit as this period, Usually, about two months can be mentioned.

(3) Seedling stage (S3):
In S3, cuttings are collected from the multi-buds proliferated in S2 and cut into culture soil to induce rooting and acclimatization. These cuttings may be collected from mature blueberry trees grown in the open field.

  For example, cuttings are collected from the shoots of polyblasts grown in S2, and the cuttings are cut into the culture soil of the cell tray as shown in FIG. 2 and transferred into an artificial weather machine to induce rooting. . When the length of the chute is 20 to 80 mm, it is collected, further cut into 10 to 20 mm and inserted.

  As the culture soil, a general culture soil used in the art can be used. For example, peat moss can be generally used as the culture soil, but a porous material such as zeolite, Kanuma soil, Bora soil, pumice, vermiculite or perlite may be used in appropriate combination. Furthermore, wood powder, sawdust, humus, or fibrous composition and clay mineral can be blended. Preferable culture soil includes a mixture of peat moss and shirasu. The mixing ratio of the culture soil is preferably about 10 to 70% by volume of shirasu. Rock wool can be used instead of culture soil.

In order to promote rooting, auxins such as indole butyric acid (IBA) or naphthalene acetic acid (NAA) may be applied to the base of the shoot. The concentration is preferably 100 to 1000 mg · L ⁻¹ .

  The temperature in the artificial weather machine is preferably 15 to 25 ° C. If it is less than 15 degreeC, rooting and growth will be slow, and if it exceeds 25 degreeC, there exists a possibility of withering before rooting by heat failure. Humidity management is important during cutting and inadequate rooting. The humidity is maintained at a high humidity of 70% RH or higher. If it is less than 70%, there is a possibility of withering. As an adjustment method, water is always put in the lower part of the cell tray and sprayed from above intermittently. In order to keep the humidity at a constant condition, the cell tray may be covered with a simple plastic lid or adjusted with a mist device.

The light irradiation at this stage is intermittent irradiation for avoiding damage due to light heat to the weak cutting head. The light source is a fluorescent lamp and / or an LED. In the case of a fluorescent lamp, the range of 20 to 50 μmol · m ⁻² · s ⁻¹ is appropriate for the irradiation intensity in the light period. The intermittent irradiation period may be appropriately repeated within the range of light period 12 to 16 hours and dark period 8 to 12 hours. The intermittent irradiation period is 30 to 60 days. An LED has a lower calorific value than a fluorescent lamp, and there is little thermal damage to the cutting head.

  Rooting begins about 14 days after cutting, and the root turns into a hole in the plug tray in 30-60 days. FIG. 3 shows the rooting state of the seedling obtained in S3.

  When most cuttings are rooted and grow into seedlings as shown in Fig. 3, the cell tray lid is opened and closed, etc., from the high humidity state of rooting induction time to about 30-60% RH of normal humidity Until the seedlings are adapted to the next process environment. Since a rapid change in humidity is not desirable, the humidity reduction is performed gradually over at least about 16 hours. The acclimatization stage temperature is 15 to 25 ° C. as in the root induction period. Irradiation is substantially the same as during rooting induction. The period required for acclimatization is about 1 to 5 days.

(4) Growth stage (S4);
S4 is a stage in which the seedlings acclimatized in S3 are grown and the fresh weight is increased. In S4, the experiment may be carried out in an artificial weather machine following S3 experimentally, but industrially, it is desirable to carry out in a substantially closed environment different from an open field such as a house or a plant factory.

The temperature at the stage of S4 is 15 to 25 ° C. and the humidity is 30 to 60% RH. The light irradiation is a continuous irradiation of a fluorescent lamp and / or LED as a light source, and the irradiation intensity is 20 to 50 μmol · m ⁻² · s ⁻¹ and the irradiation period is at least 20 days, although it is somewhat different between the fluorescent lamp and the LED. The upper limit need not be technically specified, but about 60 days is appropriate. The raw weight after the irradiation period is about twice as large as the raw weight in the S3 stage.

