CN101528940B

CN101528940B - Method for producing 4-hydroxy-L-isoleucine

Info

Publication number: CN101528940B
Application number: CN2007800363018A
Authority: CN
Inventors: 小寺智博; 瑟奇·V·斯米尔诺夫; 纳塔利亚·N·萨姆索诺瓦; 维罗尼卡·A·科特利亚罗瓦; 纳塔利亚·Y·拉什克维克; 尤里·I·科兹洛夫; 清水昌; 小川顺; 日比慎
Original assignee: Ajinomoto Co Inc
Current assignee: Ajinomoto Co Inc
Priority date: 2006-09-28
Filing date: 2007-09-28
Publication date: 2013-07-10
Anticipated expiration: 2027-09-28
Also published as: JP5246639B2; CN101528940A; JP2008173116A

Abstract

The present invention provides a novel highly active L-isoleucine dioxygenase from Bacillus thuringiensis. A method for manufacturing (2S,3R,4S)-4-hydroxy-L-isoleucine or a salt thereof comprising reacting L-isoleucine in an aqueous solvent in the presence of L-isoleucine dioxygenase and isolating produced (2S,3R,4S)-4-hydroxy-L-isoleucine is also provided.

Description

Method for generation of the 4-hydroxy-L-isoleucine

Technical field

The present invention relates to microbiological industry, and be specifically related to new dioxygenase and the method for preparing 4-hydroxy-L-isoleucine or its salt.

Background technology

The 4-hydroxy-L-isoleucine is can be from a seed amino acid of Semen Trigonellae (fenugreek) seed (pulse family Semen Trigonellae (Trigonella foenum-graecum L.leguminosae)) extraction and purifying.The 4-hydroxy-L-isoleucine shows the insulinotropic activity that evokes intense interest, because its hormesis obviously depends on the plasma glucose concentration in the medium, as (the Sauvaire that in (isolated perfused) the rat pancreas of ex vivo perfusion and people's pancreas islet, proves, Y. etc., Diabetes, 47:206-210, (1998)).For sulfonylurea this glucose dependency (Drucker unconfirmed, D.J., Diabetes 47:159-169, (1998)), sulfonylurea is the unique pancreotropic hormone medicine that is used for the treatment of type ii diabetes [or non-insulin-dependent diabetes mellitus (NIDDM) (NIDD or NIDDM) (non-insulin-dependent diabetes (NIDD) mellitus (NIDDM))] at present, therefore hypoglycemia is still general, a undesirable side effect (Jackson of sulfonylurea treatment, J. and Bessler, R.Drugs, 22:211-245; 295-320, (1981); Jennings, A. etc., Diabetes Care, 12:203-208, (1989)).The improvement of glucose tolerance also is known (Am.J.Physiol.Endocrinol., Vol.287, E463-E471,2004).Reported and this glucose metabolism enhanced activity and it be used for the potential application of medicine and protective foods (spy opens flat 6-157302, US2007-000463A1).

Exist only in the 4-hydroxy-L-isoleucine in the plant, because its special pancreotropic hormone effect, may be considered to new secretogogue, has potential importance for the treatment type ii diabetes, described type ii diabetes is a kind of disease (Broca that is characterised in that with the defective insulin secretion that insulin resistance is relevant in various degree, C. etc., Am.J.Physiol.277 (Endocrinol.Metab.40): E617-E623, (1999)).

A kind of by utilizing dioxygenase activity in the Semen Trigonellae extract with the method for iron, xitix, 2-oxoglutaric acid (2-oxyglutaric acid) and the oxidation of oxygen dependence Isoleucine, as the existing report of the method for preparing the 4-hydroxy-L-isoleucine (Phytochemistry, Vol.44, No.4, pp.563-566,1997).Yet, this method is as the method for preparing the 4-hydroxy-L-isoleucine and unsatisfactory, because in 20mM and above Isoleucine concentration, the activity of described enzyme is subjected to the inhibition of substrate, this enzyme does not obtain identifying as yet, the plant-derived extract of this enzyme and difficult a large amount of acquisition the, and this enzyme instability.

(4S)-eight steps of 4-hydroxyisoleucine are synthetic, its overall yield is 39% for 2S, 3R to disclose a kind of effective optical purity (optically pure).It is ethyl (2S with the bio-transformation of ethyl 2-methyl-acetoacetic acid that this synthetic committed step relates to geotrichum candidum (Geotrichum candidum), 3S)-2-methyl-3-hydroxyl-butyric ester and the synthetic (Wang of asymmetric Strecker, Q. etc., Eur.J.Org.Chem., 834-839 (2002)).

(2S is also disclosed; 3R; 4S)-that 4-hydroxyisoleucine a kind of controls the brief chemical enzymatic of six steps of stereochemistry (totalcontrol of stereochemistry) fully is synthetic; last step is by using the commercial enzymatic dissolving (Rolland-Fulcrand that is fixed on penicillin acylase G (penicillinacylase G) hydrolyzing N-phenylacetyl lactone derivatives on the Eupergit C (E-PAC) that can obtain; V. etc.; J.Org.Chem., 873-877 (2004)).

But at present, do not report as yet to the clone of any L-Isoleucine dioxygenase and by use the direct enzymatic hydroxylation of L-Isoleucine dioxygenase L-Isoleucine produce (2S, 3R, 4S)-the 4-hydroxy-L-isoleucine.

As for by microorganisms Isoleucine analogue, reported by bacillus (Bacillus) bacterium to produce 2-amino-3-ketone-4-methylvaleric acid (AMKP) (Bioorganic Chemistry, Vol.6, pp.263-271 (1977)).Yet, do not have the report about the Isoleucine hydroxylase that is derived from microorganism.

Summary of the invention

An object of the present invention is to provide the enzyme that is derived from microorganism by use produces the 4-hydroxyisoleucine and (is used for expression and comprises its free form and salt form, and can be called " 4HIL ", method down together), this method can be with a large amount of preparation 4-hydroxyisoleucines.

Purpose of the present invention comprises providing to have from Isoleucine and produces the microorganism of enzymic activity of 4-hydroxyisoleucine and the hydroxylation reaction that is derived from the enzyme of microorganism based on use produces the 4-hydroxyisoleucine from Isoleucine method.Above-mentioned purpose realizes by finding to have the microorganism that produces the enzymic activity of 4-hydroxyisoleucine from Isoleucine.

An object of the present invention is to improve (2S, 3R, 4S)-the 4-hydroxy-L-isoleucine (is used for expression and comprises its free form and two kinds of salt forms, and can be called " (2S, 3R, 4S)-4HIL ", generation down together), provide by the direct enzymatic hydroxylation of the bacterium L-Isoleucine that uses L-Isoleucine dioxygenase or have a described L-Isoleucine dioxygenase activity prepare (2S, 3R, 4S)-method of 4-hydroxy-L-isoleucine or its salt.Consider foregoing problems and carried out big quantity research, the result, the present inventor has separated a kind of bacterium with high-level L-Isoleucine dioxygenase activity from nature, cloned the gene of this L-Isoleucine dioxygenase of encoding, and found that this L-Isoleucine dioxygenase can be preferred for (the 2S of synthetic expectation, 3R, 4S)-the 4-hydroxy-L-isoleucine, finished the present invention thus.

That is to say that purpose of the present invention comprises the DNA of the L-Isoleucine dioxygenase that provides new and this L-Isoleucine dioxygenase of coding, and use this L-Isoleucine dioxygenase produce (2S, 3R, 4S)-method of 4-hydroxy-L-isoleucine.Above-mentioned purpose realizes by finding new L-Isoleucine dioxygenase of the present invention.

