JP5246639B2 - Process for producing 4-hydroxy-L-isoleucine - Google Patents

Description

  The present invention relates to the microbial industry, and in particular, to a novel process for producing dioxygenase and 4-hydroxy-L-isoleucine or a salt thereof.

  4-Hydroxy-L-isoleucine is an amino acid that can be extracted and purified from Trigonella foenum-graecum L. leguminosae. 4-Hydroxy-L-isoleucine exhibits interesting insulinotropic activity, which has a stimulatory effect in medium as demonstrated in both isolated perfused rat pancreas and human islets. This is because it clearly depends on the plasma glucose concentration (Sauvaire, Y. et al., Diabetes, 47: 206-210, (1998)). Such glucose dependence is due to sulfonylurea (Drucker, DJ, Diabetes), the only insulinotropic agent currently used in the treatment of type 2 diabetes [Non-insulin-dependent diabetes mellitus (NIDD) mellitus (NIDDM)]. 47: 159-169, (1998)). As a result, hypoglycemia remains a commonly undesirable side effect of sulfonylurea treatment. (Jackson, J., and Bessler, R. Drugs, 22: 211-245; 295-320, (1981); Jennings, A. et al. Diabetes Care, 12: 203-208, (1989)). Improvement of glucose tolerance is also known. ((Am. J. Physiol. Endocrinol., Vol. 287, E463-E471, 2004). This glucose metabolism enhancing activity and its potential for application to pharmaceuticals and health foods have been reported (Japanese Patent Laid-Open No. Hei 6-157302). Publication; US2007-000463A1).

4-Hydroxy-L-isoleucine, found only in plants, because of its special insulinotropic action, is a type of diabetes that is characterized by insulin secretion deficiency associated with varying degrees of insulin resistance. May be regarded as a novel secretagogue with potential therapeutic potential (Broca, C. et al., Am. J. Physiol. 277 (Endocrinol. Metab. 40): E617-E623, (1999))
.

  An oxidation method of isoleucine depending on iron, ascorbic acid, 2-oxyglutaric acid, and oxygen utilizing dioxygenase activity in fenugreek extract has been reported as a method for producing 4-hydroxy-L-isoleucine (Phytochemistry, Vol. 44, No. 4, pp. 563-566, 1997). However, in this method, the enzyme activity is inhibited by a substrate at an isoleucine concentration of 20 mM or more, the enzyme has not been identified, the enzyme is derived from a plant extract, and is not easily obtained in large quantities. Is not stable, it is insufficient as a method for producing 4-hydroxy-L-isoleucine.

  An efficient eight-step synthesis is disclosed in which optically pure (2S, 3R, 4S) -4-hydroxy-L-isoleucine is obtained in 39% overall yield. The key steps in this synthesis include the bioconversion of ethyl 2-methylacetoacetate with Geotrichum candidum to ethyl (2S, 3S) -2-methyl-3-hydroxybutanoate, and asymmetric Strecker synthesis (Wang , Q. et al., Eur. J. Org. Chem., 834-839 (2002)).

  Chemo-enzymatic synthesis of (2S, 3R, 4S) -4-hydroxyisoleucine with fully controlled stereochemistry in 6 short steps has been announced, but the final step is immobilization on commercially available Eupergit C (E-PAC) This is an enzymatic resolution by hydrolysis of an N-phenylacetyllactone derivative using penicillin acylase G (Rolland-Fulcrand, V. et al., J. Org. Chem., 873-877 (2004)).

However, there are currently reports on the production of (2S, 3R, 4S) -4-hydroxy-L-isoleucine by cloning L-isoleucine dioxygenase and direct enzymatic hydroxylation of L-isoleucine using L-isoleucine dioxygenase There is no.

  Regarding the production of isoleucine analogues by microorganisms, there is a report of 2-amino-3-keto-4-methylpentanoic acid (AMKP) production by Bacillus bacteria [Bioorganic Chemistry, Vol. 6, pp.263-271 (1977). )]. However, there are no reports on microbial isoleucine hydroxylase.

  An object of the present invention is to produce 4-hydroxyisoleucine (also referred to as “4HIL”, also referred to as “4HIL”, hereinafter the same) using an enzyme derived from a microorganism that can be prepared in large quantities. It is to provide a method.

  The subject of the present invention also includes providing a microorganism having an enzyme activity for producing 4-hydroxyisoleucine from isoleucine, and a method for producing 4-hydroxyisoleucine from isoleucine by hydroxylation using a microorganism-derived enzyme. The The above object has been achieved by finding a microorganism having an enzyme activity for producing 4-hydroxyisoleucine from isoleucine.

  The subject of the present invention is (2S, 3R, 4S) -4-hydroxy-L-isoleucine (used to mean both free form and its salt form, also referred to as “(2S, 3R, 4S) -4HIL”). Hereinafter, the same) is improved by direct enzymatic hydroxylation of L-isoleucine using a microorganism having L-isoleucine dioxygenase or L-isoleucine dioxygenase activity (2S, 3R, 4S) -4 It is to provide a method for producing -hydroxy-L-isoleucine or a salt thereof. As a result of diligent research to solve the above problems, the inventors of the present application isolated a bacterium having high L-isoleucine dioxygenase activity from nature, cloned a gene encoding L-isoleucine dioxygenase, The inventors have found L-isoleucine dioxygenase that can be preferably used for the synthesis of 2S, 3R, 4S) -4-hydroxy-L-isoleucine, and have completed the present invention.

  That is, the object of the present invention is to provide novel L-isoleucine dioxygenase and DNAwo encoding L-isoleucine dioxygenase, and use (2S, 3R, 4S) -4-hydroxy-L-isoleucine of L-isoleucine dioxygenase. It is to provide a manufacturing method. The above object has been achieved by finding the novel L-isoleucine dioxygenase of the present invention.

  One of the objects of the present invention includes a step of subjecting isoleucine or a salt thereof to a hydroxylation reaction in the presence of a hydroxylase that produces 4-hydroxyisoleucine from isoleucine to produce 4-hydroxyisoleucine. It is providing the manufacturing method of 4-hydroxyisoleucine or its salt characterized by these.

  A further object of the present invention is to provide the production method as described above, wherein the microorganism belongs to the genus Bacillus.

  A further object of the present invention is to provide the production method described above, wherein the microorganism belonging to the genus Bacillus is a microorganism selected from Bacillus thuringiensis, Bacillus licheniformis, and Bacillus sphaericus.

  A further object of the present invention is to provide the production method as described above, wherein the hydroxylation reaction is carried out in the presence of a disrupted solution prepared from logarithmic growth phase cells of microorganisms.

A further object of the present invention is to provide the above production method in which L-isoleucine is subjected to a hydroxylation reaction.

  A further object of the present invention is to provide the production method as described above, wherein the hydroxylase is a dioxygenase.

A further object of the present invention is to provide the production method described above, wherein the hydroxylase has the following properties.
(A) Oxygen, Fe ²⁺ , ascorbic acid, and 2-oxoglutaric acid are required as cofactors.
(B) The optimum pH for the reaction is pH 5 to pH 8.
(C) The optimum reaction temperature is 45 ° C. or lower.
(D) Deactivates at 50 ° C. or higher.
(E) It is inhibited by EDTA, Cu ²⁺ and Zn ²⁺ .

A further object of the present invention is to provide a dioxygenase that has the following properties and can be isolated from Bacillus bacteria.
(A) Oxygen, Fe ²⁺ , ascorbic acid, and 2-oxoglutaric acid are required as cofactors.
(B) The optimum pH for the reaction is pH 5 to pH 8.
(C) The optimum reaction temperature is 45 ° C. or lower.
(D) Deactivates at 50 ° C. or higher.
(E) It is inhibited by EDTA, Cu ²⁺ and Zn ²⁺ .
(F) It consists of subunits having a molecular weight of 31,000 ± 20,000 as measured by sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
(G) It has the amino acid sequence shown in SEQ ID NO: 2 at the N-terminus.

  A further object of the present invention is to provide a dioxygenase as described above, wherein the Bacillus bacterium is Bacillus thuringiensis.

A further object of the present invention is to
(a) DNA comprising the nucleotide sequence of SEQ ID NO: 1,
(b) a DNA that hybridizes with a DNA having a base sequence complementary to the base sequence of SEQ ID NO: 1 under stringent conditions and encodes a protein having L-isoleucine dioxygenase activity;
(c) DNA encoding a protein having the amino acid sequence of SEQ ID NO: 2,
(d) a protein having an amino acid sequence including substitution, deletion, insertion, addition or inversion of one or several amino acid residues and having L-isoleucine dioxygenase activity in the amino acid sequence of SEQ ID NO: 2 DNA to do and
(e) DNA encoding a protein having an amino acid sequence showing at least 98% homology to the amino acid sequence of SEQ ID NO: 2 and having L-isoleucine dioxygenase activity
Providing DNA selected from the group consisting of:

  A further object of the present invention is to provide a recombinant DNA obtained by ligating a DNA containing the above and a vector DNA.

  A further object of the present invention is to provide cells transformed with recombinant DNA comprising the above.

A further object of the present invention includes culturing cells containing the above recombinant DNA in a medium, and accumulating a protein having L-isoleucine dioxygenase activity in the medium, cells or both, and thus L-isoleucine dioxygenase. It is to provide a method for producing a protein having activity.

A further object of the present invention is to
(f) a protein having the amino acid sequence of SEQ ID NO: 2,
(g) a protein having an amino acid sequence including substitution, deletion, insertion, addition or inversion of one or several amino acid residues in the amino acid sequence of SEQ ID NO: 2 and having L-isoleucine dioxygenase activity; and ,
(h) To provide a protein selected from the group consisting of proteins having an amino acid sequence showing at least 98% homology to the amino acid sequence of SEQ ID NO: 2 and having L-isoleucine dioxygenase activity.

A further object of the present invention is to provide a protein having the following properties:
(A) It has an activity of catalyzing a reaction for producing (2S, 3R, 4S) -4-hydroxy-L-isoleucine by hydroxylation of L-isoleucine.
(B) The activity depends on the divalent cation Fe ²⁺ .
(C) The molecular weight measured by SDS-PAGE is about 29 ± 2.0 kDa.

A further object of the present invention is to
(f) a protein having the amino acid sequence of SEQ ID NO: 2, 8, 13, 17 or 21;
(g) L-isoleucine having an amino acid sequence comprising substitution, deletion, insertion, addition or inversion of one or several amino acid residues in the amino acid sequence of SEQ ID NO: 2, 8, 13, 17 or 21 A protein having dioxygenase activity, and
(h) at least one selected from the group consisting of proteins having an amino acid sequence showing at least 70% homology to the amino acid sequence of SEQ ID NO: 2, 8, 13, 17 or 21 and having L-isoleucine dioxygenase activity Reacting L-isoleucine in an aqueous solvent in the presence of the species L-isoleucine dioxygenase and isolating the resulting (2S, 3R, 4S) -4-hydroxy-L-isoleucine (2S, 3R , 4S) -4-hydroxy-L-isoleucine or a salt thereof.

A further object of the present invention is to
(f) a protein having the amino acid sequence of SEQ ID NO: 2, 8, 13, 17 or 21;
(g) L-isoleucine having an amino acid sequence comprising substitution, deletion, insertion, addition or inversion of one or several amino acid residues in the amino acid sequence of SEQ ID NO: 2, 8, 13, 17 or 21 A protein having dioxygenase activity, and
(h) L- selected from the group consisting of proteins having an amino acid sequence showing at least 70% homology to the amino acid sequence of SEQ ID NO: 2, 8, 13, 17, or 21 and having L-isoleucine dioxygenase activity Reacting L-isoleucine in an aqueous solvent in the presence of bacteria containing isoleucine dioxygenase and isolating the resulting (2S, 3R, 4S) -4-hydroxy-L-isoleucine (2S, 3R, It is to provide a process for producing 4S) -4-hydroxy-L-isoleucine or a salt thereof.

  It is a further object of the present invention to provide the above method wherein the bacterium has been modified to enhance the activity of L-isoleucine dioxygenase.

  A further object of the present invention is to provide the above method wherein the activity of L-isoleucine dioxygenase is enhanced by increasing the expression of the gene encoding said L-isoleucine dioxygenase.

A further object of the present invention is to modify the expression regulatory sequence of the gene encoding L-isoleucine dioxygenase or increase the copy number of the gene encoding L-isoleucine dioxygenase. It is to provide a method as described above that is enhanced.

A further object of the present invention is that the bacterium is Escherichia, Pseudomonas, Corynebacterium,
It is to provide the above method belonging to the genus Arthrobacter, Aspergillus or Bacillus.

  A further object of the present invention is to provide the above method wherein the bacterium belongs to Escherichia coli, Arthrobacter simplex, Corynebacterium glutamicum, Arthrobactor globiformis, Arthrobactor sulfureus, Arthrobactor viscosus or Bacillus subtilis.

  A further object of the present invention is to provide the method as described above, wherein the bacterium is a bacterial culture, a cell, a cell treatment product or a cell lysate.

  In this specification, 4-hydroxyisoleucine means (2S, 3S, 4S) -4-hydroxyisoleucine [(2S, 3S, 4S) -4-hydroxyisoleucine], (2S, 3R, 4R) -4-hydroxyisoleucine [(2S, 3R, 4R) -4-hydroxyisoleucine], (2S, 3S, 4R) -4-hydroxyisoleucine [(2S, 3S, 4R) -4-hydroxyisoleucine] and (2S, 3R, 4S) -4- One or two or more diastereomeric mixtures selected from the group consisting of hydroxyisoleucine [(2S, 3R, 4S) -4-hydroxyisoleucine]. 4-hydroxyisoleucine is preferably (2S, 3R, 4S) or (2R, 3R, 4S) -4-hydroxyisoleucine or a mixture thereof, more preferably (2S, 3R, 4S) − 4-hydroxyisoleucine.

  In particular, “(2S, 3R, 4S) -4-hydroxy-L-isoleucine” or “(2S, 3R, 4S) -4-HIL” refers to a single compound or (2S, 3R, 4S) -4- Sometimes refers to a mixture containing hydroxyisoleucine.

  As used herein, the term “bacteria” or “microorganism” encompasses enzyme-producing bacteria or microorganisms, mutants and genetically modified organisms of such bacteria or microorganisms that have or have an enhanced enzyme activity of interest. .

<I> Enzyme activity for producing 4HIL from isoleucine As the hydroxylase used in the method for producing 4-hydroxyisoleucine via the isoleucine hydroxylation reaction by the hydroxylase of the present invention, the enzyme activity for converting isoleucine to 4-hydroxyisoleucine As long as it has, it is possible to use any of a microorganism culture, a microbial cell, a crudely purified enzyme using a cell lysate, or a purified enzyme.