(5) PAC increasing step (S5);
S5 is the most characteristic light irradiation step of the present invention that increases the PAC content of the seedlings obtained in S4. FIG. 4 shows the state of the seedling immediately before the PAC increasing stage. The length of the seedling is about 50 to 120 mm. Fig. 5 shows the situation of light irradiation by an artificial weather machine. However, if the temperature, humidity, light irradiation conditions, etc. can be properly managed, a place in a substantially closed environment such as a house or a plant factory other than the artificial weather machine is shown. This is suitable for mass production.

  The temperature and humidity at S5 may be substantially the same as S4, the temperature is in the range of 15 to 25 ° C., and the humidity is in the range of 30 to 60% RH.

The light source for light irradiation in S5 is continuous irradiation by a fluorescent lamp and / or LED. The irradiation intensity is in the range of 60 to 300 μmol · m ⁻² · s ⁻¹ and the irradiation period is at least 4 days. By irradiation with light for 4 days or longer, the PAC content and the PAC content ratio can be increased. Although it is not necessary to technically specify the upper limit of the irradiation period, early harvesting is possible if the irradiation period is about 4 to 12 days. When an LED is used for light irradiation, the LED may be blue or red alone or a combination thereof. For blue irradiation of the LED, a range of irradiation intensity of 100 to 300 μmol · m ⁻² · s ⁻¹ is preferable. In the red irradiation of the LED, a range of irradiation intensity of 60 to 90 μmol · m ⁻² · s ⁻¹ is preferable. Even if the irradiation conditions change, the irradiation period may be about 4 to 12 days.

  In general, the use of LEDs has an advantage that the cost for air conditioning can be reduced because of low power consumption and low calorific value. In addition, since the calorific value is low, thermal damage does not occur in the seedlings even with light irradiation from a close distance, and the light utilization efficiency of the plant body is high. Moreover, as described later, the PAC content and the PAC content ratio can be remarkably increased by irradiating the LED with specific light.

Suitable combinations of light irradiation in S3, S4, and S5, which are features of the present invention, are exemplified below.
(1) Light irradiation in the seedling raising stage S3 is intermittent light / dark irradiation every 12 hours using only a fluorescent lamp, irradiation intensity is 20 to 50 μmol · m ⁻² · s ⁻¹ , and irradiation duration is 30 to 60 days. It is. The light irradiation in the growth stage S4 is continuous irradiation using only a fluorescent lamp, and the irradiation intensity is 20 to 50 μmol · m ⁻² · s ⁻¹ and the irradiation period is 20 to 30 days. The light irradiation in the PAC increasing step S5 is continuous irradiation with a fluorescent lamp and a red LED, and the irradiation intensity is 120 μmol · m ⁻² · s ⁻¹ and the irradiation period is 4 to 12 days.
(2) Light irradiation at the seedling stage is intermittent light / dark irradiation with fluorescent lamps every 12 hours, irradiation intensity is 20 to 50 μmol · m ⁻² · s ⁻¹ and irradiation period is 30 to 60 days. is there. The light irradiation in the growth stage is continuous irradiation with a fluorescent lamp, and the irradiation intensity is 20 to 50 μmol · m ⁻² · s ⁻¹ and the irradiation period is 20 to 30 days. The light irradiation in the PAC increasing step is continuous irradiation with a fluorescent lamp and a blue LED, and the irradiation intensity is 300 μmol · m ⁻² · s ⁻¹ and the irradiation period is 4 to 12 days.

  What should be noted is the irradiation effect in S5. Although details are left to the discussion of the examples, generally speaking, as shown in FIGS. 7B and 9B, the light irradiation up to S4 does not increase the total PAC content of the seedling so much. It is that the total PAC content close to the leaf of an adult blueberry tree cultivated in the open field has been reached for the first time after short-term irradiation. Further, as shown in FIG. 10, the anthocyanin content increases remarkably when a fluorescent lamp and a blue LED are used in combination. A combination of a fluorescent lamp and a red LED or a blue LED alone has a degree of increase effect. This result means that the proportion of PAC content in the total anthocyanins increases.

  In the effect of increasing the amount of PAC and anthocyanin by light irradiation, changes with time are different as shown in FIG. The total PAC content increases with the irradiation period, but the total anthocyanin content starts to decrease from around 5 days. This result means that the increase in PAC is selectively increased when the light irradiation of the present invention is carried out preferably for 5 days or longer.