To describe the present invention in detail hereinafter.

An object of the present invention is to provide the method that produces 4-hydroxyisoleucine and salt thereof, it comprises the step by following generation 4-hydroxyisoleucine: Isoleucine or its salt are carried out hydroxylation reaction being derived from the presence of the hydroxylase of microorganism, and from Isoleucine generation 4-hydroxyisoleucine.

Further aim of the present invention provides aforesaid production method, and wherein said microorganism is the microorganism that belongs to bacillus.

Further aim of the present invention provides aforesaid production method, and the wherein said microorganism that belongs to bacillus is the microorganism that is selected from bacillus thuringiensis (Bacillus thuringiensis), Bacillus licheniformis (Bacillus licheniformis), Bacillus sphaericus (Bacillus sphaericus), bacillus cereus (Bacillus cereus) and Webster genus bacillus (Bacillus weihenstephanensis).

Further aim of the present invention provides aforesaid production method, and wherein said hydroxylation reaction carries out in the presence of the cell lysate of logarithmic phase microorganism cells in preparation.

Further aim of the present invention provides aforesaid production method, wherein the L-Isoleucine is carried out hydroxylation reaction.

Further aim of the present invention provides aforesaid production method, and wherein said hydroxylase is dioxygenase.

Further aim of the present invention provides aforesaid production method, and wherein said hydroxylase has following characteristic:

(a) need oxygen, Fe ²⁺, xitix and 2-oxoglutaric acid be as cofactor,

(b) optimal reaction pH is 5-8,

(c) optimal reactive temperature is 45 ℃ or lower,

(d) at 50 ℃ or higher inactivation,

(e) be subjected to EDTA, Cu ²⁺And Zn ²⁺Suppress.

Further aim of the present invention provides the dioxygenase that has following characteristic and can separate from bacillus:

(a) need oxygen, Fe ²⁺, xitix and 2-oxoglutaric acid be as cofactor,

(b) optimal reaction pH is 5-8,

(c) optimal reactive temperature is 45 ℃ or lower,

(d) at 50 ℃ or higher inactivation,

(e) be subjected to EDTA, Gu ²⁺And Zn ²⁺Suppress,

(f) be 29000 ± 2000 subunit as measuring by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, comprising molecular weight,

(g) has the aminoacid sequence of SEQ ID NO:5 at N-terminal.

Further aim of the present invention provides aforesaid dioxygenase, and wherein said bacillus is bacillus thuringiensis.

Further aim of the present invention provides the DNA that is selected from down group:

(a) comprise the DNA of the nucleotide sequence of SEQ ID No:1;

(b) under stringent condition, hybridize and encode with the DNA with complementary nucleotide sequence of SEQ ID No:1 nucleotide sequence and have the protein DNA of L-Isoleucine dioxygenase activity;

(c) coding comprises the protein DNA of the aminoacid sequence of SEQ ID No:2;

(d) protein DNA of encoding and having following aminoacid sequence and having L-Isoleucine dioxygenase activity, described aminoacid sequence comprises replacement, disappearance, insertion, interpolation or the inversion (inversion) of one or several amino-acid residue in the aminoacid sequence of SEQ ID No:2; With

(e) protein DNA of encoding and having following aminoacid sequence and having L-Isoleucine dioxygenase activity, the aminoacid sequence of described aminoacid sequence and SEQ ID No:2 are at least 98% homologies.

Further aim of the present invention provides the recombinant DNA by following acquisition: the DNA (the DNA containing the same) that will comprise above-mentioned DNA is connected with carrier DNA.

Further aim of the present invention provides by the recombinant DNA that comprises above-mentioned recombinant DNA (therecombinant DNA containing the same) cell transformed.

Further aim of the present invention provides for generation of the method for protein with L-Isoleucine dioxygenase activity, it comprises: the protein that cultivation comprises the cell of described recombinant DNA and accumulation has L-Isoleucine dioxygenase activity in substratum and/or cell in substratum.

Further aim of the present invention provides the protein that is selected from down group:

(f) comprise the protein of the aminoacid sequence of SEQ ID No:2;

(g) protein that has following aminoacid sequence and have L-Isoleucine dioxygenase activity, described aminoacid sequence comprises replacement, disappearance, insertion, interpolation or the inversion of one or several amino-acid residue in the aminoacid sequence of SEQ ID No:2; With

(h) with aminoacid sequence at least 98% homology of SEQ ID No:2 and the protein with L-Isoleucine dioxygenase activity.

Further aim of the present invention provides a kind of protein, and it comprises:

(A) have the hydroxylation of catalysis by the L-Isoleucine produce (2S, 3R, 4S)-reactive activity of 4-hydroxy-L-isoleucine;

(B) described activity depends on divalent cation Fe ²⁺And

(C) as measuring by SDS-PAGE, the molecular weight of each subunit is about 29 ± 2.0kDa.

Further aim of the present invention provide for the preparation of (2S, 3R 4S)-method of 4-hydroxy-L-isoleucine or its salt, comprise step:

Be selected from the presence of at least a L-Isoleucine dioxygenase of organizing down, the L-Isoleucine reacted in aqueous solvent (aqueous solvent):

(f) comprise the protein of SEQ ID No:2,8,13,17 or 21 aminoacid sequence,

(g) protein that has following aminoacid sequence and have L-Isoleucine dioxygenase activity, described aminoacid sequence in SEQ ID No:2,8,13,17 or 21 aminoacid sequence, comprise one or several amino-acid residue replacement, disappearance, insertion, interpolation or inversion and

(h) with SEQ ID No:2,8,13,17 or 21 aminoacid sequence at least 70% homology and the protein with L-Isoleucine dioxygenase activity;

The separation generation (2S, 3R, 4S)-the 4-hydroxy-L-isoleucine.

Comprising in the presence of the bacterium that is selected from the L-Isoleucine dioxygenase of organizing down, the L-Isoleucine reacted in aqueous solvent:

(f) comprise the protein of SEQ ID No:2,8,13,17 or 21 aminoacid sequence,

(h) with SEQ ID No:2,8,13,17 or 21 aminoacid sequence at least 70% homology and the protein with L-Isoleucine dioxygenase activity; With

The separation generation (2S, 3R, 4S)-the 4-hydroxy-L-isoleucine.

Further aim of the present invention provides aforesaid method, and wherein said bacterium is modified to strengthen the activity of L-Isoleucine dioxygenase.

Further aim of the present invention provides aforesaid method, wherein strengthens the activity of described L-Isoleucine dioxygenase by the expression that increases L-Isoleucine dioxygenase.

Further aim of the present invention provides aforesaid method, and wherein the copy number of the expression of gene regulating and controlling sequence by modifying coding L-Isoleucine dioxygenase or the gene by increasing coding L-Isoleucine dioxygenase increases the expression of described L-Isoleucine dioxygenase.

Further aim of the present invention provides aforesaid method, and wherein said bacterium belongs to Escherichia (Escherichia), Rhodopseudomonas (Pseudomonas), Corynebacterium (Corynebacterium), genus arthrobacter (Arthrobacter), Aspergillus (Aspergillus) or bacillus.