  Examples of the hydroxylase include oxygenase and dioxygenase, and dioxygenase is preferable. More preferably, it is a hydroxylase that can be isolated from the 2-e-2 strain and has the following properties.

(A) Oxygen, Fe ²⁺ , ascorbic acid, and 2-oxoglutaric acid are required as cofactors.
(B) The optimum pH for the reaction is pH 5 to pH 8.
(C) The optimum reaction temperature is 45 ° C. or lower.
(D) Deactivates at 50 ° C. or higher.
(E) It is inhibited by EDTA, Cu ²⁺ and Zn ²⁺ .

Hydroxylase that can be isolated from 2-e-2 strain further has the following properties.
(F) It consists of subunits having a molecular weight of 31,000 ± 20,000 as measured by sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
(G) It has the amino acid sequence shown in SEQ ID NO: 2 at the N-terminus.

When the hydroxylase requires a cofactor, it is preferable to add or supply the cofactor to the system. Examples of cofactors include Fe ²⁺ , ascorbic acid, and 2-ketoglutaric acid in the case of dioxygenase. If these cofactors can be converted to salts, they may be added or supplied to the system as salts.

  Any microorganism can be used as long as it has an enzyme activity for converting isoleucine to 4-hydroxyisoleucine under hydroxylation conditions.

  Examples of the microorganism used include microorganisms belonging to the genus Bacillus, or mutants and derivatives thereof. Moreover, it is the microorganism which expressed the said hydroxylase recombinantly, Comprising: You may have an activity which produces | generates 4-hydroxyisoleucine.

  Specific examples include Bacillus thuringiensis (2-e-2, AKU238, NBRC3958, ATCC35646, etc.), Bacillus licheniformis (AKU223, IAM11054, etc.) and Bacillus sphaericus (AKU227, NBRC3526, etc.). . The 2-e-2 strain is named AJ110584, and based on the Budapest Treaty, the National Institute of Advanced Industrial Science and Technology Patent Biology Center (Postal Code 305-8566 Tsukuba, Ibaraki, Japan) It is deposited as FERM BP-10688 in 1-Chome, 1-Chome, Ichi-Chito, Central 6).

Regarding the above microorganisms, those whose stock name begins with AKU can be purchased from the Department of Fermentation Physiology and Brewing Science, Department of Applied Life Sciences, Graduate School of Agriculture, Kyoto University. Those whose stock names begin with IAM are stored in the IAM collection of the Institute of Molecular Cell Biology, the University of Tokyo, and can be sold using the registration number. The registration number corresponding to each strain is described in the IAM catalog (IAM Catalog of strain Third
Edition, 2004). Those whose stock names begin with NBRC can be sold from the National Institute of Technology and Evaluation (2-5-8 Kazusa Kamashi, Kisarazu City, Chiba Prefecture 292-0818). Those whose stock name begins with ATCC can be purchased from the American Type Culture Collection (ATCC) (address ATCC, Address: PO Box 1549, Manassas, VA 20108, 1, United States of America).

  Bacillus thuringiensis 2-e-2 strain is a strain newly isolated from the soil of Kyoto City by the present inventors, and its scientific properties are shown below.

Taxonomic properties of Bacillus thuringiensis 2-e-2
1. Phenotypic plasma cell morphology Neisseria gonorrhoeae (size: 1.0-1.2 × 2.0-3.0 μm)
Gram stain +
Endospore +
Attitude toward oxygen Aerobic growth temperature Good growth optimum at 20-35 ° C pH 7.0-7.5

2. Molecular phylogenetic analysis based on the base sequence of 16S rDNA Using the base sequence of 16S rDNA of this 2-e-2 strain (SEQ ID NO: 1), the BLAST bacterial reference database (NCB Japan, Shizuoka) and A homology search was performed on the international nucleotide sequence database (GeneBank / DDBJ / EMBL) to determine the top 30 strains with the same homology rate. Then, a molecular phylogenetic tree was created by the neighborhood binding method using the top 30 strains searched in the bacterial reference strain database and the 16S rDNA base sequences of each specimen. DNASISpro (Hitachi Software Engineering, Tokyo) was used for homology search and creation of a simple molecular phylogenetic tree.

  As a result of homology search against a bacterial reference strain database using BLAST, the 16S rDNA partial nucleotide sequence of the 2-e-2 strain was 100% homologous and matched with the 16S rDNA of the Bacillus thuringiensis ATCC10792 strain. Also in the result of homology search against GenBank / DDBJ / EMBL, 16S rDNA of 2-e-2 strain showed high homology to Bacillus thuringiensis. In addition, as a result of simple molecular phylogenetic analysis using 16S rDNA of 2-e-2 strain and 16S rDNA of the top 30 homology search against the bacterial reference strain database, 2-e-2 strain was almost identical to 16S rDNA of Bacillus thuringiensis It was shown that it was very closely related.

3. Results of classification and identification As a result of simple morphology observation, 2-e-2 strain showed general properties of Bacillus. From the results of 16S rDNA partial sequence analysis, 2-e-2 strain was assigned to Bacillus thuringiensis. It was shown to do. Since no microorganism showing AMKP production activity at the same level as 2-e-2 was found, this strain was identified as a new strain.

  The microorganism used in the present invention can be cultured according to a normal culture method. The medium used for the culture may be a natural medium or a synthetic medium as long as it contains a carbon source, a nitrogen source, inorganic salts, and the like that can be assimilated by the microorganism to be used and can efficiently culture the microorganism.

  Any carbon source may be used as long as the microorganism to be used can assimilate, sugars such as glucose, fructose, sucrose, maltose, starch, starch hydrolyzate, molasses, organic acids such as acetic acid, lactic acid, and gluconic acid, Alternatively, alcohols such as ethanol and propanol can be used. As the nitrogen source, as long as the microorganism to be used can assimilate, ammonium salts of various inorganic acids and organic acids such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, and ammonium phosphate, other nitrogen-containing compounds, peptone, meat extract Yeast extract, corn steep liquor, casein hydrolyzate, soybean meal and soybean meal hydrolyzate, various fermented cells and digests thereof, and the like.

  As the inorganic salt, potassium phosphate, ammonium sulfate, ammonium chloride, sodium chloride, magnesium sulfate, ferrous sulfate, manganese sulfate and the like can be used as long as the microorganism to be used can utilize. In addition, salts such as calcium, zinc, boron, copper, cobalt, and molybdenum may be added as trace elements. If necessary, vitamins such as thiamine and biotin, amino acids such as glutamic acid and aspartic acid, and nucleic acid-related substances such as adenine and guanine may be added.

  The culture is performed under aerobic conditions such as shaking culture or deep aeration stirring culture. The culture temperature is preferably 10 to 37 ° C., and the culture time is 5 to 40 hours. During the cultivation, the pH is maintained at 5.0 to 9.0. The pH is adjusted using an inorganic or organic acid, an alkaline solution, urea, calcium carbonate, ammonia or the like.

  The cell disruption crude enzyme used in the present invention, that is, the microorganism cell disruption solution only needs to contain a hydroxylase outside the cell, and the cell surface active agent or organic solvent-treated product, enzyme-treated product, Examples thereof include ultrasonically treated products, mechanically milled products, solvent-treated products, bacterial cell protein fractions, and immobilized bacterial cell products. The cell lysate is preferably prepared from logarithmic growth phase cells.

  Regarding cell lysate preparation methods, the cultured cells are washed with an isotonic solution such as physiological saline, and then pressed and crushed with a French press, glass beads, ultrasonic crusher, Menton Gaurin homogenizer, mortar, etc. Any method such as a combination thereof may be used. Furthermore, for efficient disruption, the cell membrane surface may be subjected to physical and chemical treatment by freezing or enzymatic treatment. At the time of cell disruption, the temperature is always maintained at a low temperature, and when the temperature of the disrupted liquid rises due to the disruption process, it may be quickly cooled.

  Examples of the aqueous medium for the cell lysate include, but are not limited to, buffers such as water, borate, acetate, carbonate, tris, phosphate, citrate, and Good's buffer. Glycerol, DTT, etc. may be added as an enzyme stabilizer, EDTA, EGTA, PMSF, pepstatin, E-64, etc. may be added as protease inhibitors, combinations of inhibitors, and inhibition. An agent cocktail or the like may be added.

The composition of the substrate solution for the 4-hydroxyisoleucine production reaction using the above cell disruption solution was 100 mM HEPES buffer (pH 7.7) containing 5 mM isoleucine, 5 mM 2-ketoglutaric acid, 5 mM ascorbic acid, 5 mM Fe ²⁺ . 0), make the volume 100 μl, and react at 30 ° C. for 60 minutes. In addition to HEPES, the buffer may be any buffer such as MES or GTA broad-area buffer. The reaction solution is enzyme-inactivated as necessary, the centrifugal supernatant fraction is filtered and the production of 4-hydroxyisoleucine is confirmed using high performance liquid chromatography or TLC.

For determination of 4-hydroxyisoleucine, any method may be used as long as it is an analysis system that can be separated from other components, and examples thereof include TLC and high-performance liquid chromatography. Among these, high performance liquid chromatography is excellent for quantitative analysis because of its high sensitivity and high separation. For example, the Waters AccQ / Tag ^™ method of amino acid analysis method can be mentioned. The Waters AccQ · Tag ^TM methods modified method (see Example), diastereomeric separation or 4-hydroxy isoleucine, natural bodies of 4-hydroxy isoleucine and 4-hydroxy-keto body hydroxyl groups are oxidized isoleucine, Separation of 2-amino-3-methyl-4-ketopentanoic acid is possible.

  4-Hydroxyisoleucine produced according to the present invention can be isolated using a commonly used amino acid purification method. For example, 4-hydroxyisoleucine can be isolated from the reaction solution supernatant from which solids have been removed by centrifugation, by combining operations such as ion exchange resin, membrane treatment, and crystallization.

In the production method of the present invention, the pH of the isoleucine hydroxylation reaction is preferably pH 5-8. As a composition of the reaction solution, it is preferable that an essential factor for the enzyme reaction is present. When Fe ²⁺ is essential as a factor, a reaction solution composition that is less likely to chelate with Fe ²⁺ , such as HEPES buffer, MES buffer, and GTA broad-area buffer, is desirable, but if the action of Fe ²⁺ is retained There are no restrictions.

In the production method of the present invention, the temperature of the isoleucine hydroxylation reaction is usually 15 to 30 ° C. and preferably 45 ° C. or less. The reaction time varies depending on the amount of enzyme, but is usually 5 minutes to 200 hours.
As isoleucine to be subjected to the hydroxylation reaction, L-isoleucine is preferably used.

Solvents for carrying out the reaction include aqueous solvents such as water, carbonates, acetates, borates, citrates, and tris buffers, alcohols such as methanol and ethanol, esters such as ethyl acetate, Examples include organic solvents such as ketones such as acetone, amides such as acetamide, and aqueous solvents containing these. Moreover, you may add a hydroxylation reaction activator as needed.

  The protein concentration of the microbial cell disruption solution used in the production method of the present invention is 0.1 to 50 mg / ml, preferably 0.5 to 20 mg / ml (in terms of microbial cells (wet weight)). Appropriate concentrations of the microorganism disruption solution, substrate and cofactor are added to the aqueous medium, and the temperature is 45 ° C. or lower, preferably 30 ° C., pH 5 to 12, preferably pH 5 to 7.5, and 5 minutes to 120 minutes. By reacting for a period of time, 4-hydroxy-L-isoleucine can be produced.

<II> DNA encoding L-isoleucine dioxygenase and L-isoleucine dioxygenase and uses thereof [I] L-isoleucine dioxygenase and [II] L-isoleucine dioxygenase of the present invention are used below (2S, A method for producing 3R, 4S) -4-hydroxy-L-isoleucine will be described in detail with reference to the drawings.

[I] L-isoleucine dioxygenase According to the study of the inventors of the present invention, L-isoleucine dioxygenase having the ability to produce (2S, 3R, 4S) -4HIL was confirmed in a bacterial strain of the genus Bacillus. Hereinafter, L-isoleucine dioxygenase derived from microbial cells is abbreviated as IDO.

  As described above, by screening environmental microorganisms prepared by the inventors of the present invention, Bacillus thuringiensis 2-e-2 strain, which is a unique microorganism, has been obtained from L-isoleucine by (2S, 3R, 4S) -4HIL. It has been shown that it has an activity capable of catalyzing a reaction directly generated. The inventors of the present invention have purified and isolated novel L-isoleucine dioxygenase from cultured cells of microorganisms. Hereinafter, this is abbreviated as IDO (Lys, 23).

  Furthermore, the inventors of the present invention determined the N-terminal amino acid sequence of IDO (Lys, 23) by purifying dioxygenase derived from Bacillus thuringiensis 2-e-2 strain. The Bacillus thuringiensis 2-e-2 strain is named Bacillus thuringiensis AJ110584, and based on the Budapest Treaty, the National Institute of Advanced Industrial Science and Technology Patent Biology Center (Postal Code 305-8566 Ibaraki, Japan) It is deposited as FERM BP-10688 in 1-6 Higashi 1-chome, Tsukuba City, Prefecture 6).

  Furthermore, the inventors of the present invention synthesize a synthetic DNA molecule of about 30 base pairs deduced from the amino acid sequence of IDO (Lys, 23) and use the chromosomal DNA of Bacillus thuringiensis 2-e-2 strain, Isolation of full-length DNA encoding IDO (Lys, 23) and L-isoleucine dioxygenase (hereinafter abbreviated as IDO (Lys, 32)) from Bacillus thuringiensis (serovar israelensis) strain (ATCC 35646) as a control And obtained recombinant plasmids and E. coli transformed cells using them. Subsequent analysis of recombinant E. coli IDO activity revealed that IDO (Lys, 23) activity was detected as a result of a unique mutation in the IDO (Lys, 23) gene from Bacillus thuringiensis 2-e-2. It was found to be extremely high (5 times higher) than (Lys, 32).

  The DNA encoding IDO (Lys, 23) of the present invention identified as described in the Examples is shown in SEQ ID NO: 1 in the Sequence Listing. Furthermore, the amino acid sequence of IDO (Lys, 23) encoded by the base sequence of SEQ ID NO: 1 is shown in SEQ ID NO: 2. SEQ ID NO: 2 is the amino acid sequence of IDO (Lys, 23) encoded by the base sequence of SEQ ID NO: 1. IDO (Lys, 23) of SEQ ID NO: 2 has L-isoleucine dioxygenase activity, and has a reaction of directly synthesizing (2S, 3R, 4S) -4HIL represented by the following formula (I) from one L-isoleucine molecule. Catalyze.