  Furthermore, the gene expression involved in the production of PAC shown in FIG. 12 is strong and weak reflecting light irradiation as is apparent from FIG. 13, and at least F3H, DFR, LDOX and ANR are forced light irradiation. Compared with Comparative Example (1) where no light is applied, it is clearly stronger reflecting specific light irradiation conditions. From this, conversely, suitable irradiation conditions in a blueberry artificial cultivation plant or the like for obtaining PAC from blueberry leaves, using as an indicator that gene expression under test irradiation conditions for blueberry seedlings in an artificial weather machine is strong Can be pre-screened.

(6) Harvest stage (S6);
S6 is the harvest stage of blueberry seedlings with increased PAC content in S5. FIG. 6 shows the state of the seedlings just before harvesting. The total length of the seedling is about 50 to 150 mm.

  The upper part of the seedling at this stage can be cut out together with branches and leaves and used as a raw material for PAC extraction. As described above, PACs exhibiting excellent physiological activity exist in the branches and leaves of blueberries. In the present invention, since the seedlings reach the harvest stage, there is no problem even if twigs are mixed in, and the harvesting operation is extremely efficient compared to harvesting the leaves of mature trees grown in the open field. The seedlings after harvesting the branches and leaves can be returned to the production process of S4 again to increase the fresh weight. If the cycle of S4 to S6 is about 60 days, branches and leaves can be harvested 5 to 6 times a year because all stages are performed in a substantially closed environment. This is also advantageous compared to outdoor cultivation where the harvest is once a year.

  Hereinafter, the present invention will be described with reference to experimental examples and examples. However, the present invention is not limited to these examples. Unless otherwise specified, “%” means “% by weight” and “parts” means “parts by weight”.

Materials and equipment:
Rabbit eye blueberry ( V. ashei Reade) cultured seedlings and adult leaves and highbush blueberry ( V. corymbosum L.) cultured seedlings were used.

  Lunch white fluorescent lamp (Mellow 5N FLR40S-EX-NM36-H Toshiba), blue LED (panel LED LED-B type Tokyo Rika Instruments Co., Ltd., peak wavelength 470 nm), red LED (panel LED LED-R type Tokyo Rika Instrument) Corporation peak wavelength 660nm) was used.

  A plant incubator (CFH-405 Tomy Seiko Co., Ltd.) was used for the growth of the plant body.

Measuring method
1. Polyphenols were extracted from the lyophilizate with methanol of 80% (v / v) total polyphenol content of blueberry seedlings . The polyphenol content was measured by a foreign-thiocult method (Chizuko Kashiwazaki et al., “Antioxidant activity of agricultural products produced in the prefecture”, Miyazaki Prefecture Industrial Technology Center, Miyazaki Food Development Center Research Report [48] 91-98 (2003)). The measured value was calculated by the amount corresponding to gallic acid per raw weight.

2. PAC was extracted from the lyophilized product with hot water having a total PAC content of 99 ° C. in blueberry seedlings . The PAC content was measured according to the 4-dimethylaminocinnamaldehyde (DMACA) method (Li, Y.-G. et al. “The DM ACA-HCl Protocol and the Threshold Proanthocyanidin Content for Blotter Safety in Forge”. and Agriculture 70: 89-101 (1996)). The measured value was calculated as an amount equivalent to catechin per raw weight.

3. Anthocyanins were extracted from the lyophilized product with 95% (v / v) ethanol to which hydrochloric acid was added so that the final concentration of blueberry seedlings was 0.1N. Measurement of the anthocyanin content was carried out by HPLC (Ballington J.R. et al. " Interspecific differences in the percentage of anthocyanins, aglycons, and aglycon-sugars in the fruit of seven species of blueberries." Journal of American Society for Horticultural Science 112: 859-864 (1987)). The measured value was calculated by an amount equivalent to cyanidin 3-glucoside per raw weight.