Further aim of the present invention provides aforesaid method, and wherein said bacterium belongs to intestinal bacteria (Escherichia coli), Arthrobacter simplex (Arthrobacter simplex), Corynebacterium glutamicum (Corynebacterium glutamicum), Arthrobacter globiformis (Arthrobactor globiformis), sulphur Arthrobacter (Arthrobactor sulfureus), mucus Arthrobacter (Arthrobactor viscosus) or subtilis (Bacillus subtilis).

Further aim of the present invention provides aforesaid method, and wherein said bacterium is bacterial cultures, cell, treated cell (treated cells) or cell lysate.

The accompanying drawing summary

The generation that the diagram that Fig. 1 shows has represented 4-hydroxyisoleucine and AMKP in the culture of bacterial strain 2-e-2 over time.

The diagram that Fig. 2 shows has represented the variation of turbidity in the culture of bacterial strain 2-e-2.

The diagram that Fig. 3 shows has represented by the generation 4-hydroxyisoleucine of the resting cell observation of using bacterial strain 2-e-2 and the activity of AMKP.

The 4-hydroxyisoleucine that the diagram that Fig. 4 shows has represented several samples produces active.

The 4-hydroxyisoleucine that the diagram that Fig. 5 shows has represented bacterial strain 2-e-2 cell lysate produces active pH dependency.

The 4-hydroxyisoleucine that the diagram that Fig. 6 shows has represented bacterial strain 2-e-2 cell lysate produces active temperature dependency.

The 4-hydroxyisoleucine that the diagram that Fig. 7 shows has represented bacterial strain 2-e-2 cell lysate produces active temperature stability.

The 4-hydroxyisoleucine that the diagram that Fig. 8 shows has represented purifying enzyme produces active pH dependency.

The 4-hydroxyisoleucine that the diagram that Fig. 9 shows has represented purifying enzyme produces active temperature dependency.

The 4-hydroxyisoleucine that the diagram that Figure 10 shows has represented purifying enzyme produces active temperature stability.

Figure 11 shows that the present invention produces the schema of the method for IDO (flowchart).

Figure 12 shows from bacillus thuringiensis bacterial strain 2-e-2 purifying IDO (photo).Described the SDS-PAGE from the protein prepared product of purification step.Swimming lane: the mark of 1-indication molecule amount; The rough cell lysate of 2-; The 3-ammonium sulfate precipitation; 4-SEC; 5-AEC.

Figure 13 shows that the MS from the IDO of bacillus thuringiensis bacterial strain 2-e-2 identifies.

Figure 14 shows bacillus thuringiensis (Israel's serovar (serovar israelensis), ATCC35646) translation starting point of inferring of RBTH_06809 ORF.

Figure 15 shows the artificial expression module (module) of reorganization pMW119-IDO (Lys, 32/23) plasmid.

Figure 16 shows the dna sequence dna of mensuration of the physical map of pMW119-IDO (Lys, 23) plasmid and clone's the BamHI-SacI fragment that comprises IDO structure gene.Spontaneous point mutation in the regulatory region of grey mark.

Figure 17 shows the dna sequence dna that the physical map of pMW119-IDO (Lys, 32) plasmid and clone's the BamHI-SacI fragment that comprises IDO structure gene is measured.

Figure 18 shows the DNA comparison corresponding to the structure gene of IDO (Lys, 23), IDO (Lys, 32) and RBTH_6809 (brachymemma of 5 ' end).With the variable position of grey mark.

Figure 19 shows the protein comparison of IDO (Lys, 23), IDO (Lys, 32) and RBTH_06890 ORF.With the variable position of this grey mark.

Figure 20 shows IDO from bacillus thuringiensis, from the BC1061 of bacillus cereus with from the protein comparison of the conservative hypothetical protein of Webster genus bacillus.

The best mode that carries out an invention

In this manual, the 4-hydroxyisoleucine means a type or two or more types mixture in the diastereomer that is selected from down group: (2S, 3S, 4S)-the 4-hydroxyisoleucine, (2S, 3R, 4R)-4-hydroxyisoleucine, (2S, 3S, 4R)-the 4-hydroxyisoleucine and (2S, 3R, 4S)-the 4-hydroxyisoleucine.The 4-hydroxyisoleucine preferably (2S, 3R, 4S)-or (2R, 3R 4S)-the 4-hydroxyisoleucine, or their mixture, be more preferably (2S, 3R, 4S)-the 4-hydroxyisoleucine.

Particularly, term " (2S, 3R, 4S)-the 4-hydroxy-L-isoleucine " or " (2S, 3R, 4S)-4HIL " can refer to the simplification compound or contain (2S, 3R, 4S)-mixture of 4-hydroxyisoleucine.

Term " bacterium " or " microorganism " comprise the mutant of bacterium or microorganism, the existence of producing enzyme or these bacteriums that strengthened the target enzyme activity or microorganism and genetic recombination body etc. as being used for this specification sheets.

＜I〉produce the enzymic activity of 4HIL from Isoleucine

Produce the hydroxylase that uses in the method for 4-hydroxyisoleucine as the Isoleucine hydroxylation reaction that the present invention is based on hydroxylase catalysis, can use any rough enzyme such as microorganisms cultures, bacterial cell or cell lysate or purifying enzyme, as long as selected materials has the enzymic activity that Isoleucine is converted into the 4-hydroxyisoleucine.Rough enzyme is desirable as the cell that breaks or the enzyme of purifying.

The example of hydroxylase comprises oxygenase, dioxygenase etc., and dioxygenase preferably.Can separate and hydroxylase with following characteristic is preferred from bacterial strain 2-e-2:

(a) need oxygen, Fe ²⁺, xitix and 2-oxoglutaric acid be as cofactor,

(b) optimal reaction pH is 5-8,

(c) optimal reactive temperature is 45 ℃ or lower,

(d) at 50 ℃ or higher inactivation,

(e) be subjected to EDTA, Cu ²⁺And Zn ²⁺Suppress.

Can further have following characteristic from the hydroxylase that bacterial strain 2-e-2 separates:

(f) as measuring by SDS-PAGE, be that 29000 ± 2000 subunit is formed by molecular weight,

(g) has the aminoacid sequence of SEQ ID NO:5 at N-terminal.

When hydroxylase needs cofactor, preferably add or supply described cofactor to system.The example that is used for the cofactor of dioxygenase comprises, for example, and Fe ²⁺, xitix and 2-oxoglutaric acid.When they form salt, these cofactors can be added or are supplied to system with the form of their salt.

As described microorganism, can use any microorganism, as long as selection is to have the microorganism that Isoleucine is changed into the enzymic activity of 4-hydroxyisoleucine under described hydroxylation reaction condition.

The example of the microorganism of using comprises the microorganism that belongs to bacillus or Rhodopseudomonas, their mutant or derivative, etc.In addition, described microorganism can be such microorganism, and wherein by the described hydroxylase of gene recombination technology expression, and described microorganism has 4-hydroxyisoleucine generation activity.

Specific examples comprises bacillus thuringiensis (bacterial strain 2-e-2, strains A KU 238, bacterial strain NBRC3958, strains A TCC 35646 etc.), Bacillus licheniformis (strains A KU 223, bacterial strain IAM 11054 etc.), Bacillus sphaericus (strains A KU 227, bacterial strain NBRC 3526 etc.), bacillus cereus strain ATCC 14579 and Webster Bacillus strain KBAB4.With bacterial strain 2-e-2 called after AJ110584 bacterial strain, and be defined in according to budapest treaty and be deposited in Independent Administrative Leged Industrial Technology Complex Inst special permission microbial preservation center (independent administrative agency on September 27th, 2006, National Institute of Advanced Industrial Science and Technology, InternationalPatent Organism Depositary) (Tsukuba Central 6,1-1, Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, 305-8566, and obtain accession number FERM BP-10688 Japan).