  Next, (1) DNA encoding L-isoleucine dioxygenase, (2) properties of L-isoleucine dioxygenase, and (3) a method for producing L-isoleucine dioxygenase will be described in detail.

(1) DNA encoding L-isoleucine dioxygenase
The IDO (Lys, 23) gene of the present invention having the nucleotide sequence of SEQ ID NO: 1 was isolated from chromosomal DNA of Bacillus thuringiensis 2-e-2 strain as described in the Examples. The base sequence of SEQ ID NO: 1 derived from Bacillus thuringiensis 2-e-2 strain encoding IDO (Lys, 23) is against the non-annotated portion of the genomic base sequence derived from Bacillus thuringiensis (serovar israelensis) strain (ATCC 35646). They showed high homology in the base sequence (FIG. 19) and amino acid sequence (FIG. 18). One of the genome sequences was submitted to the National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA (Accession No: AAJM00000000.1, GI: 74494335) on January 17, 2007, and , Another one encodes IDO (Lys, 32) of the same Bacillus thuringiensis (serovar israelensis) strain stored and received from the Russian National Collection of Industrial Microorganisms (VKPM) with the accession number of VKPM B-197 It was obtained as a result of sequencing of genomic DNA. The nucleotide sequence derived from Bacillus thuringiensis (serovar israelensis) strain VKPM B-197 encoding IDO (Lys, 32) is shown in SEQ ID NO: 7.

Hereinafter, a method for obtaining the amino acid sequence of IDO from IDO-producing bacteria will be described.
The major protein was recovered from the gel and identified by MS analysis as a putative RBTH — 06809 protein from Bacillus thuringiensis (serovar israelensis) ATCC 35646 strain (FIG. 13).

  Mass spectrometry of protein samples extracted from SDS-PAGE was performed. Gel processing, trypsin digestion, protein extraction, and mass spectrometry with time-of-flight matrix-assisted laser desorption ionization (MALDI-TOF) are described in Govorun, VM et al, (The proteome comparative analysis of Helicobacter pylori clinical isolates. Biochemistry (Mosc ), 68, 1, 42-49 (2003)). Proteins were identified by a set of photolytic peptide masses using the Peptide Fingerprint option of Mascot software (Matrix Science, USA).

  A DNA fragment encoding IDO can be obtained by PCR using appropriate primers designed based on the sequence of Bacillus thuringiensis (serovar israelensis) strain (ATCC 35646).

  Procedures used for PCR are described in documents such as White, T.J. et al., Trends Genet. 5, 185 (1989). Methods for isolating chromosomes and methods for isolating target DNA molecules from gene libraries using DNA molecules as probes are described in documents such as Molecular Cloning, 3rd edition, Cold Spring Harbor Laboratory Press (2001). Yes.

The method for determining the base sequence of isolated DNA encoding IDO is described in A Practical Guide to Molecul.
ar Cloning, John Wiley & Sons, Inc. (1985). Furthermore, the base sequence can be determined using a DNA sequencer manufactured by Applied Biosystems. A DNA encoding IDO (Lys, 23) derived from Bacillus thuringiensis 2-e-2 strain is shown in SEQ ID NO: 1. The base sequence encoding IDO (Lys, 32) derived from Bacillus thuringiensis (serovar israelensis) strain VKPM B-197 is shown in SEQ ID NO: 7.

  The DNA encoding IDO that catalyzes the reaction of producing (2S, 3R, 4S) -4HIL from L-isoleucine is not limited to the DNA shown in SEQ ID NO: 1. This is because there should be a difference in the nucleotide sequence found in each species producing IDO that catalyzes the reaction of producing (2S, 3R, 4S) -4HIL from L-isoleucine, and in Bacillus strains.

  The DNA of the present invention includes not only isolated DNA encoding IDO, but also DNA obtained by artificially adding mutation to DNA encoding IDO isolated from the chromosomal DNA of an IDO-producing microorganism. As long as it encodes IDO having catalytic activity, it is included in the DNA of the present invention. Methods for artificially adding mutations include commonly used methods such as the method for introducing site-specific mutations described in Method. In Enzymol., 154 (1987).

  A DNA that hybridizes under stringent conditions with a DNA having a base sequence complementary to the base sequence of SEQ ID NO: 1 and encodes a protein having IDO activity is also included in the DNA of the present invention. Here, “stringent conditions” refers to conditions under which so-called specific hybrids are formed and non-specific hybrids are not formed. Although it is difficult to indicate these conditions numerically, for example, highly homologous DNAs, for example, 70% or higher, preferably 80% or higher, more preferably 90% or higher, particularly preferably 95% or higher. DNA which has the property of hybridizing and DNA having lower homology does not hybridize with each other, or 37 ° C., 0.1 × SSC, 0.1% SDS, which is a washing condition of normal Southern hybridization Preferably, a salt concentration corresponding to 60 ° C., 0.1 × SSC, 0.1% SDS, and more preferably 65 ° C., 0.1 × SSC, 0.1% SDS can be mentioned. The length of the probe is appropriately selected depending on the hybridization conditions, but is usually 100 bp to 1 Kbp. Furthermore, “L-isoleucine dioxygenase activity” may be any activity that synthesizes (2S, 3R, 4S) -4HIL from L-isoleucine. However, in the case of a base sequence that hybridizes under stringent conditions with DNA having a base sequence complementary to the base sequence of SEQ ID NO: 1, the protein having the amino acid sequence of SEQ ID NO: 2 is subjected to 37 ° C., pH 8 Under these conditions, it is preferable to retain 10% or more, preferably 30% or more, more preferably 50% or more, and still more preferably 70% or more of L-isoleucine dioxygenase activity.

Furthermore, DNA encoding a protein substantially identical to IDO encoded by the DNA of SEQ ID NO: 1 is also included in the DNA of the present invention. That is, the following DNA is also included in the DNA of the present invention.
(a) DNA comprising the nucleotide sequence of SEQ ID NO: 1,
(b) a DNA that hybridizes with a DNA having a base sequence complementary to the base sequence of SEQ ID NO: 1 under stringent conditions and encodes a protein having L-isoleucine dioxygenase activity;
(c) DNA encoding a protein having the amino acid sequence of SEQ ID NO: 2,
(d) a protein having an amino acid sequence including substitution, deletion, insertion, addition or inversion of one or several amino acid residues and having L-isoleucine dioxygenase activity in the amino acid sequence of SEQ ID NO: 2 DNA to do and
(e) DNA encoding a protein having an amino acid sequence showing at least 98% homology to the amino acid sequence of SEQ ID NO: 2 and having L-isoleucine dioxygenase activity
DNA selected from the group consisting of

Here, “several” is a range in which the 3D structure or L-isoleucine dioxygenase activity of the amino acid residue protein is not substantially impaired, specifically 1 to 78, preferably 1 to 52, more preferably 1 to 25, still more preferably 1 to 13.

  The substitution, deletion, insertion, or addition of one or several amino acids described above is a conservative mutation that maintains the enzyme activity. A typical conservative mutation is a conservative substitution. Examples of conservative substitutions include Ala to Ser or Thr substitution, Arg to Gln, His or Lys substitution, Asn to Glu, Gln, Lys, His or Asp substitution, Asp to Asn, Glu or Gln. Substitution, Cys to Ser or Ala, Gln to Asn, Glu, Lys, His, Asp or Arg, Glu to Asn, Gln, Lys or Asp, Gly to Pro Substitution from His to Asn, Lys, Gln, Arg or Tyr, Ile to Leu, Met, Val or Phe, Leu to Ile, Met, Val or Phe, Lys to Asn, Glu, Gln, His Or Arg, Met to Ile, Leu, Val or Phe, Phe to Trp, Tyr, Met, Ile or Leu, Ser to Thr or Ala, Thr to Ser or Ala Substitution, substitution from Trp to Phe or Tyr, substitution from Tyr to His, Phe or Trp, and substitution from Val to Met, Ile or Leu.

  Furthermore, “L-isoleucine dioxygenase activity” means an activity of synthesizing (2S, 3R, 4S) -4HIL from L-isoleucine as described above. However, in the amino acid sequence of SEQ ID NO: 2, in the case of an amino acid sequence including substitution, deletion, insertion, addition or inversion of one or several amino acid residues, the protein having the amino acid sequence of SEQ ID NO: 2 Thus, it is preferable to maintain L-isoleucine dioxygenase activity of 10% or more, preferably 30% or more, more preferably 50% or more, and still more preferably 70% or more under the conditions of 37 ° C. and pH 6.0. The L-isoleucine dioxygenase activity of IDO of the present invention can be measured by analysis of (2S, 3R, 4S) -4HIL production from L-isoleucine using high performance liquid chromatography (HPLC).

  Furthermore, the homolog DNA of SEQ ID NO: 1 can also be used as a gene encoding the L-isoleucine dioxygenase of the present invention. Whether or not the homolog DNA encodes L-isoleucine dioxygenase can be confirmed by measuring the L-isoleucine dioxygenase activity of a cell disruption solution or a cell disruption solution of a microorganism overexpressing the homolog DNA.

  The homologous DNA of SEQ ID NO: 1 can also be prepared from the genome of other Bacillus species such as Bacillus cereus, Bacillus weihenstephanensis as the L-isoleucine dioxygenase of the present invention.

  The alignment of the amino acid sequences of Bacillus cereus, Bacillus thuringiensis, Bacillus weihenstephanensis is shown in FIG. A sequence conserved in the genus Bacillus is shown in SEQ ID NO: 6.

Homologous DNAs encoded by other bacteria are Bacillus, Escherichia, Corynebacterium,
Arthrobacter, Aspergillus, Pseudomonas, Granulibacter, Methylobacillus, Granulibacter, Acidiphilium, Agrobacterium, Gluconobacter, Caulobacter, Stigmatella, Myxococcus, Polaromonas, Caulobacter, Polaromonas, Sphingomonas, Vitroactiob And cloning based on the homology of the genes listed in (1). Homolog DNA can be amplified by PCR using synthetic oligonucleotides shown in SEQ ID NOs: 3 and 4, for example.

(2) Properties of IDO Next, the properties of the purified L-isoleucine dioxygenase (IDO (Lys, 23)) derived from Bacillus thuringiensis 2-e-2 strain will be described.

The IDO (Lys, 23) of the present invention has the amino acid sequence of SEQ ID NO: 2 as determined by the above gene isolation and analysis. However, the present invention relates to SEQ ID NO: 2, 8, 13, 17 or 21
And a protein having an L-isoleucine dioxygenase activity, having an amino acid sequence including substitution, deletion, insertion, addition or inversion of one or several amino acid residues.

That is, the IDO of the present invention includes the following proteins.
(f) a protein having the amino acid sequence of SEQ ID NO: 2, 8, 13, 17 or 21;
(g) L-isoleucine having an amino acid sequence comprising substitution, deletion, insertion, addition or inversion of one or several amino acid residues in the amino acid sequence of SEQ ID NO: 2, 8, 13, 17 or 21 A protein having dioxygenase activity, and
(h) a protein having an amino acid sequence showing at least 70% homology to the amino acid sequence of SEQ ID NO: 2, 8, 13, 17 or 21 and having L-isoleucine dioxygenase activity

  Here, the definitions of “several” and “L-isoleucine dioxygenase activity” are the same as those defined in the section (1) DNA encoding L-isoleucine dioxygenase.

  The IDO of the present invention catalyzes a reaction for synthesizing (2S, 3R, 4S) -4HIL from L-isoleucine by a hydroxylation reaction.

  The L-isoleucine dioxygenase activity of IDO of the present invention can be measured by analysis of (2S, 3R, 4S) -4HIL production from L-isoleucine using high performance liquid chromatography (HPLC).

  The IDO of the present invention catalyzes a reaction for synthesizing (2S, 3R, 4S) -4HIL from L-isoleucine by a hydroxylation reaction. In a hydroxylation reaction catalyzed by dioxygenase, one atom of molecular oxygen is introduced into L-isoleucine and the other oxygen atom is introduced into another oxygen acceptor, such as α-ketoglutarate. As a result, carbon dioxide is liberated and (2S, 3R, 4S) -4HIL and succinic acid are formed. Dioxygenase can stereospecifically hydroxylate aliphatic carbon chains. An example of a plant enzyme capable of catalyzing a hydroxylation reaction using L-isoleucine as a substrate has been reported for L-isoleucine dioxygenase derived from fenugreek extract (Phytochemistry, Vol. 44, No. 4, pp. 563-566). , 1997). However, in this method, the enzyme activity is inhibited by a substrate at an isoleucine concentration of 20 mM or more, the enzyme has not been identified, the enzyme is derived from a plant extract, and is not easily obtained in large quantities. Is not stable, it is insufficient as a method for producing 4-hydroxy-L-isoleucine.

Next, the enzymatic properties examined for purified IDO (Lys, 23) will be described.
IDO (Lys, 23) catalyzes a reaction for producing (2S, 3R, 4S) -4HIL represented by (I) below from L-isoleucine in the following reaction.

  Therefore, a method for producing (2S, 3R, 4S) -4HIL from L-isoleucine using the IDO (Lys, 23) of the present invention is also included in the present invention.

Furthermore, the activity of IDO (Lys, 23) of the present invention is strictly dependent on the divalent cation Fe ²⁺ and is completely inhibited by the presence of EDTA. IDO (Lys, 23) transfers one oxygen atom to L-isoleucine and the other oxygen atom to α-ketoglutarate, which is an acceptor molecule. Therefore, IDO (Lys, 23) belongs to the α-ketoglutamate-dependent dioxygenase.

The subunit molecular weight of IDO (Lys, 23) measured by SDS-PAGE is about 29 ± 2.0 kDa. Accordingly, the present invention also includes proteins defined by the following properties.
(A) It has an activity of catalyzing a reaction for producing (2S, 3R, 4S) -4-hydroxy-L-isoleucine by hydroxylation of L-isoleucine.
(B) The activity depends on the divalent cation Fe ²⁺ .
(C) The molecular weight measured by SDS-PAGE is about 29 ± 2.0 kDa.

  IDO (Lys, 32) from Bacillus thuringiensis (serovar israelensis) strain VKPM B-197 has the amino acid sequence of SEQ ID NO: 8.

(3) Method for Producing L-Isoleucine Dioxygenase Next, the method for producing IDO of the present invention will be described. There are two methods for producing the IDO of the present invention. These include (i) a method of culturing IDO-producing microorganisms to generate and accumulate IDO, and (ii) preparing transformants that produce IDO by recombinant DNA technology, cultivating trait endurance and accumulating IDO. It is a method to do.