5. Measurement of gene expression In order to examine the polyphenol biosynthesis system of blueberries, expression analysis of six genes, polyphenol biosynthesis genes, F3H, LDOX, DFR, LAR1, LAR2, and ANR was performed.
Of the blueberry polyphenol biosynthesis genes, F3H and LDOX were isolated using the Clontech PCR-Select ^™ cDNA subtraction kit (Clontech). For DFR and ANR, two types of specific primers having the following base sequences were prepared in regions having high homology among the respective genes in organisms other than blueberries.
DFR
DFR-F1: GTNTSYGTBACNGGDGNGNNGNTWY
DFR-R1: HTCDAYRGCNCCNNBRWACATNTCYTY
ANR
ANR-F1: AAGRMVGCDTGYGTBRTHGGYGGMACY
ANR-R1: CCCCTTDGYSTTSAWRTAYTCYASASW
LAR
LAR-F1: GGWKCMWCCYGGKTTYATNGGBMRGTTY
LAR-R1: VTYAAGRCAYTCNTCNAHGSWYCKRAA
A base sequence specific to each gene was amplified and isolated by the polymerase chain reaction (PCR) used. Moreover, Rapid Amplification of cDNA Ends (RACE) -PCR was performed using SMARTScribe ^™ Reverse Transscriptase (manufactured by Clontech), and the 5 ′ end and 3 ′ end of each gene were isolated. The base sequence of the isolated gene was decoded with Applied Biosystems 3500 × L Genetic Analyzer (Life Technologies Japan Inc.). The function of the decoded gene was estimated by homology search by Blast of Japan DNA Data Bank.
Based on the decoded sequence, two types of primers specific for the blueberry polyphenol biosynthetic gene were prepared and used for expression analysis described later.
In order to investigate the expression of polyphenol biosynthesis genes in cultured seedlings, the improved cetyl trimethyl ammonium bromide (CTAB) method (“Development of an efficient RNA extraction method in blueberry leaves” 51th Annual Meeting of the Plant Physiological Society of Japan 282 Page 2010), RNA was extracted from the cultured seedlings.
Complementary DNA (cDNA) was synthesized from the extracted RNA using a transcriptase (Invitrogen). Two types of specific primers having the following base sequences for each gene were prepared for the synthesized cDNA.
F3H
C74-F6: ATGGCACCAACGACGCTGAC
C74-R7: ATAGCAAAGTGGGTCTAAGCA
LDOX
C68-F6: ATGGTGAGTACAATGGTTGC
C68-R4: GACAAGTACAACGTTATGCC
DFR
DFR-F8: CGAACCAGTCCATGAAAGAGC
DFR-R8: CCACCCTCATCCATACAGAGCAT
ANR
ANR-F6: CGACCCTCAATTCTTTGCTC
ANR-R6: ACCATTGCTAAGGTGAACACC
LAR1
LAR1-F3: ATGACGTTGATCACAGCTTCTG
LAR1-R1: GCTGATACACATGCTCCCCAT
LAR2
LAR2-F4: GGGAATCATGACTGTGTGA
LAR2-R2: GCCACGTAATCCTCCAAAGCA
And a base sequence specific to each gene was amplified. The amplified product is electrophoresed on a 1.5% (w / v) agarose gel at 50 V for 90 minutes to separate the specific product, stained with ethidium bromide, and then fluoresced by ultraviolet irradiation. The expression intensity was estimated. Analysis of expression intensity was performed with analysis software ImageJ 1.43u (National Institutes of Health).

1. Blueberry seedling stage (S3)
“Red Pearl” was used for blueberries. The cuttings prepared based on Patent Document 6 were transplanted into a 100-well cell tray having a width of 28 cm, a depth of 28 cm, and a height of 6 cm filled with soil mixed with peat moss and mullet in a 1: 1 ratio. Insert once in a day to give the mist water enough to wet the entire ear, place a transparent lid on the cell tray so that it can be exposed to light, and prevent the inner ear from drying out. Placed in an artificial weather machine. Of the day, 12 hours were irradiated with a 30 to 50 μmol · m ⁻² · s ⁻¹ daytime white fluorescent lamp, and the remaining 12 hours were placed in a dark place and irradiated intermittently for 60 days. The cuttings were not subjected to special treatment such as application of hormones. Rooting occurred in the cuttings in about 14 days, and healthy seedlings could be confirmed 60 days after the cuttings. After raising the seedlings, the lid was slightly opened and gradually lowered to the same humidity as the outside air over 2 days. Finally, the lid was removed to acclimatize.