In mentioned microorganism, strain name can be from Laboratory ofFermentation Physiology and Applied Microbiology with initial those of AKU, Division of Applied LifeSciences, Graduate School of Agriculture, Kyoto University (Kyoto University Academy of Agricultural Sciences uses life science portion fermentation physiology and applied microbiology laboratory) obtains.Strain name is kept at Laboratory of Bioresources with initial those of IAM, Institute of Molecular and CellularBiosciences, the IAM culture collection center of the University of Tokyo (Tokyo University's molecule and cell biological Science Institute Biological resources laboratory), and can obtain by using registration number.The registration number corresponding with described bacterial strain listed in IAM catalogue (IAM Catalogue of Strains Third Edition (the IAM bacterial strain catalogue third edition), 2004).Strain name can be from (the independent administrative agency of independent administrative corporation's product evaluation technical foundation mechanism with initial those of NBRC, NationalInstitute of Technology and Evaluation) (2-5-8, Kazusa Kamatari, Kisarazu-shi, Chiba 292-0818) obtains.Strain name can be from American type culture collection (ATCC) (postal address: ATCC, P.O.Box 1549, Manassas, VA 20108,1, UnitedStates of America) with initial those of ATCC.Webster Bacillus strain KBAB4 can be from France national farming research institute (Institut National de la Recherche Agronomique) (postal address: GenetiqueMicrobienne, INRA, Domaine de Vilvert, 79352 Jouy en Josas cedex France) obtain.

Bacillus thuringiensis bacterial strain 2-e-2 is a kind of bacterial strain that is separated recently from the soil of urban, capital by the present inventor, and the science characteristic of this bacterial strain is shown in hereinafter.

The systematics property of bacillus thuringiensis bacterial strain 2-e-2

1. phenotype

Cellular form: genus bacillus (size: 1.0-1.2 * 2.0-3.0 μ m)

Gramstaining :+

Statospore (endospore) :+

Attitude to oxygen: aerobic

Growth temperature: at 20-35 ℃ of well-grown (favorable growth)

Optimum pH:pH7.0-7.5

2. analyze based on the Molecular Phylogeny and Evolution (phylogenetic) of 16S rDNA nucleotide sequence

By using BLAST at bacteria types bacterial strain database (NCIMB Japan, Shizuoka (Shizuoka)) homology of search and the 16SrDNA nucleotide sequence (SEQ ID NO:9) of bacterial strain 2-e-2 and in the international nucleotide sequence database (GenBank/DDBJ/EMBL) respectively retrieves the bacterial strain of 30 homologies.Then, use from bacteria types bacterial strain database retrieval to 30 homologous strains and create the Molecular Phylogeny and Evolution tree according to the 16S rDNA nucleotide sequence of the various samples of adjacent method.For the Molecular Phylogeny and Evolution tree of homology search and generation simplification, and use DNAsisPro (Hitachi Software EngineeringCo., Ltd., Tokyo).

The result who uses the bacteria types bacterial strain of BLAST database to carry out the homology search is that the 16S rDNA of the partial nucleotide sequence of the 16S rDNA of bacterial strain 2-e-2 and bacillus thuringiensis ATCC 10792 bacterial strains mates with 100% homology.The result who GenBank/DDBJ/EMBL is carried out the homology search is the high homology of demonstration of the 16S rDNA of bacterial strain 2-e-2 and bacillus thuringiensis.In addition, use bacterial strain 2-e-2 16S rDNA and from bacteria types bacterial strain database retrieval to the result of simplification Molecular Phylogeny and Evolution analysis of 16S rDNA of 30 homologous strains be, bacterial strain 2-e-2 has formed substantially the same phyletic evolution branch with the 16S rDNA of bacillus thuringiensis, illustrates that they are closely related very much.

3. classification and the result that identifies

The result of the morphological observation of simplifying is that bacterial strain 2-e-2 has shown the total characteristic of bacillus, and the analytical results of part 16S rDNA sequence is shown that also bacterial strain 2-e-2 belongs to bacillus thuringiensis.Produce activity owing to find the AMKP that microorganism and bacterial strain 2-e-2 do not demonstrate same level, so be new bacterial strain with this identification of strains.

The microorganism of using among the present invention can be cultivated according to conventional cultural method.Natural medium or synthetic medium all can be used for cultivating, as long as contain can be by the carbon source of described microbial assimilation, nitrogenous source, inorganic salt etc. for described substratum, and can cultivate described microorganism effectively in this substratum.

Carbon source can be can be by the carbon source of described microbial assimilation, and can use carbohydrate such as glucose, fructose, sucrose, maltose, starch, starch hydrolyzates and molasses, organic acid such as acetic acid, lactic acid and glyconic acid, and alcohol is as ethanol and propyl alcohol.As nitrogenous source, can use ammonia, various mineral acid and organic acid ammonium salt such as ammonium sulfate, ammonium chloride, ammonium acetate and ammonium phosphate, other nitrogenous compound, peptone, meat extract, yeast extract, corn steep liquor, casein hydrolysate, soyflour, soyflour hydrolyzate, various fermentation cell and digestion product thereof etc., as long as described microorganism can assimilate them.

As inorganic salt, can use potassiumphosphate, ammonium sulfate, ammonium chloride, sodium-chlor, sal epsom, ferrous sulfate, manganous sulfate etc., as long as the microorganism of using can assimilate them.In addition, calcium salt, zinc salt, boron salt, mantoquita, cobalt salt, molybdenum salt etc. can be used as the trace elements interpolation.In addition, VITAMIN such as VitB1 and vitamin H, amino acid such as L-glutamic acid and aspartic acid, nucleic acid-related substance such as VITAMIN B4 and guanine etc. can add as required.

Cultivation is carried out under aerobic conditions, as by shake culture or master gas mixing and mix the condition that culture (deepaeration stirring culture) obtains.The preferred 10-37 of culture temperature ℃, incubation time is 5-40 hour.PH with culture in culturing process remains on 5.0-9.0.By using mineral acid or organic acid, alkaline solution, urea, calcium carbonate, ammonia to wait to regulate pH.

The cell of rough enzyme as breaking that uses among the present invention, it is the microorganism cells lysate, can be the rough enzyme that comprises the outer hydroxylase of born of the same parents, its example comprises the bacterial cell of handling with tensio-active agent, organic solvent or enzyme, cell through ultrasonic, mechanical disruption or solvent treatment, the cell protein fraction, the cured product of treated cell, etc.Described cell lysate preferred preparation is from the cell of logarithmic phase.

In order to prepare cell lysate, the bacterial cell of cultivating can be washed with isotonic solution such as physiological saline, by any means it is broken then, for example, use the extruding of French press (French press), granulated glass sphere, Ultrasonic Cell Disruptor (ultrasonic disruptor), Manton Gaulin homogeneous instrument, mortar (mortar) or their combination etc. to break.In order further effectively to break, can to pass through freezing treatment, enzyme processing etc. and handle surface of cell membrane with physics or chemical process.During cell rupture, make cell always remain on low temperature, and when the lysis temperature raises because of disruption treatments, can immediately temperature be reduced.