(i) Method for generating and accumulating IDO by microbial culture
In the method for producing and accumulating IDO by culturing IDO-producing microorganisms, examples of microorganisms that are the source of IDO include microorganisms belonging to the genus Escherichia, Pseudomonas, Corynebacterium, Arthrobacter, Aspergillus, or Bacillus.

  Bacillus, Escherichia, Corynebacterium, Arthrobacter, Aspergillus, Pseudomonas, Granulibacter, Methylobacillus, Granulibacter, Acidiphilium, Agrobacterium, Gluconobacter, Caulobacter, Stigmatella, Myxococcus, Polaromonas, Vibriobacteria, Polaromonascobacteria Can be used in the present invention as long as the microorganism belonging to the above group produces IDO that catalyzes the reaction of synthesizing (2S, 3R, 4S) -4HIL from L-isoleucine and α-ketoglutarate. Preferred microorganisms include the Bacillus thuringiensis 2-e-2 strain and the Bacillus thuringiensis (serovar israelensis; ATCC 35646) strain. Of these, Bacillus thuringiensis 2-e-2 strain is particularly preferred.

  A microorganism as an IDO acquisition source can be cultured in any form such as liquid culture or solid culture, but an industrially advantageous method is deep aeration and agitation culture. Carbon sources, nitrogen sources, inorganic salts, and other micronutrients commonly used in microbial culture can be used as nutrient components of the nutrient medium. All nutrient sources can be used as long as the microorganism used is available.

  The culture is performed under aerobic conditions such as shaking culture and deep-ventilation stirring culture. The culture temperature may be in a range where microorganisms grow and IDO is produced. Therefore, although the conditions are not strict, the culture temperature is usually 10 to 50 ° C., preferably 15 to 42 ° C. The culture time varies depending on other culture conditions. For example, it may be cultured until a large amount of IDO is produced, and is usually about 5 to 7 days, preferably about 10 to 96 hours.

  After incubation, the microbial cells are collected by centrifugation (10,000xg, 10 minutes). Since most of IDO is present in the cells, IDO is solubilized by disrupting or lysing microbial cells. Ultrasonic crushing, French press crushing or glass bead crushing can be used for crushing microbial cells. When cells are lysed, egg white lysozyme, peptidase treatment or an appropriate combination thereof can be employed.

  When purifying IDO from IDO-producing microorganisms, IDO can be purified using the enzyme-solubilized solution of the starting material, but if undisrupted or undissolved residue remains, re-centrifuge the lysate and remove the residue. Precipitation is advantageous for purification.

  All of the methods commonly used to purify common enzymes can be used for IDO purification. Examples thereof are ammonium sulfate precipitation, gel filtration chromatography, ion exchange chromatography, hydrophobic interaction chromatography, hydroxyapatite chromatography. As a result, an IDO-containing fraction having a higher specific activity is obtained.

(ii) Manufacturing Method Using Recombinant DNA Technology Next, an IDO manufacturing method using the recombinant DNA technology will be described. There are numerous known examples of producing useful proteins such as enzymes and physiologically active substances using recombinant DNA technology. The use of recombinant DNA technology allows for the mass production of useful proteins that are only naturally present in trace amounts.

FIG. 11 is a flowchart of a method for manufacturing the IDO of the present invention.
First, DNA encoding the IDO of the present invention is prepared (step S1).

  Next, the prepared DNA is ligated with vector DNA to produce recombinant DNA (step S2), and a transformant is produced by transforming cells with the recombinant DNA (step S3). Subsequently, the transformant is cultured in a medium, and IDO is generated and accumulated in the medium, cells, or both (step S4).

  Thereafter, the method proceeds to step S5, and purified IDO is produced by recovering and purifying the enzyme.

  The target (2S, 3R, 4S) -4HIL can be produced in a large amount by hydroxylation using the purified IDO produced in step S5 or the medium, cells or both accumulated IDO in step S4 (step S6). .

DNA linked to vector DNA can express the IDO of the present invention.
Here, examples of the IDO gene linked to the vector DNA include the DNA described in [I] above.

  For large scale protein production using recombinant DNA technology, cells such as bacterial cells, Actinomyces cells, enzyme cells, fungal cells, plant cells, and animal cells can be used as host cells to be transformed. Examples of bacterial cells for which host-vector systems have been developed include Escherichia species, Pseudomonas species, Corynebacterium species, Arthrobacter species, Aspergillus species, and Bacillus species. Preferably, Escherichia coli or Corynebacterium glutamicum is used. A method for producing L-isoleucine dioxygenase using transformed E. coli will be described below. The following E. coli methods can be applied to Corynebacterium glutamicum and Bacillus bacteria.

Encodes IDO, a commonly used promoter for heterologous protein production by E. coli
It can be used as a promoter for expressing DNA. Examples thereof are T7 promoter, trp promoter, lac promoter, tac promoter and PL promoter.

  When IDO is produced in the form of a fusion protein inclusion body, a gene encoding another protein, preferably a hydrophilic peptide, is linked upstream or downstream of the IDO gene to form a fusion protein gene. The gene encoding another protein may be a gene that increases the amount of accumulated fusion protein or increases the solubility of the fusion protein after the denaturation and regeneration steps. Examples thereof are T7 gene 10, β-galactosidase, dehydroforate reductase gene, interferon γ gene, interleukin 2 gene and prochymosin gene.

  When these genes are linked to the gene encoding IDO, the codon reading frame is adapted. The gene may be linked at an appropriate restriction enzyme site, or synthetic DNA having an appropriate sequence may be used.

  In order to increase the production amount, it is preferable to combine a transcription termination sequence in the form of a terminator downstream of the fusion protein gene. Examples of such terminators include T7 terminator, fd phage terminator, T4 terminator, tetracycline resistance gene terminator and E. coli trpA gene terminator.

  A multicopy vector is preferable as a vector used for introducing a gene encoding IDO or a fusion protein of IDO and another protein into E. coli. Examples of such include plasmids having a Col E1-derived origin of replication such as pUC plasmids, pBR322 plasmids, and derivatives thereof. Here, the “derivative” means a plasmid modified by base substitution, deletion, insertion, addition or inversion. Modifications here include mutagenesis using mutagens and UV radiation, natural mutations, and random mutations.

  In order to select a transformant, the vector preferably has a marker such as an ampicillin resistance gene. Examples of such plasmids include commercially available expression vectors with strong promoters (eg, pUC (Takara), pPROK (Clontech) and pKK233-2 (Clontech)).

  Recombinant DNA can be obtained by ligating a DNA fragment in which a promoter, a gene encoding IDO or a fusion protein of IDO and another protein, and a terminator are ligated in this order with vector DNA.

  When E. coli is transformed with recombinant DNA and then cultured, IDO or a fusion protein of IDO and another protein is expressed and produced. Strains commonly used for the expression of heterologous genes can be used as transformation hosts, with E. coli JM109 (DE3) and E. coli JM109 strains being particularly preferred. Transformation methods and methods for selecting transformants are described, for example, in Molecular Cloning, 3rd edition, Cold Spring Harbor Laboratory Press (2001).

  In the case of expression of a fusion protein, IDO may be excised with a restrictive protease such as blood coagulation factor Xa or kallikrein using a sequence that does not exist in IDO as a recognition sequence.

  A medium usually used for culturing E. coli can be used as a production medium. Examples of such are M9-casamino acid medium and LB medium. Furthermore, the conditions for culture and production induction may be appropriately selected according to the type of marker and promoter used in the vector and the type of host microorganism used.

  The following method can be used to recover IDO or fusion proteins of IDO and other proteins. When IDO or a fusion protein thereof is soluble in microbial cells, the microbial cells can be recovered and used in the form of a crude enzyme solution after the recovered cells are crushed or lysed. Furthermore, IDO or a fusion protein thereof can be used after purification by precipitation, filtration, column chromatography, or other conventional techniques, if necessary. In this case, the purification method may use an antibody against IDO or a fusion protein thereof.

  When a protein inclusion body is formed, it is solubilized with a denaturing agent. Although it may be solubilized together with the bacterial cell protein, it is preferable to take out the inclusion body and then solubilize it in consideration of the subsequent purification procedure. Methods known in the prior art can be used to recover inclusion bodies from bacterial cells. For example, inclusion bodies can be recovered by disrupting bacterial cells and then centrifuging. Examples of denaturing agents that solubilize protein inclusion bodies include guanidine hydrochloride (eg 6 M, pH 5-8) and urea (eg 8 M).

  Protein inclusion bodies can be regenerated as active proteins by removing these denaturing agents by treatment such as dialysis. A dialysis solution such as Tris-HCl buffer or phosphate buffer can be used for dialysis, and the concentration may be 20 mM to 0.5 M, and the pH may be 5 to 8.

  The protein concentration in the regeneration step is preferably maintained at about 500 μg / ml or less. In order to prevent the regenerated IDO from self-crosslinking, the dialysis temperature is preferably 5 ° C. or lower. Furthermore, the activity can be expected to be restored by other methods in addition to the dialysis described above, excluding denaturing agents such as dilution and ultrafiltration.

  When the IDO gene is derived from a bacterium belonging to the genus Bacillus, in one preferred embodiment, IDO can be expressed and produced using Escherichia, Pseudomonas, Corynebacterium, Arthrobacter, Aspergillus or Bacillus bacterium as a host. .

  The copy number of a gene can be increased by inserting the gene into a multicopy vector and introducing the vector into a microorganism. Usable vectors include E. coli plasmids such as pMW118, pBR322, pUC19, pBluescript KS +, pACYC177, pACYC184, pAYC32, pMW119, pET22b, E. coli-B.subtilis shuttle vectors such as pHY300PLK, pGK12, pLF14, pLF22, Phage vectors such as l1059, lBF101, M13mp9, Mu phage (JP-A-2-109985) and transposons such as Mu, Tn10, Tn5 (Berg, DE and Berg, CM, Bio / Technol., 1, 417 (1983) ) Moreover, the number of copies of a gene can be increased by integrating the gene into the chromosome by homologous recombination using a plasmid. Examples of host cells and expression systems in this case include reports of recombinant expression methods in Arthrobacter nicotinovorans by Shaw PC et al. (J Gen Micobiol. 134 (1988) p. 903-911), Morikawa, M. et al. al. (Appl Microbiol Biotechnol., 42 (1994), p.300-303) has reported a recombinant expression method in Arthrobacter sp. There are also several reports that expression systems developed for coryneform bacteria can also be used for Arthrobacter species (Sandu C. et al.). However, the expression system used for Bacillus species bacteria and Bacillus IDO used as host cells is not limited to these.

[II] Process for Producing (2S, 3R, 4S) -4-hydroxy-L-isoleucine (2S, 3R, 4S) -4-hydroxy-L-isoleucine represented by the general formula (I) of the present invention (( The production method of 2S, 3R, 4S) -4HIL) includes a one-step reaction of direct enzymatic hydroxylation of L-isoleucine to produce (2S, 3R, 4S) -4HIL, which is shown in the following reaction.

  The above reaction consists of L-isoleucine as one acceptor molecule of oxygen atoms, α-ketoglutarate as the acceptor molecule of other oxygen atoms, one oxygen molecule as a donor of two oxygen atoms, and IDO that catalyzes the reaction. Done in the presence.

  In the present invention, “enzymatic hydroxylation” means a hydroxylation reaction performed by an IDO enzyme. Bacterial IDO is particularly preferred.

  The IDO that catalyzes the reaction is not particularly limited, and any protein that can catalyze the hydroxylation reaction of L-isoleucine in the presence of α-ketoglutaric acid and oxygen can be used.

  A preferred example of such an IDO is the IDO described in section [1] describing IDO. In the method of the present invention, bacteria (including cultures, cultured cells, treated cells), purified enzymes, crude enzymes, etc., as long as the IDO that catalyzes the reaction for producing the above (2S, 3R, 4S) -4HIL is included You can use IDO in any form. When using bacteria as the source of IDO, (1) bacteria that naturally produce IDO such as microorganisms belonging to the genus Bacillus, and (2) recombinant microorganisms transformed with recombinant DNA as described in section [1] Both can be used to accumulate IDO by culturing the microorganism.

  The protein sequence used for IDO characterization is classified as L-isoleucine dioxygenase (SEQ ID NO: 2, SEQ ID NO: 8, Table 1).

The L-isoleucine dioxygenase of the present invention includes proteins defined by the following properties.
(A) It has an activity of catalyzing a reaction for producing (2S, 3R, 4S) -4-hydroxy-L-isoleucine by hydroxylation of L-isoleucine.
(B) The activity depends on the divalent cation Fe ²⁺ .
(C) The molecular weight measured by SDS-PAGE is about 29 ± 2.0 kDa.

  For example, in the production process of (2S, 3R, 4S) -4HIL using bacteria producing IDO or bacterial cells transformed with recombinant DNA, the substrate may be added directly to the culture medium during the culture. The cells may be used in the form of cells isolated from the culture or washed cells. Furthermore, the disrupted or dissolved microbial cell treated product may be used directly, or IDO may be recovered from the treated microbial cell product and used as a crude enzyme solution, or may be used after purifying the enzyme. . That is, as long as it is in the form of a fraction having IDO, it can be used in the method for producing (2S, 3R, 4S) -4HIL of the present invention.

  In order to carry out the hydroxylation reaction using IDO, the reaction solution containing L-isoleucine, α-ketoglutaric acid, protein that catalyzes the reaction or IDO-containing composition is adjusted to an appropriate temperature of 20 to 50 ° C., and the pH is adjusted. Maintain 5-12 and stand, shake or stir for 30 minutes to 5 days.

The reaction rate can also be improved by adding a divalent cation such as Fe ²⁺ to the reaction solution.
When these divalent cations are added to the reaction solution, salts can be used as long as they do not interfere with the reaction. Preferably, FeSO ₄ or the like can be used. The concentration of these divalent cations can be determined by simple preliminary tests performed by those skilled in the art. These divalent cations can be added in the range of 0.01 mM to 50 mM, preferably 0.1 mM to 25 mM.

  During culture, oxygen is supplied to the reaction from air as a result of regular agitation of the culture volume.

  The (2S, 3R, 4S) -4HIL of the general formula (I) produced in the reaction solution can be separated or purified by known techniques, or particularly when the reaction is performed using a recombinant microorganism expressing IDO. It may be used as it is.

  Examples of separation and purification methods include contacting (2S, 3R, 4S) -4HIL with an ion exchange resin to adsorb basic amino acids, followed by elution and crystallization, and decolorizing the product obtained by elution. There is a method of obtaining (2S, 3R, 4S) -4HIL by filtering with activated carbon and crystallizing.

  Unexplained genes derived from other microorganisms can be identified based on homology with known IDO genes and evaluated by evaluating the activity of the proteins encoded by these genes.