2. Seedling growth stage (S4)
The seedlings obtained in the previous step were irradiated continuously for 24 hours in an artificial meteor with an air temperature of 25 ° C. using a daylight fluorescent lamp with an irradiation intensity of 30 μmol · m ⁻² · s ⁻¹ , an irradiation period of 20 days.
3. PAC increase stage of seedlings (S5)
The grown seedlings obtained in the previous step were irradiated continuously for 24 hours in an artificial weather machine at a temperature of 25 ° C. using a daylight white fluorescent lamp, with an irradiation intensity of 170 μmol · m ⁻² · s ⁻¹ , an irradiation period of 1 to 10 days. . As shown in FIGS. 7 and 8, samples were collected on the first, third, fifth, and tenth days from the start of the PAC increasing step irradiation, freeze-dried, and stored frozen.
4). The total polyphenol content, the total PAC content, and the total anthocyanin content were measured by the above-described method using the freeze-dried sample before the measurement of the active ingredient . The results are shown in FIGS.

“Kunisato 35” was used as a blueberry, and PAC increased irradiation was continuously performed with a daylight white fluorescent lamp with an irradiation intensity of 170 μmol · m ⁻² · s ⁻¹ , an irradiation period of 10 days, and 24 hours. Otherwise, the same method as in Example 1 was used. The results are shown in FIGS.

“Barclay” was used as a blueberry, and PAC increased irradiation was continuously performed with a daylight white fluorescent lamp with an irradiation intensity of 170 μmol · m ⁻² · s ⁻¹ , an irradiation period of 10 days, and 24 hours. Otherwise, the same method as in Example 1 was used. The results are shown in FIGS.

“Red pearl” was used as a blueberry, and PAC increased irradiation was performed with a combination of a daylight fluorescent lamp 30 μmol · m ⁻² · s ⁻¹ and an LED (blue or red). The blue LED was irradiated continuously for 24 hours with an irradiation intensity of 300 μmol · m ⁻² · s ⁻¹ , an irradiation period of 5 days and 10 days. The red LED was irradiated continuously for 24 hours with an irradiation intensity of 90 μmol · m ⁻² · s ⁻¹ , an irradiation period of 10 days. Otherwise, the same method as in Example 1 was used. The results are shown in FIGS.

“Red pearl” was used as a blueberry, and PAC increased irradiation was continuously performed with a blue LED at an irradiation intensity of 300 μmol · m ⁻² · s ⁻¹ , an irradiation period of 10 days, and 24 hours. Otherwise, the same method as in Example 1 was used. The results are shown in FIGS.

“Barclay” was used as a blueberry, and PAC increased irradiation was continuously performed with a blue LED at an irradiation intensity of 300 μmol · m ⁻² · s ⁻¹ , an irradiation period of 10 days, and 24 hours. Otherwise, the same method as in Example 1 was used. The results are shown in FIGS.

  As shown in FIG. 7 (A), the total polyphenol content was the highest when the seedlings were irradiated with PAC-increasing irradiation for 10 days, and the amount was 74 mg per 1 g of fresh weight. Compared with open-grown grown trees, it reached 79% of June harvest leaves and 56% of September harvest leaves.

  As shown in FIG. 7B, the total PAC content was also highest when the seedlings were subjected to PAC-increasing irradiation for 10 days, and the amount was 6.0 mg per 1 g of fresh weight. Compared with open-grown mature trees, it reached 153% of June harvest leaves and 75% of September harvest leaves. Moreover, even with irradiation for about 5 days, a total amount of PAC almost equal to that of mature trees grown in the open field was obtained. As in Test Nos. 1 and 2, a sufficient amount of PAC was not obtained only by growth irradiation. From this, it is possible to harvest seedlings sufficiently containing PAC by irradiation for about 5 to 10 days. The total PAC content of “Kunisato 35” seedlings was a very high value of 8.2 mg / g of fresh weight. From these results, “Kunisato 35” is considered to be a variety suitable for the cultivation method of the present invention. On the other hand, “Barclay” seedlings, which are one type of highbush blueberry, were unable to obtain the PAC content as much as rabbit eye blueberry seedlings.

  As shown in FIG. 8, the total anthocyanin content was highest on the fifth day from the start of the PAC-increasing irradiation, and decreased after the fifth day. Although the reason is not clear, it has become clear that the PAC is selectively increased by the light irradiation of the present invention.