The example that is used for the aqueous medium of cell lysate includes, but not limited to damping fluid and the Good damping fluid of water and damping fluid such as borate, acetate, carbonate, Tris, phosphoric acid salt, Citrate trianion.In addition, glycerine, DTT etc. can be added as enzyme stabilizers, and EDTA, EGTA, PMSF, pepstatin, E-64 etc. can be added as proteinase inhibitor.Also can add combination, inhibitor mixed thing (inhibitor cocktail) of inhibitor etc.

About the composition of the aitiogenic substrate solution of 4-hydroxyisoleucine that uses above-mentioned cell lysate, can use volume be 100 μ l contain 5mM Isoleucine, 5mM 2-oxoglutaric acid, 5mM xitix and 5mM Fe ²⁺100mM HEPES damping fluid (pH7.0), and will be reflected at 30 ℃ and carry out 60 minutes.Except the HEPES damping fluid, also can use any damping fluid such as MES damping fluid and GTA wide area damping fluid (GTA wide range buffer).With after the enzyme deactivation, the centrifugal supernatant fraction of reaction soln is filtered as required, and confirm the generation of 4-hydroxyisoleucine by high performance liquid chromatography or TLC.

Can come quantitative 4-hydroxyisoleucine by any method, can be with the analytical system of 4-hydroxyisoleucine and other component separating as long as used, and the example of described analytical system comprises TLC and high performance liquid chromatography.Among them, high performance liquid chromatography is preferred for quantitative analysis, reason be it highly sensitive and high score from ability.Example comprises amino acid analysis method Waters AccQ-Tag ^TMMethod, etc.By improved Waters AccQ-Tag ^TMMethod (embodiment that vide infra and describe), the diastereomers that can separate the 4-hydroxyisoleucine, and the 4-hydroxyisoleucine that can separating natural exists and 2-amino-3-methyl-4-ketone valeric acid (a kind of ketone compounds of the hydroxyl formation by oxidation 4-hydroxyisoleucine).

The 4-hydroxyisoleucine that produces according to the present invention can separate by using the conventional amino acid purification process that adopts.For example, by using the combination of ion exchange resin treatment, film processing, crystallization etc., the supernatant (by the centrifugal solid of therefrom removing) of 4-hydroxyisoleucine reaction mixture can be separated.

In production method of the present invention, the pH that is used for the Isoleucine hydroxylation reaction is 5-8 preferably.About the composition of reaction mixture, preferably in described mixture, there is the factor to the enzyme reaction key.Work as Fe ²⁺When being key factor, expected response mixture composition unlikely causes and Fe ²⁺Chelating, as HEPES damping fluid, MES damping fluid and GTA wide area damping fluid.Yet it is basic unrestricted that reaction mixture is formed, as long as keep Fe ²⁺Effect get final product.

In production method of the present invention, be used for normally 15-30 ℃ of the temperature of Isoleucine hydroxylation reaction, preferred 45 ℃ or lower.Normally 5 minutes to 200 hours reaction times is although it depends on the enzyme quantitative changeization.

Isoleucine as being used for hydroxylation reaction preferably uses the L-Isoleucine.

The example of the solvent that reacts therein comprises aqueous solvent, for example, water, the damping fluid of damping fluid such as carbonate, acetate, borate, Citrate trianion and Tris, organic solvent, for example, pure as methyl alcohol and ethanol, ester such as ethyl acetate, ketone such as acetone, acid amides such as ethanamide contain the aqueous solvent of these organic solvents, etc.In addition, can add as required for the factor that activates hydroxylation reaction.

The protein concentration of the microorganism cells lysate that uses among the present invention is 0.1-50mg/ml, preferred 0.5-20mg/ml (according to cell weight (weight in wet base)).The 4-hydroxy-L-isoleucine can be by following generation: hydrotropisms's medium adds cell lysate, substrate and cofactor with suitable concentration, and make described be reflected at 45 ℃ or lower temperature, preferred 30 ℃, and pH5-12, preferred pH5-7.5 carried out 5 minutes to 120 hours.

＜II〉L-Isoleucine dioxygenase and the DNA of this L-Isoleucine dioxygenase of coding and their purposes

Provide about [I] L-Isoleucine dioxygenase below with reference to accompanying drawing, [II] use L-Isoleucine dioxygenase of the present invention produce (2S, 3R, 4S)-detailed description of the method for 4-hydroxy-L-isoleucine.

[I] L-Isoleucine dioxygenase

According to inventor's research, confirmed the bacterial isolates in the bacillus comprise and have formation (2S, 3R, 4S)-the L-Isoleucine dioxygenase of 4HIL ability.To be abbreviated as IDO from the L-Isoleucine dioxygenase of microorganism cells hereinafter.

As mentioned above, the screening to environmental microorganism that the present inventor provides has disclosed unique microorganism bacillus thuringiensis bacterial strain 2-e-2 to have and can catalysis (is used for expression and comprises its free form and two kinds of salt forms from the L-Isoleucine, directly form (2S down together), 3R, 4S)-reactive activity of 4HIL.The microorganism cells purifying of the described microorganism that the present inventor cultivates has certainly also separated new L-Isoleucine dioxygenase, is abbreviated as IDO (Lys, 23) hereinafter.

In addition, the present inventor's dioxygenase of being derived from bacillus thuringiensis bacterial strain 2-e-2 by purifying has been determined the-terminal amino acid sequence of IDO (Lys, 23).With bacillus thuringiensis bacterial strain 2-e-2 called after bacillus thuringiensis AJ110584, and be defined in according to budapest treaty and be deposited in Independent Administrative Leged Industrial Technology Complex Inst on September 27th, 2006 and specially permit biological preservation center (Central 6,1-1-1Higashi, Tsukuba, Ibaraki 305-8566, Japan) and obtain accession number FERM BP-10688.

In addition, the present inventor has also synthesized (the Lys from IDO, the dna molecular of about 30 base pairs that aminoacid sequence 23) is inferred, use is from the chromosomal DNA of bacillus thuringiensis bacterial strain 2-e-2 and hereinafter be abbreviated as IDO (Lys, 23) the L-Isoleucine dioxygenase from bacillus thuringiensis (Israel's serovar) bacterial strain (ATCC 35646) separates in contrast and has obtained coding IDO (Lys, 23) total length of DNA has made up recombinant plasmid and has transformed the cell of coli strain with them.Subsequent analysis to recombination bacillus coli IDO activity has disclosed IDO (Lys, the 23) activity of comparing much higher (5 times high) with IDO (Lys, 32), and reason is to suddenly change from the uniqueness in the IDO of bacillus thuringiensis bacterial strain 2-e-2 (Lys, the 23) gene.

The encode DNA of IDO (Lys, 23) of the present invention who identifies described in embodiment part is shown in SEQ ID No:1 in the sequence table.In addition, the aminoacid sequence by the nucleotide sequence coded IDO (Lys, 23) of SEQ ID No:1 is shown in SEQ ID No:2.SEQ ID No:2 is the aminoacid sequence by the nucleotide sequence coded IDO of SEQ ID No:1 (Lys, 23).The IDO of SEQ ID NO:2 (Lys, 23) has L-Isoleucine dioxygenase activity, and catalysis from the L-Isoleucine of a molecule directly synthetic hereinafter shown in the formula (I) (2S, 3R, 4S)-reaction of 4HIL.

Secondly, provide the DNA about (1) coding L-Isoleucine dioxygenase successively, the characteristic of (2) L-Isoleucine dioxygenase and (3) are for generation of the method for L-Isoleucine dioxygenase.