  Homology between two amino acid sequences can be determined using well-known methods, for example, the computer program BLAST 2.0 which calculates three parameters: score, identity and similarity.

  Therefore, PCR (polymerase) using primers prepared from DNA fragments encoding full-length IDOs derived from Bacillus thuringiensis 2-e-2 and Bacillus thuringiensis (serovar israelensis; ATCC 35646) strains based on the amino acid and base sequences of known fragments. Chain reaction, White, TJ et al., Trends Genet., 5, 185 (1989)). DNA fragments encoding IDOs derived from other microorganisms can be obtained in the same manner.

  Since the DNA sequence may differ between bacterial strains, the above-mentioned fragments encoding IDO are limited to the nucleotide sequences shown in SEQ ID NOs: 1, 7, 12, 16, 20, FIG. 18 or Table 1. In addition, base sequences similar to those shown in SEQ ID NOs: 1, 7, 12, 16, 20, FIG. 18 or Table 1 are also included. Therefore, the protein mutant encoded by the above gene maintains the ability of the protein to catalyze the above reaction with respect to the amino acid sequence shown in SEQ ID NO: 2, 8, 13, 17, 21, FIG. 18 or Table 1. As long as it is possible, it may have a similarity of 80% or more, preferably 90% or more, most preferably 95% or more.

  Further, the above DNA fragment is hybridized under stringent conditions to the nucleotide sequence shown in SEQ ID NOs: 1, 7, 12, 16, 20, FIG. 18 or Table 1 or to a probe prepared based on these nucleotide sequences. It can be shown by a variant that can soy. Here, “stringent conditions” are the same as those described in the section [1] (1) DNA encoding IDO.

  The form of the treated microbial cell used in the present invention is a dried microbial cell, lyophilized microbial cell, surfactant or organic solvent treated product, enzyme treated product, ultrasonic treated product, mechanically ground product, solvent treated product. , Protein fractions of bacterial cells, immobilized bacterial cells, and processed bacterial cells.

  IDO may be prepared separately as described above and added to the reaction solution. Bacteria (host cells) that express DNA encoding IDO can be prepared by transfection of an expression vector functionally containing DNA encoding IDO in a form that can be expressed in a host cell having these activities. Furthermore, a host cell in which the activity of IDO is increased by increasing the expression of a gene encoding IDO is preferably used.

The phrase “increasing gene expression” means that the gene expression is higher than an unmodified strain, eg, a wild-type strain. Examples of such modifications include increasing the number of copies of the expressed gene per cell, increasing the level of gene expression, and the like. The amount of the copy number of the expressed gene is measured by, for example, Southern blotting using a probe based on the gene sequence, fluorescence in situ hybrid method (FISH) or the like after restriction of chromosomal DNA. The level of gene expression can be measured by various known methods including Northern blotting, quantitative RT-PCR and the like. The amount of the protein encoded by the gene can be measured by a known method including immunoblotting method assay (Western blotting analysis) after SDS-PAGE.

  “Transformation of bacteria with DNA encoding a protein” means introduction of DNA into bacteria by, for example, a conventional method. This transformation of DNA results in increased expression of the gene encoding the protein of the present invention and enhances the activity of the protein in bacterial cells. Methods of transformation include all known methods previously reported. For example, a method of treating receptor cells with calcium chloride to increase the permeability of the cells to DNA has been reported for and used for Escherichia coli K-12. (Mandel, M. and Higa, A., J. Mol. Biol., 53, 159 (1970)).

  Methods for enhancing gene expression include increasing gene copy number. If a gene is introduced into a vector that can function in the bacterium of the present invention, the copy number of the gene increases. For such purposes, preferably a multicopy vector can be used. Examples of the multicopy vector include pBR322, pMW119, pUC19, pET22b and the like.

  Enhancement of gene expression can also be achieved by introducing multiple copies of the gene into the bacterial chromosome, for example by homologous recombination or Mu integration. For example, a single Mu integration can introduce up to three copies of a gene into the bacterial chromosome.

  Increasing the copy number of a gene can also be achieved by introducing multiple copies of the gene into the DNA of the bacterial chromosome. In order to introduce multiple copies of a gene into the bacterial chromosome, homologous recombination is carried out using sequences in which multiple copies are present as targets in the chromosomal DNA. Sequences with multiple copies in chromosomal DNA include, but are not limited to, repetitive DNA or inverted repeats at the end of transposable elements. Further, as disclosed in US Pat. No. 5,595,889, it is possible to incorporate a gene into a transposon and transfer it to introduce multiple copies of the gene into chromosomal DNA.

Enhancing gene expression can also be achieved by placing the DNA of the present invention under the control of a strong promoter. For example, P _tac promoter, lac promoter, trp promoter, it is known that trc promoter, P _R or P _L promoters of λ phage are all effective promoters. Strong promoters can be used in combination with increased gene copies.

  Alternatively, the effect of the promoter can be enhanced by introducing a mutation into the promoter, for example, so as to increase the transcription level of the gene located downstream of the promoter. Furthermore, it is known that substitution of several nucleotides in the spacer between the ribosome binding site (RBS) and the start codon, particularly the sequence immediately upstream of the start codon, has a profound effect on mRNA translational ability. For example, it has been found that expression levels range 20-fold due to the nature of the three nucleotides preceding the start codon (Gold et al., Annu. Rev. Microbiol., 35, 365-403, 1981; Hui Et al., EMBO J., 3, 623-629, 1984). Previously, the rhtA23 mutation was reported to replace G with A at position -1 relative to the ATG start codon (17th co-organized with 1997 Annual Meeting of the American Society for Biochemistry and Molecular Biology). Times International Congress of Biochemistry and Molecular Biology San Francisco, California August 24-29, 1997, abstract 457).

Furthermore, it is also possible to introduce nucleotide substitutions into the promoter region of the gene on the bacterial chromosome, which further enhances the promoter function. The expression control sequence can be changed, for example, in the same manner as gene replacement using a temperature-sensitive plasmid as disclosed in International Publication WO 00/18935 and Japanese Patent Application Laid-Open No. 1-215280.

  Plasmid DNA preparation methods include, but are not limited to, DNA digestion and ligation, transformation, selection of oligonucleotides as primers, or other methods known to those skilled in the art. These methods are described, for example, in Sambrook, J., Fritsch, E..F., And Maniatis, T., “Molecular Cloning A Laboratory Manual, Third Edition”, Cold Spring Harbor Laboratory Press (2001).

  The following examples further illustrate the present invention. In addition, this invention is not limited at all by this Example.

[Example 1] Screening of strains having L-Ile hydroxylase <1> Screening of 4-hydroxyisoleucine producing strain and analysis of broth
Screening for microorganisms capable of producing 4-hydroxyisoleucine was performed using L-isoleucine as a substrate. Soluble starch 0.4% (w / v), yeast extract 0.4%, malt extract 1%, L-isoleucine 0.2% was dissolved in water, and then soil bacteria were added to the medium adjusted to pH 7-7.5. Inoculated. After shaking culture at 28 ° C. for 2 days, 4-hydroxyisoleucine was analyzed by amino acid analysis of the centrifugal supernatant.

Amino acid analysis conditions 4-hydroxyisoleucine was detected using the Waters AccQ • Tag ^™ method. An amino acid in 5 μl of a reaction solution diluted to an appropriate concentration according to a conventional method was derivatized and analyzed by HPLC to determine the amount of 4-hydroxyisoleucine produced. As a result, one of the strains (2-e-2 strain) was found to have the activity of producing a substance having the same retention time as 4-hydroxyisoleucine. From the analysis of 16S rDNA, the 2-e-2 strain was identified as Bacillus thuringiensis. Therefore, when other Bacillus genera were screened, the same activity was found in Bacillus licheniformis (AKU223 strain, IAM11054 strain), Bacillus sphaericus (AKU227 strain, NBRC3526 strain), and Bacillus thuringiensis (AKU238 strain, NBRC3958 strain). It was.

Identification of Product A substance that produces the Bacillus strain obtained in the above screening using L-isoleucine as a substrate was identified. First, when the molecular weight of the product was analyzed by MS, it was 145, which was 2 smaller than 4-hydroxyisoleucine. Moreover, when the composition formula was estimated by accurate mass measurement using a high-resolution mass spectrometer (Q-TofMS), it was found that C ₆ H ₁₁ NO ₃ contained 2 fewer hydrogen atoms than 4-hydroxyisoleucine. From the above results, it was suggested that the substance produced by the aforementioned Bacillus strain may be 2-amino-3-keto-4-methylpentanoic acid (AMKP). AMKP was synthesized and purified according to the experimental method described in the report of AMKP production by bacteria belonging to the genus Bacillus [Non-Patent Document 5], and the product was purified from the above-mentioned culture medium of Bacillus bacteria according to the AMKP purification method of Non-Patent Document 5. When NMR analysis was performed, both showed the same chemical shift.

  From the above, it was clarified that the Bacillus found this time produced AMKP. The amount of AMKP produced by the 2-e-2 strain is about 1 to 2 mM. On the other hand, the estimated amount of AMKP production of Bacillus described in Non-Patent Document 5 is 0.04 mM, confirming the high AMKP production activity of the 2-e-2 strain.

<2> Establishment of separation analysis method for AMKP and HIL
Since AMKP production activity was found in Bacillus bacteria such as the 2-e-2 strain, it was found that it was necessary to establish a method for separating and analyzing AMKP and 4-hydroxyisoleucine. As a result of extensive studies, a method for separating and analyzing AMKP and 4-hydroxyisoleucine was established by modifying the Waters AccQ • Tag ^™ method. As specific conditions, the column was changed to XBridge C18 5 mm, 2.1 × 150 mm (Waters), the eluent B was changed to MeOH, and the eluent flow rate was changed to 0.3 ml / min. The gradient of the eluent is shown in the table below.

  Under the above conditions, AMKP in the medium was eluted per 11.0 min and 4-hydroxyisoleucine was eluted per 11.9 min, making it separable.

<3> Change in AMKP production by adding cofactors during culture
We considered the possibility of uptake of molecular oxygen by hydroxylation as a mechanism of AMKP production activity. Therefore, we analyzed AMKP production activity when monooxygenase cofactor NAD (P) H or dioxygenase cofactor Fe ²⁺ , 2-oxoglutarate and ascorbic acid were added during culture of 2-e-2 strain. .

In the group added with 10 mM NADP, 10 mM NADPH, the group added with Fe ²⁺ , and the group added with Fe ²⁺ , 2-oxoglutaric acid and ascorbic acid, using the culture in the medium used for the previous screening as a control. AMKP production activity was compared. The culture temperature was 30 ° C., and the culture time was 22 hours. The AMKP concentration of the culture supernatant was measured. The results are shown in Table 3.

  This suggests that dioxygenase may be involved in AMKP production.

<4> Time course of 2-e-2 strain broth
AMKP production medium (soluble starch 0.4% (w / v), yeast extract 0.4%, malt extract 1%, L-isoleucine 0.2%, glucose 0.5%, ascorbic acid 1 mM, 2-oxoglutaric acid 1 mM, CaCl ₂ 1 mM, MgSO ₄ 1 mM, pH 7 to 7.5) was placed in a 3 L Sakaguchi flask, and the 2-e-2 strain was cultured with shaking at 23 ° C. The culture solution was sampled after 0, 6, 8, 10, 12, 14, 16, 18, 20 hours after the start of the culture, and 4-hydroxyisoleucine and AMKP in the culture solution were quantified by the method described in <2> above. . Turbidity (OD ₆₆₀ ) was also measured.

  FIG. 1 shows the concentrations of 4-hydroxyisoleucine (HIL) and AMKP, and FIG. 2 shows the turbidity of the culture solution. The sum of 4-hydroxyisoleucine and AMKP increased during the logarithmic growth phase and then reached a plateau. Also, after reaching a plateau, 4-hydroxyisoleucine was reduced and AMKP was increased.

After obtaining 2-e-2 strain cells from 200 μl of the culture solution at each of the above culture times, washing with physiological saline, 100 μl of dioxygenase reaction solution (10 mM Ile, 1 mM Fe ²⁺ , 10 mM 2-oxoglutar) Acid, suspended in 10 mM ascorbic acid, 50 mM potassium phosphate buffer (pH 7.0)), reacted while shaking at 30 ° C. for 1 hour, and the amount of 4-hydroxyisoleucine and AMKP produced in the supernatant was measured. . As a result, production of 4-hydroxyisoleucine and AMKP could be confirmed only when cells in a trace amount but logarithmic growth phase were used as shown in FIG.

<5> HIL production by 2-e-2 cell disruption solution
After culturing to OD ₆₆₀ = 3.2 in AMKP production medium, the harvested and washed 2-e-2 strain cells are crushed in a mortar, and then a suspension buffer (50 mM HEPES pH 7.0, 10% glycerol, complete mini (Roche)) to obtain a suspension (crushed liquid) having a protein concentration of about 10 mg / ml, and a centrifugal precipitate of the suspension. The centrifugal precipitate was finally suspended in the same volume of physiological saline as the crushed liquid. These were mixed with an equal amount of 2 × dioxygenase reaction solution (10 mM Ile, 2 mM Fe ²⁺ , 10 mM 2-oxoglutaric acid, 10 mM ascorbic acid, 100 mM HEPES (pH 7.0)) and reacted at 30 ° C. for 1 hour. . Similarly, the resting cells used for the preparation of the disrupted solution were washed, suspended in physiological saline at a concentration 10 times that of the culture broth, and mixed and reacted with an equal amount of 2 × dioxygenase reaction solution. The amount of AMKP and 4-hydroxyisoleucine produced for each sample is shown in FIG.

  By using the crushed liquid, the production activity of 4-hydroxyisoleucine using Ile as a substrate could be clearly confirmed.

<6> Effect of Cofactor of 2-e-2 Strain Cell Breakdown Enzyme Cofactor during 4-hydroxyisoleucine production reaction by hydroxylation of Ile using 2-e-2 strain cell lysate in logarithmic growth phase The effect of was examined. Logarithmic growth phase 2-e-2 cell disruption solution (lysate) prepared by the method described in <5> above has a final concentration of 50 mM containing 5 mM Ile and 5 mM various cofactors.
The reaction was carried out in a HEPES (pH 7) reaction solution, and the amount of 4-hydroxyisoleucine produced was measured. As shown in Table 4, Fe ²⁺ (Fe) and 2-oxoglutaric acid (a-KG) are essential for 4-hydroxyisoleucine production, and 4-hydroxyisoleucine production is achieved by adding ascorbic acid (Asc.). The amount became the maximum. Therefore, it was strongly suggested that dioxygenase might be involved in the production of 4-hydroxyisoleucine by isoleucine hydroxylation.