  From the above, changes in proanthinidine content due to changes in light irradiation conditions behaved completely differently from changes in anthocyanin content. Irradiating cultivation method is effective.

As shown in FIG. 9 (A), the total polyphenol content was determined as follows: rabbit eye blueberry seedlings, 30 μmol · m ⁻² · s ⁻¹ white fluorescent lamp, 300 μmol · m ⁻² · s ⁻¹ LED blue light Was irradiated most for 10 days, and the amount was 56 mg / g of raw weight. Compared to open-grown grown trees, the content was 60% of the June harvested leaves and 43% of the September harvested leaves. The total polyphenol content was not as high as that of mature grown-up trees.

As shown in FIG. 9 (B), the total PAC content becomes the highest when the cultured seedlings are irradiated with only 300 μmol · m ⁻² · s ⁻¹ LED blue light for 10 days, and the amount is the raw weight. It was 6.6 mg per g. Compared to those grown in the open field, the content was 169% of the June harvested leaves and 83% of the September harvested leaves. In addition to the light of a white fluorescent lamp of 30μmol ^{· m} -2 ^{· s -1,} even if the LED blue light 300μmol ^{· m} -2 ^{· s -1} was irradiated for 10 days, were included comparable PAC. In addition to the light of 30 μmol · m ⁻² · s ⁻¹ white fluorescent lamp, the LED red light of 90 μmol · m ⁻² · s ⁻¹ is irradiated for 10 days, or the white fluorescence of 30 μmol · m ⁻² · s ⁻¹ Even when 300 μmol · m ⁻² · s ⁻¹ LED blue light was irradiated for 5 days in addition to the light from the lamp, a PAC content higher than that of the June harvest leaves was confirmed.

  As shown in FIG. 10, the total anthocyanin content decreased after 10 days of LED irradiation than that after 5 days, and the same tendency as in FIG. 8 was observed.

  From the above, in the case of only daylight white fluorescent lamp, in the case of irradiating LED light and daylight white fluorescent lamp at the same time, or in the case of only LED light, it is possible to irradiate for a short period of 5 to 10 days. It was found that the PAC content of seedlings can be made to be comparable to that of mature trees grown in the open field. When LED light is used, the total polyphenol content increases in the white fluorescent lamp, but the increase in the PAC content is almost the same, and it is considered that the ratio of PAC in the polyphenol can be further increased.

A seedling of “Berkeley”, one of the highbush blueberries, was tested by irradiating only 300 μmol · m ⁻² · s ⁻¹ LED blue light for 10 days after growing for 20 days. A moderate PAC content could not be obtained.

  On the other hand, among the genes involved in the production of the PAC of FIG. 12 or its precursor, F3H, DFR, LDOX, and ANR are assigned to test number 1 for light irradiation without forced light irradiation, as shown in FIG. In comparison, gene expression is stronger. That is, the expression intensity of F3H greatly exceeds test number 1 under the light irradiation conditions in test numbers 2 and 6. Similarly, DFR expression is strong in test numbers 2, 3, 6, 9, LDOX expression is strong in test numbers 2, 3, 6, 9, and ANR expression is test numbers 2, 3, 4, 9 It is getting stronger. However, even in the genes involved in the production of the same PAC or its precursor, the expression intensity of LAR1 and LAR2 does not reflect the light irradiation conditions.

  As is clear from Patent Document 1, berry-derived PAC has a higher proportion of epicatechin as the basic skeleton than catechin. In the present invention, as shown in FIG. 13, the expression of LDOX and ANR involved in the epicatechin root in FIG. 12 is strong, but the expression of LAR in the catechin root is not strong. This suggests that the gene expression in the present invention is strong and that the proportion of epicatechin in PAC derived from blueberry leaves is high.