(1) DNA of coding L-Isoleucine dioxygenase

The chromosomal DNA of the bacillus thuringiensis bacterial strain 2-e-2 that IDO of the present invention (Lys, 23) gene isolation with nucleotide sequence of SEQ ID No:1 is partly described from embodiment.Coding IDO (Lys, 23), show the high-level homology of part (non-annotated part) in nucleotide sequence (Figure 19) and aminoacid sequence (Figure 18) with bacillus thuringiensis (Israel's serovar) bacterial strain (ATCC 35646) genome nucleotide sequence no noting from the nucleotide sequence of the SEQ ID No:1 of bacillus thuringiensis bacterial strain 2-e-2, one of them is committed to National Center for BiotechnologyInformation (American National bioinformation center) on January 17th, 2007, NIH (national sanitary institute), Bethesda, MD 20894, USA (accession number: AAJM00000000.1, GI:74494335), another obtains the coding IDO (Lys from identical bacillus thuringiensis (Israel's serovar) bacterial strain, the sequencing result of genomic dna 32), described bacillus thuringiensis (Israel's serovar) bacterial strain (VKPM) is obtained by Russia state-run industrial microorganism preservation center (Russian National Collection of IndustrialMicroorganisms) with accession number VKPM B-197.Nucleotides sequence from the coding IDO (Lys, 32) of bacillus thuringiensis (Israel's serovar) bacterial strain VKPM B-197 is shown in SEQ ID NO:7.

Hereinafter will provide about obtain the explanation of the method for IDO aminoacid sequence from product IDO bacterium.

Reclaim major protein and be the RBTH_06809 albumen (Figure 13) of inferring from bacillus thuringiensis (Israel's serovar) ATCC 35646 bacterial strains by the MS Analysis and Identification from gel.

The protein sample that extracts from SDS-PAGE has been carried out mass spectroscopy.According to Govorun, (The proteome comparative analysis of Helicobacter pylori clinical isolates.Biochemistry (Rus) such as V.M., 68,42-49 (2003)) rules are carried out Gel Treatment, trypsin hydrolyzing (trypsinolysis), proteins extraction and the mass analysis by substance assistant laser desorpted ionized time-of-flight mass spectrometry (TOFMS) (MALDI-TOF).(the photodissociation peptide quality of Matrix Science, PeptideFingerprint USA) (peptide fingerprint) the option protein by is in groups identified this protein to use Mascot software.

Can use based on the suitable primer of the sequences Design of bacillus thuringiensis (Israel's serovar) bacterial strain (ATCC 35646) by PCR obtain the to encode dna fragmentation of IDO.

Be used for the method for PCR at open source literature such as White, T.J. etc., Trends Genet.5,185 (1989) middle descriptions.Method for separating of chromosomal DNA, and use dna molecular to separate the method for the dna molecular of expectation from gene library as probe, at open source literature such as Molecular Cloning, describe among the 3rdedition (the 3rd edition), Cold Spring Harbor Laboratory Press (2001).

Be used for to measure the method for separated DNA nucleotide sequence of coding IDO at A Practical Guideto Molecular Cloning, John Wiley﹠amp; Describe among the Sons, Inc. (1985).In addition, can measure nucleotide sequence by using the dna sequencing instrument of being made by Applied Biosystems.The DNA that is derived from the coding IDO (Lys, 23) of bacillus thuringiensis bacterial strain 2-e-2 is shown in SEQ ID No:1.Nucleotides sequence from the coding IDO (Lys, 32) of bacillus thuringiensis (Israel's serovar) bacterial strain VKPM B-197 is shown in SEQ ID No:7.

Catalysis from the L-Isoleucine form (2S, 3R, 4S)-coding DNA of the IDO of the reaction of 4HIL is not only the DNA shown in the SEQ ID No:1.This be because form catalysis from the L-Isoleucine produce (2S, 3R, 4S)-the bacillus bacterial classification of the IDO of the reaction of 4HIL in, from each bacterial classification and the observed nucleotide sequence of bacterial strain, should there are differences.

DNA of the present invention not only comprises the separated DNA of the IDO that encodes, also comprise the DNA that has manually added sudden change to the DNA of the coding IDO that separates self-produced IDO microbial staining body DNA among the DNA of the present invention, as long as the IDO that this dna encoding has the described reactive activity of catalysis.Be used for artificial method of adding sudden change and comprise normally used method, as Method.in Enzymol., 154 (1987) the middle methods of describing that are used for the introduction site specific mutant.

Under stringent condition, be also included among the DNA of the present invention with the DNA hybridization of the complementary nucleotide sequence with SEQ ID No:1 nucleotide sequence and the protein DNA with IDO activity of encoding.As being used for this paper, " stringent condition " refers to such condition, forms the specific hybrid body and do not form nonspecific heterozygote under this condition.Although be difficult to use clearly these conditions of numeral, but as example, what deserves to be mentioned is following condition: under this condition homology for example be higher than preferred 70% or higher, more preferably 80% or higher, also more preferably 90% or higher and especially preferred 95% or the dna molecular phase mutual cross of higher homology, and have not phase mutual cross of dna molecular than low homology; Perhaps under this condition, under the conventional wash conditions of Southern hybridization, produce hybridization, described normal condition is that salt concn is equivalent to 0.1 * SSC and 0.1%SDS at 37 ℃, and preferred 0.1 * SSC and 0.1%SDS be at 60 ℃, and more preferably 0.1 * SSC and 0.1%SDS at 65 ℃.Probe length can depend on hybridization conditions and select suitably, and changes at 100 bp to 1 kbp usually.In addition, " L-Isoleucine dioxygenase activity " for from the L-Isoleucine synthetic (2S, 3R, 4S)-activity of 4HIL may be enough.Yet, be listed under the situation of hybridizing with the complementary nucleotide sequence of SEQ ID No:1 nucleotide sequence under the stringent condition at nucleotides sequence, preferably under 37 ℃ and pH 8 conditions, keep the protein with SEQ ID No:2 aminoacid sequence L-Isoleucine dioxygenase activity 10% or more, preferred 30% or more, more preferably 50% or more, and more preferably 70% or more.

In addition, coding is also included among the DNA of the present invention basically with by the identical protein DNA of the IDO of the dna encoding of SEQ ID No:1.That is, following DNA is also included among the DNA of the present invention:

(a) comprise the DNA of the nucleotide sequence of SEQ ID No:1;

(b) protein DNA of under stringent condition, hybridizing and encoding and have L-Isoleucine dioxygenase activity with the DNA of the complementary nucleotide sequence with SEQ ID No:1 nucleotide sequence;

(c) coding comprises the protein DNA of the aminoacid sequence of SEQ ID No:2;

(d) protein DNA of encoding and having following aminoacid sequence and having L-Isoleucine dioxygenase activity, described aminoacid sequence comprises replacement, disappearance, insertion, interpolation or the inversion of one or several amino-acid residue in the aminoacid sequence of SEQ ID No:2; With

(e) protein DNA of encoding and having following aminoacid sequence and having L-Isoleucine dioxygenase activity, the aminoacid sequence of described aminoacid sequence and SEQ ID No:2 is at least 70% homology, preferred at least 80% homology, more preferably at least 90% homology, and more preferably at least 95% homology.

At this, the 3D structure of " one or several " finger protein matter amino-acid residue or L-Isoleucine dioxygenase activity are not subjected to the scope significantly damaged, and more specifically, scope is 1-78, preferred 1-52, more preferably 1-26, and more preferably 1-13.