<7> Configuration of 2-e-2 strain lysate product 4-Hydroxyisoleucine has three asymmetric carbons, 8 diastereomers and 4 pairs of enantiomers. Specifically, the enantiomers are (2S, 3S, 4S) and (2R, 3R, 4R) {hereinafter also referred to as HIL1}, (2S, 3S, 4R) and (2R, 3R, 4S) {hereinafter also referred to as HIL2. }, (2S, 3R, 4R) and (2R, 3S, 4S) {hereinafter also referred to as HIL3}, (2S, 3R, 4S) and (2R, 3S, 4R) {hereinafter also referred to as HIL4} The natural HIL present in Fenugreek and the like is (2S, 3R, 4S). In the present invention, since (2S, 3S) isoleucine is used as the substrate, 4-hydroxyisoleucine produced by the hydroxylation reaction is either (2S, 3R, 4S) or (2S, 3R, 4R). . Therefore, it was decided to determine the configuration of 4-hydroxyisoleucine produced in the 2-e-2 strain.

  As various enantiomeric pairs, (2R, 3R, 4R): HIL1 and (2S, 3R, 4R): HIL3 according to Tetrahedron 47 (32), 6469-6482, (1991), (2R, 3R, 4S): HIL2 and (2S, 3R, 4S): HIL4 was obtained according to Eur. J. Org. Chem. 834-839, (2002). When HIL1 to 4 obtained by the chemical synthesis method were analyzed under the above-mentioned <2> 4-hydroxyisoleucine and ANKP simultaneous analysis conditions, the retention times were as shown in Table 5.

  When the 4-hydroxyisoleucine-containing sample prepared in the above <6> was analyzed, the retention time was 11.99 min. When analyzed by mixing with 4-hydroxyisoleucine, a standard of HIL4, the peaks were completely consistent. Therefore, when (2S, 3S) isoleucine is used as a substrate, among the possible HIL3 and HIL4, 4-hydroxyisoleucine produced by this enzyme is HIL4, indicating that it is a natural 4-hydroxyisoleucine. It was done.

<8> Optimum pH of 2-e-2 strain disruption enzyme
According to the method described in <5> above, the pH dependence of 4-hydroxyisoleucine production activity was evaluated using a cell disruption solution prepared from 2-e-2 strain cells having an OD ₆₆₀ = 7. The composition of the dioxygenase reaction solution was 5 mM Ile, 5 mM Fe ²⁺ , 5 mM 2-oxoglutarate, 5 mM ascorbic acid, 100 mM GTA, and the pH of the reaction solution was measured after the reaction. The reaction temperature was 30 ° C. The produced 4-hydroxyisoleucine was analyzed by the method <2>. The reactivity of each pH is shown in FIG. 5 in terms of the relative activity ratio with respect to the HIL amount at the pH showing the maximum production amount as 100%. Activity was confirmed at pH 5-8.

<9> Optimum temperature of 2-e-2 strain disruption enzyme According to the method described in <5> above, using a cell disruption solution prepared from 2-e-2 strain of OD ₆₆₀ = 7, 4 -The temperature dependence of hydroxyisoleucine production activity was evaluated. The composition of the dioxygenase reaction solution was 5 mM Ile, 5 mM Fe ²⁺ , 5 mM 2-oxoglutaric acid, 5 mM ascorbic acid, 100 mM GTA (pH 6), and the reaction temperature was 15 to 50 ° C. The produced 4-hydroxyisoleucine was analyzed by the method <2>. FIG. 6 shows the reactivity at each temperature in terms of the relative activity ratio with respect to the amount of 4-hydroxyisoleucine at the pH showing the maximum production amount as 100%. The optimum temperature was 45 ° C or lower.

<10> Temperature stability of 2-e-2 strain disruption enzyme According to the method described in <5> above, using a cell disruption solution prepared from 2-e-2 strain cells with OD ₆₆₀ = 7, 4 -The temperature stability of hydroxyisoleucine producing activity was evaluated. The crushing solution was incubated at 0 to 50 ° C. for 1 hr, and then Ile hydroxylation activity was measured. The composition of the substrate reaction solution was 5 mM Ile, 5 mM Fe ²⁺ , 5 mM 2-oxoglutaric acid, 5 mM ascorbic acid, 100 mM Hepes (pH 7), and the reaction temperature was 30 ° C. The produced 4-hydroxyisoleucine was analyzed by the method of Example 2. The amount of 4-hydroxyisoleucine at the temperature showing the maximum production amount is defined as 100%, and the temperature stability at each temperature is shown in FIG. The enzyme was inactivated above 50 ° C.

<11> Substrate reaction characteristics of 2-e-2 strain disruption enzyme In accordance with the method described in <5> above, various cell disruptions prepared from 2-e-2 strain cells with an OD _{660 of} 7 were used. Reaction characteristics for amino acids were evaluated. After mixing the crushed solution and the substrate solution, the mixture was reacted at 30 ° C. for 1 hour, and the production of a new substance was evaluated by TLC or amino acid analysis. The composition of the substrate reaction solution is 5 mM amino acid, 5 mM Fe ²⁺ , 5 mM 2-oxoglutaric acid, 5 mM ascorbic acid, 100 mM Hepes (pH 7). As amino acids, L-leucine, L-valine, L-glutamic acid, L-lysine was evaluated individually. The produced 4-hydroxyisoleucine was analyzed by the method of Example 1. The results are shown in Table 6. For amino acids other than L-isoleucine, the formation of new substances could not be confirmed. Therefore, it was suggested that this enzyme is an isoleucine-specific dioxygenase.

<12> Effect of inhibitor of 2-e-2 strain disruption enzyme According to the method described in <5> above, using a cell disruption solution prepared from 2-e-2 strain cells having an OD ₆₆₀ = 7, The effect of inhibitors on 4-hydroxyisoleucine production activity was examined. According to the method described in <5> above, a cell disruption solution prepared from 2-e-2 strain cells having OD ₆₆₀ = 7 was used. The composition of the dioxygenase reaction solution was 5 mM Ile, 5 mM Fe ²⁺ , 5 mM 2-oxoglutaric acid, 5 mM ascorbic acid, 100 mM Hepes (pH 6), the reaction temperature was 30 ° C., and the reaction time was 1 hour. During the reaction, the amount of 4-hydroxyisoleucine produced when 10 mM inhibitor (EDTA, Cu ²⁺ , Zn ²⁺ ) was added individually was measured. 4-Hydroxyisoleucine was analyzed by the above method <2>. Isoleucine hydroxylation activity was lost by the inhibitor.

[Example 2] Isolation and purification of L-Ile hydroxylase (1) Preparation of cell-free extract
2-e-2 was cultured in a total of 2 L of AMKP production medium until OD ₆₆₀ = 6.0, and the cells were washed with physiological saline. Cell bodies were treated with cell membrane treatment solution (10 mg / ml Lysing enzyme (SIGMA), 5 mg / ml Cellulase "ONOZUKA" R-10 (Yakult), Yatalase (Takara Bio), 1 mg / ml Lysozyme (SIGMA) 0.2 M NaH ₂ PO ₄ ,
Suspended in 0.6 M KCl (pH 5.5)) and incubated at 30 ° C. for 1 hr. The incubated cells were washed with physiological saline, suspended in buffer A (50 mM HEPES pH 7.0, 10% glycerol, 2 mM DTT, 1 mM EDTA, complete (Roche)), and subjected to ultrasound under ice cooling. The cells were crushed with a crusher (Branson). This treatment solution was centrifuged at 4 ° C., 18,500 × g for 60 minutes to obtain a supernatant. All subsequent isolation and purification operations were carried out at 4 ° C. or under ice cooling.

(2) Anion exchange chromatography The supernatant obtained in the previous step was filtered through a 0.45 μm filter and then subjected to DEAE (16 mm × 100 mm: GE Healthcare Bioscience) that had been equilibrated with buffer A in advance. did. After washing the column with buffer A, buffer B (50 mM HEPES pH 7.0, 10% glycerol, 2 mM DTT,
The solution was eluted with 1 mM EDTA, 0.5 M NaCl, complete (Roche) using a linear concentration gradient of sodium chloride.

(3) Detection of active fractions Each fraction consists of an Ile hydroxylation reaction solution (final concentration 100 mM Hepes (pH 6.0), 5 mM L-Ile, 5 mM Fe ²⁺ , 5 mM 2-oxoglutaric acid, 5 mM ascorbic acid). For 30 minutes at 30 ° C. After enzyme inactivation at 100 ° C., the amount of 4-hydroxyisoleucine was quantified by the AMKP and HIL separation measurement method described above. In the subsequent analysis, 4-hydroxyisoleucine indicates only an isomer having the same retention time as that of natural 4-hydroxyisoleucine. In addition, the enzyme activity which produces | generates 1 nmol HIL per minute was set to 1U.

(4) Cation exchange chromatography The active fraction obtained in the previous step was subjected to desalting column (GE Healthcare Bioscience) with buffer C (50 mM MES pH 5.2, 10% glycerol, 2 mM DTT, 1 mM EDTA, complete (Roche)). This replacement solution was subjected to monoS (10 mm × 100 mm: GE Healthcare Bioscience) that had been equilibrated with buffer C in advance. After washing the column with buffer C, buffer D (50 mM MES pH 5.2, 10% glycerol, 2 mM DTT, 1 mM EDTA, 0.5 M NaCl, complete
(Roche)) was eluted with a linear concentration gradient of sodium chloride, and the Ile hydroxylation activity of each fraction was measured.

(5) Ammonium sulfate precipitation 2 M ammonium sulfate was added and dissolved in the soluble fraction obtained in the previous step. After sufficiently stirring, the mixture was fractionated into a soluble fraction and a precipitated fraction by centrifugation, and the precipitated fraction was dissolved in buffer A. When the Ile hydroxylation activity of each fraction was measured, the activity was detected in the precipitate fraction.

(6) Size Exclusion Chromatography The active fraction obtained in the previous step was subjected to Superdex 75 (10 mm × 300 mm: GE Healthcare Bioscience) previously equilibrated with buffer A. Elution was performed with buffer A, and the Ile hydroxylation activity of each fraction was measured.

(7) Hydrophobic interaction chromatography The active fraction obtained in the previous step was subjected to buffer E (50 mM MES pH 6.5, 10% glycerol, 2 mM DTT,
1 mM EDTA, 1 M ammonium sulfate, complete (Roche)). The buffer replacement sample was subjected to Resource PHE (1 ml: GE Healthcare Bioscience) that had been equilibrated with buffer E in advance. After washing the column with buffer E, the fraction containing Ile hydroxylase was added to ammonium sulfate using buffer F (50 mM MES pH 6.5, 10% glycerol, 2 mM DTT, 1 mM EDTA, complete (Roche)). The elution was performed using an inverse linear concentration gradient.

  Table 7 summarizes the isolation and purification of L-Ile hydroxylase.

[Example 3] Determination of properties of l-Ile hydroxylase <1> Analysis by electrophoresis The purified sample obtained in Example 2 was subjected to sodium dodecyl sulfate-polyacrylamide electrophoresis (polyacrylamide manufactured by Daiichi Chemicals). The analysis was performed by gel PAG mini “Daiichi” 15/25 (13 well) and Biorad molecular weight standard (Prestained SDS-PAGE standards, Low Range). As a result, it was revealed that this enzyme consists of almost uniform subunits having a molecular weight of about 31,000 ± 20,000.

<2> Effect of addition of cofactor Using purified enzyme, the influence of cofactor during 4-hydroxyisoleucine production reaction by hydroxylation of Ile was examined. L-Ile hydroxylase prepared by the method described in Example 2 was reacted in a 100 mM HEPES (pH 6) reaction solution containing 5 mM L-Ile and 5 mM of various cofactors to produce 4-hydroxyisoleucine. The amount was measured. As shown in Table 8, Fe ²⁺ and 2-oxoglutaric acid were essential for 4-hydroxyisoleucine production, and the amount of 4-hydroxyisoleucine produced was maximized by adding ascorbic acid. Therefore, the possibility that dioxygenase is involved in the production of 4-hydroxyisoleucine by L-isoleucine hydroxylation was strongly suggested, which was the same as the result of the examination using the crushed liquid.

<3> Optimum pH
Using L-Ile hydroxylase prepared according to the method described in Example 2, the pH dependency of 4-hydroxyisoleucine production activity was evaluated. The composition of the enzyme reaction solution was 5 mM L-Ile, 5 mM Fe ²⁺ , 5 mM 2-oxoglutaric acid, 5 mM ascorbic acid, 200 mM GTA (pH 3 to 12). The reaction temperature was 30 ° C. The amount of 4-hydroxyisoleucine at the pH showing the maximum production amount is defined as 100%, and the reactivity at each pH is shown in FIG. The activity was confirmed at pH 4 to 8, and high activity was confirmed at pH 5 to 8.

<4> Optimum temperature Using L-Ile hydroxylase prepared according to the method described in Example 2, the optimum temperature of 4-hydroxyisoleucine production activity was evaluated. The composition of the enzyme reaction solution was 5 mM Ile, 5 mM Fe ²⁺ , 5 mM 2-oxoglutaric acid, 5 mM ascorbic acid, 100 mM Hepes (pH 6). The reactivity at each temperature is shown in FIG. 9 in terms of relative activity ratio with respect to the amount of 4-hydroxyisoleucine at the temperature showing the maximum production amount as 100%. High activity was confirmed in the temperature range of 0 ° C to 40 ° C.

<5> Temperature stability Using the L-Ile hydroxylase prepared according to the method described in Example 2, the temperature stability of 4-hydroxyisoleucine production activity was evaluated. After incubating the pH 7.0 enzyme solution at 0 to 70 ° C. for 1 hr, Ile hydroxylation activity was measured. The composition of the enzyme reaction solution is 5 mM Ile, 5 mM Fe ²⁺ , 5 mM
The reaction temperature was 30 ° C. with 2-oxoglutaric acid, 5 mM ascorbic acid, 100 mM Hepes (pH 6). The amount of 4-hydroxyisoleucine at the storage temperature showing the maximum production amount is defined as 100%, and the temperature stability at each temperature is shown in FIG. The enzyme was inactivated above 60 ° C.

<6> Substrate reaction characteristics Using L-Ile hydroxylase prepared according to the method described in Example 2, reaction characteristics against various amino acids were evaluated. After mixing the enzyme solution and the reaction solution, they were reacted at 30 ° C. for 1 hour, and the production of new substances was evaluated by HPLC analysis. The composition of the enzyme reaction solution is 5 mM amino acid, 5 mM Fe ²⁺ , 5 mM 2-oxoglutaric acid, 5 mM ascorbic acid, 100 mM Hepes (pH 6). In addition to L-isoleucine, D-isoleucine, L-leucine, L-valine L-glutamic acid and L-lysine were evaluated individually. The produced 4-hydroxyisoleucine was analyzed by the method of Example 1. The results are shown in Table 9. Similar to the results of the examination using the crushed liquid, the production of new substances could not be confirmed for amino acids other than L-isoleucine. Therefore, it was suggested that this enzyme has an activity to produce natural HIL with a dioxygenase specific to L-isoleucine, similar to the results examined using the cell lysate.