  Further, as can be seen from FIG. 7B and FIG. 13, after the start of the S5: PAC-increasing irradiation conditions, the expression of F3H, DFR, LDOX and ANR became stronger in 1 day, and the total PAC content increased in 5 days. Yes. From the correspondence between the gene expression and the light irradiation conditions, a suitable light irradiation condition can be selected using as an indicator that the expression of at least one of the genes F3H, DFR, LDOX and / or ANR is strong. Alternatively, in combination with or instead of measuring the total polyphenols of the collected blueberry leaves, the level of gene expression is measured and the appropriateness of light irradiation conditions in the artificial cultivation of blueberries for the purpose of obtaining PACs of blueberry leaves is pressed. It can also be used as an index for cleaning.

  The present invention can be used for cultivation in a plant factory. The product can be used as an additive in the manufacture of supplements, salads, sweets, beverages and the like. Moreover, the gene involved in the production of PAC under light irradiation of the present invention can also be used for breeding blueberries with a large amount of PAC production.

Claims (12)

Blueberry seedlings, professional light irradiation by the fluorescent lamp and / or LED, irradiation intensity 60~330μmol ^{· m} -2 ^{· s -1,} which is included in the seedlings by the irradiation period between 4-12 days, to continuous irradiation A method for cultivating blueberries, comprising a PAC increasing step to increase anthocyanidin (PAC) content. The method according to claim 1, wherein the irradiation light in the PAC increasing step is light from an LED alone , and the LED is blue or red alone or a combination thereof. The method of claim 2 blue illumination light of the LED is a illumination intensity 100~300μmol ^{· m} -2 ^{· s -1.} The method of claim 2 LED red illumination light, a illumination intensity 60~90μmol ^{· m} -2 ^{· s -1.} Blueberry seedlings
A seedling stage in which cuttings collected from the proliferated polybud or blueberry mature tree are cut into a culture soil, rooting is induced under light irradiation, and the rooted seedling is acclimatized,
A stage of growing seedlings by irradiating the seedlings with fluorescent light and / or LED light.
The method according to any one of claims 1 to 4, which is obtained by the following . The light irradiation in the seedling stage is light irradiation with a fluorescent lamp and / or LED , the irradiation intensity at the time of irradiation is 20 to 50 μmol · m ⁻² · s ⁻¹ , the irradiation period is 30 to 60 days, the light period and the dark period The method according to claim 5, wherein the irradiation is repeated at least once for equal time . The method according to claim 6, wherein the intermittent irradiation in the seedling raising stage repeats the light period and the dark period every 12 hours. Light irradiation in growth stage, light irradiation by the fluorescent lamp and / or LED, irradiation intensity 20~50μmol ^{· m} -2 ^{· s -1,} claim 5 irradiation period of at least 20 days, is to continuously irradiated The method described in 1 . Light irradiation at the seedling stage is light irradiation with a fluorescent lamp , the irradiation intensity is 20 to 50 μmol · m ⁻² · s ⁻¹ , the irradiation period is 30 to 60 days , and the light period and dark period are every 12 hours. Repeated, intermittent irradiation ,
The light irradiation in the growth stage is light irradiation with a fluorescent lamp , the irradiation intensity is 20 to 50 μmol · m ⁻² · s ⁻¹ , and the irradiation period is 20 to 30 days continuously ,
Light irradiation in the PAC bulking step, a light irradiation by the fluorescent lamp and a red LED, a irradiation intensity 60~200μmol ^{· m} -2 ^{· s -1,} in which the irradiation period between 4-12 days, to continuous irradiation claims Item 6. The method according to Item 5 . Light irradiation at the seedling stage is light irradiation with a fluorescent lamp , the irradiation intensity is 20 to 50 μmol · m ⁻² · s ⁻¹ , the irradiation period is 30 to 60 days , and the light period and the dark period are repeated every 12 hours. , Intermittent irradiation ,
Light irradiation in the growth stage, in the light irradiation by the fluorescent lamp, the irradiation intensity 20~50μmol ^{· m} -2 ^{· s -1,} are those irradiation period is between 20 to 30 days, to continuous irradiation,
The light irradiation at the PAC increasing stage is light irradiation by a fluorescent lamp and a blue LED , and the irradiation intensity is 100 to 330 μmol · m ⁻² · s ⁻¹ and the irradiation period is continuously 4 to 12 days. The method of claim 5 . The method according to any one of claims 1 to 10 , wherein the blueberry is a rabbit eye blueberry. The method according to claim 11, wherein the rabbit eye blueberry is “Kunisato 35”.