The replacement of one or several amino-acid residue, disappearance, insertion, interpolation or inversion should be that the sudden change of guarding is so that retentive activity.Representational conservative sudden change is conservative the replacement.The conservative example that replaces comprises with Ser or Thr replacement Ala, use Gln, His or Lys replace Arg, use Glu, Gln, Lys, His or Asp replace Asn, use Asn, Glu or Gln replace Asp, replace Cys with Ser or Ala, use Asn, Glu, Lys, His, Asp or Arg replace Gln, use Asn, Gln, Lys or Asp replace Glu, replace Gly with Pro, use Asn, Lys, Gln, Arg or Tyr replace His, use Leu, Met, Val or Phe replace Ile, use Ile, Met, Val or Phe replace Leu, use Asn, Glu, Gln, His or Arg replace Lys, use Ile, Leu, Val or Phe replace Met, use Trp, Tyr, Met, Ile or Leu replace Phe, replace Ser with Thr or Ala, replace Thr with Ser or Ala, replace Trp with Phe or Tyr, use His, Phe or Trp replace Tyr and use Met, Ile or Leu replace Val.

In addition, " L-Isoleucine dioxygenase activity " refer to as mentioned above from the L-Isoleucine synthetic (2S, 3R, 4S)-activity of 4HIL.Yet, comprise in the aminoacid sequence of SEQ ID No:2 at aminoacid sequence under the situation of replacement, disappearance, insertion, interpolation or inversion of one or several amino-acid residue, preferably under the condition of 30 ℃ and pH 6.0, keep the aminoacid sequence with SEQ ID No:2 protein L-Isoleucine dioxygenase activity 10% or more, preferred 30% or more, more preferably 50% or more, and more preferably 70% or more.The L-Isoleucine dioxygenase activity of IDO of the present invention can by use high performance liquid chromatography (HPLC) analysis (2S, 3R, 4S)-4HIL measures from the formation of L-Isoleucine.

In addition, the homologue DNA of SEQ ID NO:1 can be as the gene of coding L-Isoleucine dioxygenase of the present invention.The homologue gene L-Isoleucine dioxygenase of whether encoding can be confirmed by the L-Isoleucine dioxygenase activity of measuring cell lysate or crossing the microbial cell lysate of expressing described homologue DNA.

The homologue DNA of SEQ ID NO:1 also can be used as L-Isoleucine dioxygenase of the present invention from the genome preparation of other bacillus bacterial classification (for example, bacillus cereus, Webster genus bacillus).

The comparison of the aminoacid sequence of bacillus cereus, bacillus thuringiensis, Webster genus bacillus is shown in Figure 20, and the conserved sequence between the bacillus is shown in SEQ ID NO:6.

In addition, can based on from bacillus (Bacillus), Escherichia, Corynebacterium, genus arthrobacter, Aspergillus, Rhodopseudomonas, Granulobacter (Granulibacter), methyl Pseudomonas (Methylobacillus), Granulobacter (Granulibacter), acidophilic bacteria belongs to (Acidiphilium), Agrobacterium (Agrobacterium), Gluconobacter (Gluconobacter), Caulobacter (Caulobacter), Stigmatella (Stigmatella), Myxococcus (Myxococcus), Polaromonas, Caulobacter (Caulobacter), Polaromonas, Sphingol single-cell belongs to (Sphingomonas), Acidovorax (Acidovorax), Mycobacterium (Mycobacterium), Azotobacter (Azotobacter), Vibrio (Vibrio), multinuclear Bacillaceae (Polynucleobacter), the homology of the following gene (table 1) of streptomyces (Streptomyces) etc. is by the coding homologue DNA of clone's acquisition from other bacterium.For example can using, the synthetic oligonucleotide shown in the SEQ ID NO:3 and 4 passes through the described homologue of pcr amplification.

The DNA tabulation of the coding L-Isoleucine dioxygenase that table 1. is inferred

Gene	Microorganism	Explanation	The Genbank accession number
				RBTH_06809	Bacillus thuringiensis Israel serovar ATCC 35646	Hypothetical protein RBTH_06809	AAJM01000012.1 GI：75758796
BC1061	Bacillus cereus ATCC 14579	Hypothetical protein	NC_004722.1 GI：30019216
				-	Webster genus bacillus KBAB4	Conservative hypothetical protein	ZP_01182590.1\| GI：89204011

PSPPH_3986	Pseudomonas syringae Kidney bean mutation (the Pseudomonas syringae pv.phaseolicola) 1448A that causes a disease	Hypothetical protein	NC_005773.3 GI：71735316
				GbCGDNIH1 2096	Granulibacter bethesdensis CGDNIH1	Hypothetical protein	NC_008343.1 GI：114328760
Mfla_2629	Methylobacillus flagellatus KT	Hypothetical protein	NC_007947.1 GI：91776977
				GbCGDNIH1_ 2096	Granulibacter bethesdensis CGDNIH1	Hypothetical protein	NC_008343.1 GI：114328760
-	Hide acidophilic bacteria (Acidiphilium cryptum) JF-5	Conservative hypothetical protein	ZP_01144511.1 GI：\|88939060
				-	Glucose edaphic bacillus (Agrobacterium vitis)	Hypothetical protein	ABG82019.1 GI：110671820
GOX1674	Gluconobacter oxydans (Gluconobacter oxydans) 621H	Hypothetical protein	YP：192070.1 GI：58040106
				-	Caulobacter bacterial classification (Caulobacter sp.) K31	Conservative hypothetical protein	ZP：01420729.1 GI：113934829
-	Orange stake bacterium (Stigmatella aurantiaca) DW4/3-1	Conservative hypothetical protein	ZP_01462001.1 GI：115374724
				MXAN_6813	Yellow myxococcus (Myxococcus xanthus) DK 1622	Hypothetical protein	YP：634930. GI：108759113

Table 1. (continuing)

Gene	Microorganism	Explanation	The Genbank accession number
				Bpro_0594	Polaromonas sp.JS666	Hypothetical protein	YP：547452.1 GI：91786500
CC3057	Crescent handle bacillus (Caulobacter crescentus) CB1	Hypothetical protein	NP_421851.1 GI：16127287
				-	Polaromonas naphthalenivorans CJ2	Similar to not profiling protein conservative in the bacterium	ZP_01022090.1 GI：84714798

-	Sphingol single-cell belongs to bacterial classification (Sphingomonas sp.) SKA58	The phage repressor of inferring	ZP_01302473 GI：94495894
					Acidovorax bacterial classification (Acidovorax sp.) JS42	Conservative hypothetical protein	ZP_01384166.1 GI：110595841
	Mycobacterium bacterial classification (Mycobacterium sp.) JLS	Conservative hypothetical protein	ZP_01276363.1 GI：92907583
					Wei Nielande vinelandii (Azotobacter vinelandii) AvOP	Similar to not profiling protein conservative in the bacterium	ZP_00417642.1 GI 67156016
VV21380	Vibrio vulnificus (Vibrio vulnficus) CMCP6	Hypothetical protein	NP_763273.1 GI 27367746
				VVA0217	Vibrio vulnificus YJ016	Hypothetical protein	NP_936273.1 GI 37675877
-	Multinuclear Bacillaceae bacterial classification (Polynucleobacter sp.) QLW-P1DMWA-1	Conservative hypothetical protein	ZP_01493168.1 GI 116268923
				AF484556_24	Black dull olive streptomycete (Streptomyces atroolivaceus)	Conservative hypothetical protein	AAN85502.1 GI：26541515

(2) characteristic of IDO

Secondly, provide about being derived from the explanation of L-Isoleucine dioxygenase bacillus thuringiensis bacterial strain 2-e-2, purifying (IDO (Lys, 23)) characteristic.