<7> Influence of inhibitor Using the L-Ile hydroxylase prepared according to the method described in Example 2, the influence of the inhibitor on 4-hydroxyisoleucine production activity was examined. The composition of the enzyme reaction solution was 5 mM Ile, 5 mM Fe ²⁺ , 5 mM 2-oxoglutaric acid, 5 mM ascorbic acid, 100 mM Hepes (pH 6), the reaction temperature was 30 ° C., and the reaction time was 1 hour. During the reaction, the amount of 4-hydroxyisoleucine produced when 10 mM inhibitor (EDTA, Cu ²⁺ , Zn ²⁺ ) was added individually was measured. The 4-hydroxyisoleucine production | generation activity when not adding an inhibitor was made into 100%, and the relative activity with respect to the production amount was shown in Table 10. Isoleucine hydroxylation activity was lost by the inhibitor.

<8> N-terminal amino acid sequence L-Ile hydroxylase prepared according to the method described in Example 2 was electrophoresed according to the method of Example 3, and then transferred to a PVDF membrane (Sequi-Blot ^™ PVDF membrane manufactured by Bio-Rad). Then, it was subjected to a protein sequencer PPSQ-10 manufactured by Shimadzu Corporation. The following results were obtained as the N-terminal sequence of the enzyme obtained by the above method.

1 LysMetSerGlyPheSerIleGluGluLys 10
11 ValHisGluPheGluSerLysGlyPheLeu 20
(SEQ ID NO: 5)

[Example 4] Purification of IDO derived from Bacillus thuringiensis (2-e-2) strain According to the screening of environmental microorganisms prepared by the inventors of the present invention, an original having an α-ketoglutarate-dependent L-isoleucine dioxygenase activity Microorganisms were found. This was identified as Bacillus thuringiensis and stored as Bacillus thuringiensis 2-e-2 (FERM BP-10688).

1.1. Culture conditions The following culture media were used in the experiments.
CM1 (trypton 10 g / l; yeast extract 10 g / l; adjusted to pH 7.0 with NaOH)
CM6 (trypton 10 g / l; yeast extract 40 g / l; adjusted to pH 7.0 with NaOH)

1.2. Inoculum preparation
Bacillus thuringiensis 2-e-2 strain was diluted with 90 mM KPi buffer (90 mM KH ₂ PO ₄ (pH with KOH
The cells were cultured overnight at 30 ° C. in CM1 medium supplemented with 7). Glycerol was then added to the culture to 20%. The resulting cell suspension was divided into 1.9 ml vials and stored at 70 ° C. until use.

1.3. Culture conditions
Bacillus thuringiensis 2-e-2 strain was cultured using a Marubischi fermenter. The culture parameters were as follows: Adjust to pH 7.0 by starting culture volume 600ml, stirring 800rev / min, air 1: 1, 1N NaOH / HCl supply. One vial (1.9 ml) of frozen suspension (see above) was used to inoculate 600 ml of CM6 medium. The 2-e-2 strain was cultured for about 7.5 hours. The cells were then collected by centrifugation and stored at -70 ° C until use.

1.4. IDO activity measurement
Bacterial cells were collected from 25 to 100 ml of Bacillus thuringiensis 2-e-2 culture by centrifugation, and 2 ml of buffer A (50 mM MOPS, 10% glycerol, 1 mM EDTA, 1 mM DTT, protease inhibitor, pH 7.2). The cells were crushed using a French press cell (3 times at 1000 Psi). The reaction solution (50 μl) contained a sample of 50 mM HEPES pH 7.0; 5 mM Ile; 5 mM ascorbic acid; 10 mM FeSO ₄ ; 5 mM α-ketoglutarate and protein preparation. The reaction was incubated at 34 ° C. for 40 minutes with shaking. The synthesized 4HIL was detected by TLC analysis. A sample (1-2 μl) of the reaction solution was spotted on a thin layer silica gel plate (10 × 15 cm) and developed with a developing solvent (2-propanol: acetone: ammonia: water = 100: 100: 25: 16). 4HIL was detected with ninhydrin reagent. HPLC analysis was performed as described in Example 4.

1.5. Purification and identification of IDO from Bacillus thuringiensis 2-e-2 strain All chromatographic operations were performed using the AKTAbasic100 system (Amersham Pharmacia Biotech). The purification protocol includes the following steps. Frozen cells (62 g organism weight) were thawed and resuspended in 150 ml buffer A [50 mM TRIZMA, 5% glycerol, 1 mM EDTA, 1 mM DTT, protease inhibitor, adjusted to pH 7 with HCl].

  Stage 1. The cells were disrupted by passing twice through a French press cell (max P = 1000 Psi), and centrifuged (14000 g, 4 ° C., 20 min) to remove cell debris. The resulting protein preparation was added to 150 ml of DEAE resin equilibrated with buffer A. The final suspension was incubated at 4 ° C. for about 10 minutes with gentle shaking. Subsequently, the resin having the adsorbed protein was transferred to a column (26 × 30 cm), and two-step elution was performed. First, the column was washed with 50 mM NaCl in buffer A, and then IDO activity was eluted with 250 mM NaCl in buffer A.

  Stage 2. IDO activity was concentrated by ammonium sulfate precipitation (1.9 M) and resuspended in about 3 ml of buffer B [50 mM TRIZMA, 5% glycerol, 1 mM EDTA, 1 mM DTT, 100 mM NaCl, pH 7].

Stage 3. 1.5 ml of the preparation obtained in step 2 was equilibrated with buffer B Superdex Applied to 200 HR 10 / 30A. Isocratic elution was performed at a flow rate of 0.5 ml / min. The active fraction was collected.

  Step 4. The protein preparation obtained in step 3 was applied to a 1.6 ml Source15Q column equilibrated with buffer A. Elution was performed using a linear gradient of 0-0.5 M NaCl in buffer B (10 column volume) at a flow rate of 0.5 ml / min. Each 1 ml fraction was collected and the active fraction was collected.

  As a result, IDO was purified about 120 times (see Table 11). SDS-PAGE of the final protein preparation showed only one major band (about 70% of total protein, see FIG. 12).

1.6. IDO identification
Major proteins were extracted from SDS-PAGE and analyzed by gravimetric analysis. Gel processing, trypsin digestion, protein extraction, and mass spectrometry with time-of-flight matrix-assisted laser desorption ionization (MALDI-TOF) are described in Govorun, VM et al, (The proteome comparative analysis
of Helicobacter pylori clinical isolates. Biochemistry (Mosc), 68, 1, 42-49 (2003)). Proteins were identified by a set of photolytic peptide masses using the Peptide Fingerprint option of Mascot software (Matrix Science, USA). The analyzed protein was identified as a putative RBTH — 06809 protein from the Bacillus thuringiensis (serovar israelensis; ATCC 35646) strain by MS analysis (FIG. 13).

[Example 5] Cloning of IDO gene derived from Bacillus thuringiensis 2-e-2 strain and Bacillus thuringiensis (serovar israelensis, ATCC 35646) strain The purified sample was electrophoresed on SDS (15-25%) polyacrylamide gel. Transfer of the protein to the polyvinylidene difluoride membrane was carried out at 1 mA cm ² for 1 hour at room temperature. After staining with CBB, the IDO band was cut out and subjected to automatic Edman degradation using a protein sequencer PPSQ-10 (Shimadzu Corporation, Japan). The first 20 amino acids at the N-terminus of the purified protein were determined.

The N-terminal amino acid sequence of the 31-kDa polypeptide was determined as KMSGFSIEEKVHEFESKGFL (SEQ ID NO: 5). By BLAST search, this amino acid sequence was obtained from RBTH_06809 derived from Bacillus thuringiensis (serovar israelensis) ATCC 35646 and Bacillus cereus ATCC shown in Table 1.
High homology with the hypothetical protein of BC1061 from 14579. Since the classic SD sequence is located 8 bp upstream of the ATG start codon based on sequence analysis of the ORF of RBTH_06809 and determination of the N-terminal amino acid of the purified protein, there is only one possible translation start site. Was shown (FIG. 14). However, the purified protein Lys (7) is the N-terminal amino acid. N-terminal processing (cleavage of N-terminal amino acids) was speculated to be necessary for IDO activity. Presumably, this cleavage is due to a specific protease co-expressed with IDO in Bacillus sp. And missing in E. coli. Therefore, a special recombinant plasmid was constructed to produce mature IDO in E. coli.

2.1. Bacteria
The Bacillus thuringiensis (serovar israelensis, ATCC 35646) strain is a Russian Collect
Obtained from ion of Industrial Microorganisms (VKPM) (accession number B-197).

2.2. Construction of pMW119-IDO (Lys, 32) plasmid
In order to construct pMW119-IDO (Lys, 32), the following procedure was performed.
A 0.8 kb DNA fragment of Bacillus thuringiensis (serovar israelensis, ATCC 35646) strain chromosome, oligonucleotide SVS 170 (SEQ ID NO: 3) and SVS 169 (SEQ ID NO: 4) as primers (see Figure 15 for details), and purified chromosomal DNA Amplified using as a template. The following PCR protocol was used. First cycle: 94 ° C 30 seconds, 4 cycles: 94 ° C 40 seconds, 49 ° C 30 seconds and 72 ° C 40 seconds, 35 cycles: 94 ° C 30 seconds, 54 ° C 30 seconds and 72 ° C 30 seconds. The resulting PCR fragment was digested with BamHI and SacI endonucleases and then ligated into the pMW119 vector pretreated with the same restriction enzymes.

2.3. Construction of pMW119-IDO (Lys, 23) plasmid
A 0.8 kb DNA fragment of Bacillus thuringiensis 2-e-2 strain chromosome, using oligonucleotides SVS 170 (SEQ ID NO: 3) and SVS 169 (SEQ ID NO: 4) as primers (see FIG. 15 for details) and purified chromosomal DNA as a template Amplified. The following PCR protocol was used. First cycle: 94 ° C 30 seconds, 4 cycles: 94 ° C 40 seconds, 49 ° C 30 seconds and 72 ° C 40 seconds, 35 cycles: 94 ° C 30 seconds, 54 ° C 30 seconds and 72 ° C 30 seconds. The resulting PCR fragment was digested with BamHI and SacI endonucleases and then ligated into the pMW119 vector pretreated with the same restriction enzymes.

  Cells of the E. coli TG1 strain were transformed with the ligation mixture. The resulting clones were selected on X-gal / IPTG agar-plate (blue / white test). IDO activity was then tested with crude cell lysates of selected clones.

  As a result, two clones of TG1 [pMW119- (Lys, 32)] and TG1 [pMW119- (Lys, 23)] were selected. Corresponding plasmids were isolated and the cloned BamHI-SacI fragment of each plasmid was sequenced (see FIGS. 16 and 17).

Analysis of the determined DNA sequence revealed inconsistencies between the cloned gene and the known RBTH — 06809 ORF (FIGS. 18 and 19). In addition, IDO (Lys,
23) is determined (FIG. 15C), the disappearance of the TAA stop codon of the leader peptide (1) and the extension of the translation to the TGA stop codon overlapping with the ATG start codon (leader peptide ( 2)) occurred (FIGS. 15A and 15C). An additional mutation was detected at position "-2" and C was replaced by A (Figure 15C).

2.4. Measurement of IDO activity of crude cell disruption fluids of TG1 [pMW119-IDO (Lys, 23) and TG1 [pMW119-IDO (Lys, 32) strains To examine the IDO activity of crude cell disruption fluids of recombinant E. coli strains The following procedure was performed. Cells are collected from 5 ml culture by centrifugation at 4 ° C and resuspended in 0.5 ml buffer A * (50 mM TRIZMA, 5% glycerol, 1 mM EDTA, 1 mM DTT, adjusted to pH 7 with HCl). Then, it was crushed at 4 ° C. by ultrasonic waves. The reaction solution (50 μl) contained 50 mM HEPES pH 7.0; 5 mM Ile; 0.5 mM α-ketoglutarate; 5 mM ascorbic acid; 5 mM FeSO ₄ and a sample of protein preparation. The reaction was incubated at 34 ° C. for 1 hour with shaking. Synthesized 4HIL was detected by TLC analysis or HPLC analysis as described in Example 4. The results are summarized in Table 12.

[Example 6] Bioconversion of L-isoleucine to 4HIL using IDO activity
Cells of E. coli TG1 [pMW119-IDO (Lys, 23)] and TG1 [pMW119-IDO (Lys, 32)] strains were cultured in LB medium supplemented with ampicillin (100 mg / l) with an optical density of A ₅₄₀ The cells were cultured until = 4-5 (about 6 hours). Bacteria were collected from 2 ml culture solution by centrifugation, and then 1 ml solution MI50 (100 mM KH ₂ PO ₄ (pH adjusted to 7 with NaOH), NH ₄ Cl 20 mM, MgSO ₄ 2 mM, CaCl ₂ 0.1 mM, ampicillin 150 μg / ml, Ile 50 mM, 0.5 mM α-ketoglutarate, glycerol 1%, yeast extract 0.005
g / l).

  The cells were then cultured for about 12 hours. Thereafter, the concentration of 4HIL was examined by TLC (HPLC) analysis. The data obtained is summarized in Table 13. As is clear from Table 13, TG1 [pMW119-IDO (Lys, 23)] accumulated more 4HIL than TG1 [pMW119-IDO (Lys, 32)].

[Example 7] HPLC measurement of accumulated 4-hydroxy-L-isoleucine
HPCL analysis: A high pressure chromatograph (Waters, USA) equipped with a spectrophotometer 1100 series was used. Selected detection wavelength range: excitation wavelength was 250 nm and emission wavelength range was 320-560 nm. Separation by the accq-tag method was performed at + 400 ° C. using a column Nova-Pak ^™ C18 150 × 3.9 mm, 4 μm (Waters, USA). The sample injection volume was 5 μl. Generation of amino acid derivatives and their separation were performed according to the recommendations of the manufacturer Waters (Liu, H. et al, J. Chromatogr. A, 828, 383-395 (1998); Waters accq-tag chemistry package. Instruction manual Millipore Corporation, pp.1-9 (1993)). To obtain amino acid derivatives with 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate, kit Accq-Flu
or ^TM (Waters, USA) was used. The analysis using the accq-tag method is based on the concentrated Accq-tag Eluent А (Waters,
USA). All solutions were prepared using Milli-Q and standard solutions were stored at + 4 ° C.

[Example 8] Cloning of Baidolus cereus ATCC14579, B. thuringiensis AKU238 and B. weihenstephanensis KBAB4-derived ido genes
(1) Preparation of chromosomal DNA
Bacillus cereus ATCC14579 strain, B. thuringiensis AKU238 strain and B. weihenstephanensis KBAB4 strain were each cultured overnight at 28 ° C. using 5 ml of LB medium (preculture). The main culture was performed using 50 ml of LB medium using 1.5 ml of the culture as an inoculum. After culturing until the late stage of logarithmic growth, 50 ml of the culture solution was subjected to centrifugation (12000 × g, 4 ° C., 15 minutes) and collected. Using these cells, chromosomal DNA was prepared according to a conventional method.

(2) Acquisition of ido gene by PCR
Based on the genome sequence information disclosed for B. cereus ATCC14579 strain (GenBank accession No. AE016877), the following primers were synthesized.
CATATGGAGGTTTTTATAATGACGTTTGTT (SEQ ID NO: 10)
CTCGAGTTTTGTCTCCTTATAAGAAAATGT (SEQ ID NO: 11)

  Using the prepared primer, amplification by PCR was performed using the chromosomal DNA of B. cereus ATCC14579 strain as a template. PCR reaction was performed using PrimeSTAR (TaKaRa), and 30 cycles were performed under the conditions of 98 ° C. for 10 seconds, 52 ° C. for 15 seconds and 72 ° C. for 1 minute.

  When the PCR product was subjected to agarose gel electrophoresis, amplification of a fragment of about 750 bp was observed. The DNA fragment was recovered, treated with restriction enzymes NdeI and XhoI, then cloned into the expression vector pET21b (Novagene) treated with the same restriction enzymes, and the nucleotide sequence was determined. As a result, it was confirmed that the ido homologous gene was obtained from the homology of the obtained DNA fragment (SEQ ID NOs: 12 and 13). The homology at the nucleotide sequence level was 98% compared to the ido gene derived from the B. thuringiensis israelensis ATCC 35646 strain, and 98% compared to the ido gene derived from the B. thuringiensis 2-e-2 strain.

For the B. thuringiensis AKU238 strain, the ido gene was cloned by PCR in the same manner as described above using the primers (SEQ ID NOs: 14 and 15) used for the ido gene cloning derived from the B. thuringiensis 2-e-2 strain (sequence) Numbers 16 and 17). The homology at the nucleotide sequence level was 98% compared to the ido gene derived from the B. thuringiensis israelensis ATCC 35646 strain, and 98% compared to the ido gene derived from the B. thuringiensis 2-e-2 strain.
CATATGAAAATGAGTGGCTTTAGCATAGAA (SEQ ID NO: 14)
CTCGAGTTTTGTCTCCTTATAAGAAAATGT (SEQ ID NO: 15)

For the B. weihenstephanensis KBAB4 strain, the following primers were synthesized based on the genome sequence information (GenBank accession No. NZ_AAOY01000001) published for the B. weihenstephanensis KBAB4 strain (SEQ ID NOs: 18 and 19). The ido gene was cloned by PCR as in the above (SEQ ID NOs: 20 and 21). The homology at the nucleotide sequence level was 78% compared to the ido gene derived from the B. thuringiensis israelensis ATCC 35646 strain and 78% compared to the ido gene derived from the B. thuringiensis 2-e-2 strain.
CATATGCTAACAACAGTTTCTAATAAGACA (SEQ ID NO: 18)
CTCGAGTTTTGGCTCCTTATAAGAAAACGT (SEQ ID NO: 19)

[Example 9] Expression of ido gene in E. coli and HIL production from Ile (1) Expression of ido gene in E. coli B. cereus ATCC14579 strain, B. thuringiensis AKU238 strain constructed in Example 8, Alternatively, the B. weihenstephanensis KBAB4-derived ido expression plasmid was introduced into E. coli Rosetta2 (DE3), and the transformant was cultured overnight at 37 ° C. in an LB medium containing 50 μg / ml ampicillin (preculture). The preculture was seeded at 1% in 50 ml of LB medium, and main culture was performed at 37 ° C. About 2 hours after the start of culture, IPTG was added to a final concentration of 1 mM, and the culture was further continued for 3 hours. After completion of the culture, the cells were collected and washed, suspended in 1 ml of 20 mM Tris-HCl (pH 7.6), and the cells were crushed using a sonicator (manufactured by INSONATOR 201M / KUBOTA). The supernatant obtained by centrifuging the disrupted solution at 15000 rpm for 10 minutes was used as a crude enzyme solution.

(2) HIL production from Ile using crude enzyme solution Using the crude enzyme solution prepared in (1), the conversion activity from Ile to HIL was measured. The composition of the reaction solution was as shown below. After reacting for 3 hours while shaking at 300C (300 rpm), HIL produced by HPLC was quantified. Table 14 shows the quantitative results.

  As a result, even when B. cereus ATCC14579, B. thuringiensis AKU238 or B. weihenstephanensis KBAB4 strain-derived ido expression strain was used, generation of HIL was clearly observed, and it was confirmed that these genes could be used for HIL production. .

Array description
1: Base sequence of IDO gene from B. thuringiensis 2-e-2
2: Amino acid sequence of IDO from B. thuringiensis 2-e-2 strain
3: Primer svs 170; for IDO gene amplification
4: Primer svs 169; for IDO gene amplification
5: N-terminal sequence of IDO from B. thuringiensis 2-e-2 strain
6: IDO conserved sequence in the genus Bacillus
7: Base sequence of IDO gene from B. thuringiensis ATCC 35646
8: Amino acid sequence of IDO from B. thuringiensis ATCC 35646
9: 16S rDNA base sequence of B. thuringiensis 2-e-2 strain
10: Primer for amplification of IDO gene from B. cereus ATCC 14579
11: Primer for amplification of IDO gene from B. cereus ATCC 14579
12: Base sequence of IDO gene from B. cereus ATCC 14579
13: Amino acid sequence of IDO from B. cereus ATCC 14579
14: Primer for amplification of IDO gene from B. thuringiensis AKU238
15: Primer for amplification of IDO gene from B. thuringiensis AKU238
16: Base sequence of IDO gene from B. thuringiensis AKU238
17: Amino acid sequence of IDO from B. thuringiensis AKU238
18: Primer for amplification of IDO gene from B. weihenstephanensis KBAB4
19: IDO gene from B. weihenstephanensis KBAB4-derived IDO gene amplification primer
20: Base sequence of IDO gene from B. weihenstephanensis KBAB4
21: Amino acid sequence of IDO from B. weihenstephanensis KBAB4

  ADVANTAGE OF THE INVENTION According to this invention, the method of manufacturing 4-hydroxyisoleucine with the enzyme derived from microorganisms which catalyzes reaction which produces | generates 4-hydroxyisoleucine by the direct hydroxylation reaction of isoleucine is provided. The present invention is extremely useful in the pharmaceutical field and food field.

  The L-isoleucine dioxygenase of the present invention is a novel dioxygenase that catalyzes the hydroxylation reaction of L-isoleucine, and is preferably useful as a component of a pharmaceutical composition having insulin secretion activity (2S, 3R, 4S) It can be used for the synthesis of -4-hydroxy-L-isoleucine.

The time-dependent change of 4-hydroxyisoleucine and AMKP production amount at the time of culture of 2-e-2 strain is shown. Changes in turbidity during 2-e-2 strain culture are shown. It shows the production activity of 4-hydroxyisoleucine and AMKP using resting cells of 2-e-2 strain. The 4-hydroxyisoleucine production activity of various samples is shown. The pH dependency of 4-hydroxyisoleucine production activity by the 2-e-2 strain disruption liquid is shown. The temperature dependence of 4-hydroxyisoleucine production activity by 2-e-2 stock | strain disruption liquid is shown. The temperature stability of 4-hydroxyisoleucine production activity by 2-e-2 stock | strain disruption liquid is shown. The pH dependence of the 4-hydroxyisoleucine production activity by a purified enzyme is shown. The temperature dependence of the 4-hydroxyisoleucine production activity by a purified enzyme is shown. The temperature stability of the 4-hydroxyisoleucine production activity by a purified enzyme is shown. 2 shows a flowchart of a method for manufacturing an IDO of the present invention. The purification (photograph) of IDO derived from Bacillus thuringiensis 2-e-2 strain is shown. The SDS-PAGE of the protein sample in the purification stage is shown. Lane: 1-marker of molecular weight shown; 2-crude cell lysate; 3-ammonium sulfate precipitation: 4-SEC; 5-AEC. The MS identification of IDO derived from Bacillus thuringiensis 2-e-2 strain is shown. Bacillus thuringiensis (serovar israelensis, ATCC 35646) RBTH_06809 The translation start part of ORF is shown. The artificial expression module of recombinant plasmid pMW119-IDO (Lys, 32/23) is shown. A physical map of the pMW119-IDO (Lys, 23) plasmid and the determined sequence of the cloned BamHI-SacI fragment carrying the IDO structural gene are shown. Natural point mutations in the regulatory region are shown in gray. A physical map of the pMW119-IDO (Lys, 32) plasmid and the determined sequence of the cloned BamHI-SacI fragment carrying the IDO structural gene are shown. DNA alignment of structural genes corresponding to IDO (Lys, 23), IDO (Lys, 32) and RBTH — 6809 (5′-end shortened) is shown. Variable sites are shown in gray. Protein alignment of IDO (Lys, 23), IDO (Lys, 32) and RBTH_06890 ORF is shown. Variable sites are shown in gray. The protein alignment of conserved virtual protein derived from Bacillus thuringienesis-derived IDO, Bacillus cereus-derived BC1061 and Bacillus weihenstephanensis is shown.

Claims (15)

4-hydroxyisoleucine comprising a step of producing 4-hydroxyisoleucine by subjecting isoleucine or a salt thereof to a hydroxylation reaction in the presence of a hydroxylase that produces 4-hydroxyisoleucine from isoleucine derived from a microorganism Or a method of producing a salt thereof,
The hydroxylation reaction
(f) a protein having the amino acid sequence of SEQ ID NO: 2, 8, 13, 17 or 21;
(g) L-isoleucine having an amino acid sequence comprising substitution, deletion, insertion, addition or inversion of one or several amino acid residues in the amino acid sequence of SEQ ID NO: 2, 8, 13, 17 or 21 A protein having dioxygenase activity, and
(h) at least one selected from the group consisting of proteins having an amino acid sequence showing at least 90% homology to the amino acid sequence of SEQ ID NO: 2, 8, 13, 17 or 21 and having L-isoleucine dioxygenase activity The method is carried out in an aqueous solvent in the presence of a species of L-isoleucine dioxygenase or in the presence of a bacterium containing the L-isoleucine dioxygenase. The production method according to claim 1, wherein the microorganism is a microorganism belonging to the genus Bacillus. The production method according to claim 2, wherein the microorganism belonging to the genus Bacillus is a microorganism selected from Bacillus thuringiensis, Bacillus licheniformis, and Bacillus sphaericus. The production method according to any one of claims 1 to 3 , wherein the hydroxylation reaction is performed in the presence of a disrupted solution prepared from cells in the logarithmic growth phase of microorganisms. Subjecting L- isoleucine hydroxylation reaction process according to any one of claims 1-4. Hydroxylase is a dioxygenase, the production method according to any one of claims 1-5. The production method according to any one of claims 1 to 6 , wherein the hydroxylase has the following properties.
(A) Oxygen, Fe ²⁺ , ascorbic acid, and 2-oxoglutaric acid are required as cofactors.
(B) The optimum pH for the reaction is pH 5 to pH 8.
(C) The optimum reaction temperature is 45 ° C. or lower.
(D) Deactivates at 50 ° C. or higher.
(E) It is inhibited by EDTA, Cu ²⁺ and Zn ²⁺ . (f) a protein having the amino acid sequence of SEQ ID NO: 2, 8, 13, 17 or 21;
(g) L-isoleucine having an amino acid sequence comprising substitution, deletion, insertion, addition or inversion of one or several amino acid residues in the amino acid sequence of SEQ ID NO: 2, 8, 13, 17 or 21 A protein having dioxygenase activity, and
(h) at least one selected from the group consisting of proteins having an amino acid sequence showing at least 90% homology to the amino acid sequence of SEQ ID NO: 2, 8, 13, 17 or 21 and having L-isoleucine dioxygenase activity Reacting L-isoleucine in an aqueous solvent in the presence of the species L-isoleucine dioxygenase and isolating the resulting (2S, 3R, 4S) -4-hydroxy-L-isoleucine (2S, 3R , 4S) -4-hydroxy-L-isoleucine or a salt thereof. (f) a protein having the amino acid sequence of SEQ ID NO: 2, 8, 13, 17 or 21;
(g) L-isoleucine having an amino acid sequence comprising substitution, deletion, insertion, addition or inversion of one or several amino acid residues in the amino acid sequence of SEQ ID NO: 2, 8, 13, 17 or 21 A protein having dioxygenase activity, and
(h) L- selected from the group consisting of proteins having an amino acid sequence showing at least 90% homology to the amino acid sequence of SEQ ID NO: 2, 8, 13, 17 or 21 and having L-isoleucine dioxygenase activity Reacting L-isoleucine in an aqueous solvent in the presence of bacteria containing isoleucine dioxygenase and isolating the resulting (2S, 3R, 4S) -4-hydroxy-L-isoleucine (2S, 3R, 4S) A process for producing 4-hydroxy-L-isoleucine or a salt thereof. The method according to claim 9 , wherein the bacterium is modified so that the activity of L-isoleucine dioxygenase is enhanced. The method according to claim 10 , wherein the activity of L-isoleucine dioxygenase is enhanced by an increase in expression of a gene encoding the L-isoleucine dioxygenase. The activity of L-isoleucine dioxygenase is enhanced by modification of an expression regulatory sequence of a gene encoding the L-isoleucine dioxygenase or an increase in the copy number of the gene encoding the L-isoleucine dioxygenase. 11. The method according to 11 . The method according to any one of claims 9 to 12 , wherein the bacterium belongs to the genus Escherichia, Pseudomonas, Corynebacterium, Arthrobacter, Aspergillus, or Bacillus. The method according to claim 13 , wherein the bacterium belongs to Escherichia coli, Arthrobacter simplex, Corynebacterium glutamicum, Arthrobactor globiformis, Arthrobactor sulfureus, Arthrobactor viscosus, or Bacillus subtilis. The method according to any one of claims 9 to 14 , wherein the bacterium is a bacterial culture, a cell, a cell treatment product, or a cell lysate.