IDO of the present invention (Lys, 23) has the aminoacid sequence of SEQ ID No:2, as the gene isolation described by preamble with analyze institute and know definite.Yet, the present invention includes the protein that has following aminoacid sequence and also have L-Isoleucine dioxygenase activity, described aminoacid sequence comprises replacement, disappearance, insertion, interpolation or the inversion of one or several amino-acid residue in SEQ IDNo:2,8,13,17 or 21 aminoacid sequence.

That is, IDO of the present invention comprises following protein:

(f) comprise the protein of SEQ ID No:2,8,13,17 or 21 aminoacid sequence;

(g) protein that has following aminoacid sequence and have L-Isoleucine dioxygenase activity, described aminoacid sequence comprise replacement, disappearance, insertion, interpolation or the inversion of one or several amino-acid residue in SEQ ID No:2,8,13,17 or 21 aminoacid sequence; With

(h) with SEQ ID No:2,8,13,17 or 21 aminoacid sequence at least 70% homology, preferred at least 80% homology, more preferably at least 90% homology and more preferably at least 95 homologies and protein with L-Isoleucine dioxygenase activity.

At this, the definition among the DNA of the definition of " several " and " L-Isoleucine dioxygenase activity " and part (1) coding L-Isoleucine dioxygenase is identical.

IDO catalysis of the present invention from the L-Isoleucine by hydroxylation reaction synthetic (2S, 3R, 4S)-reaction of 4HIL.

The L-Isoleucine dioxygenase activity of IDO of the present invention can by use high performance liquid chromatography (HPLC) analysis (2S, 3R, 4S)-4HIL measures from the formation of L-Isoleucine.

IDO of the present invention can catalysis from the L-Isoleucine by hydroxylation reaction synthetic (2S, 3R, 4S)-reaction of 4HIL.In the hydroxylation reaction of dioxygenase catalysis, an atom of molecular oxygen is included into the L-Isoleucine, and another Sauerstoffatom is included other oxygen acceptor in, α-Tong Wuersuan for example, cause forming (2S, 3R, 4S)-4HIL and succsinic acid and release of carbon dioxide.Dioxygenase can be with stereospecific mode hydroxylation aliphatic carbon chain.Although reported up to now can catalysis L-Isoleucine as an example of the plant enzyme of the hydroxylation reaction of substrate, described plant enzyme is formed (Phytochemistry, Vol.44, No.4 by the L-Isoleucine dioxygenase that is derived from the Semen Trigonellae extract, pp.563-566,1997).But, this method is as the method for preparing the 4-hydroxy-L-isoleucine and unsatisfactory, because be subjected to the inhibition of substrate in the activity of 20mM and the above described enzyme of Isoleucine concentration, described enzyme is without evaluation, the plant-derived extract of described enzyme and difficult a large amount of acquisition the, and described enzyme instability.

The description of the enzyme characteristic of investigating at purifying IDO (Lys, 23) hereinafter will be provided thereafter.

In reacting shown in below IDO (Lys, the 23) catalysis:

L-Isoleucine+α-Tong Wuersuan+O ₂→ 4HIL+ succsinic acid+CO ₂

From the L-Isoleucine form by following general formula (I) representative (2S, 3R, 4S)-reaction of 4HIL:

Therefore, the IDO of the application of the invention (Lys, 23) from the L-Isoleucine produce (2S, 3R, 4S)-method of 4HIL also belongs to the present invention.

In addition, the active strictness of IDO of the present invention (Lys, 23) depends on divalent cation Fe ²⁺And complete closed in the presence of EDTA.IDO (Lys, 23) can catalysis be transferred to a Sauerstoffatom L-Isoleucine and another Sauerstoffatom is transferred to α-Tong Wuersuan as acceptor molecule.So IDO (Lys, 23) may belong to α-Tong Wuersuan (the dependency dioxygenase of α-ketoglutamate).

Because the molecular weight of each subunit of IDO (Lys, 23) that records by SDS-PAGE is about 29 ± 2.0kDa.Therefore, the present invention also comprises the protein that is limited by following feature:

(A) have catalysis from L-Isoleucine and α-Tong Wuersuan produce (2S, 3R, 4S)-reactive activity of 4HIL;

(B) described activity depends on divalent cation and comprises Fe ²⁺And

The aminoacid sequence that has SEQ ID NO:8 from the IDO (Lys, 32) of bacillus thuringiensis (Israel's serovar) bacterial strain VKPM B-197.

(3) for generation of the method for L-Isoleucine dioxygenase

Next, provide explanation about the method that produces IDO of the present invention.There are two kinds of methods to produce IDO of the present invention.These two kinds of methods cultivate to be produced IDO by (i) microorganism is with the method that forms and accumulate IDO and (ii) prepare by recombinant DNA technology and form the transformant of IDO, and cultivates the method composition that described transformant accumulates IDO.

(i) form by microorganism culturing and the method for accumulation IDO

The microorganism example that serves as the source that obtains IDO in the method that forms and accumulate IDO by cultivation product IDO microorganism comprises the microorganism that belongs to Escherichia, Rhodopseudomonas, Corynebacterium, genus arthrobacter, Aspergillus or bacillus.

Belong to bacillus, Escherichia, Corynebacterium, genus arthrobacter, Aspergillus, Rhodopseudomonas, Granulobacter, the methyl Pseudomonas, Granulobacter, acidophilic bacteria belongs to, Agrobacterium, Gluconobacter, Caulobacter, Stigmatella, Myxococcus, Polaromonas, Caulobacter, Polaromonas, Sphingol single-cell belongs to, Acidovorax, Mycobacterium, Azotobacter, Vibrio, the multinuclear Bacillaceae, any microorganism of streptomyces can be used in the present invention, as long as they are the microorganisms that form IDO, described IDO catalysis is from L-Isoleucine and the synthetic (2S of α-Tong Wuersuan, 3R, 4S)-and the reaction of 4HIL, and preferred microorganism comprises bacillus thuringiensis bacterial strain 2-e-2 and bacillus thuringiensis (Israel's serovar; ATCC 35646) bacterial strain.Among these, bacillus thuringiensis bacterial strain 2-e-2 is especially preferred.

Can cultivate in any form although serve as the microorganism in the source that obtains IDO, such as liquid culture and solid culture, be to master gas mixing to mix cultivation (deep-aerated stircultivation) in industrial advantageous method.The carbon source, nitrogenous source, inorganic salt and other trace nutritive element that are generally used for microorganism culturing can be as the nutritive elements of nutritional medium.Can use all source of nutrition, as long as they can be utilized by the microorganism strains that uses.

By shaking culture, the stir culture (deep ventilation stir culturing) etc. of taking a breath is under aerobic conditions carried out cultivation deeply.Culture temperature can satisfy microorganism growth and produce in the scope of IDO.Therefore, although condition is not strict, normally 10-50 ℃ of culture temperature, and preferred 15-42 ℃.Incubation time changes according to other culture condition.For example, can be with microorganism culturing to the IDO that produces maximum, and these normally about 5 hours to 7 days, and preferably approximately 10 hours-96 hours.

After cultivating, reclaim microorganism cells by centrifugal (for example, 10,000x g is 10 minutes).Because most of IDO is present in the cell, make the IDO dissolving by breaking or dissolving microorganism cells.Ultrasonicly break, the Fu Shi crushing is broken or granulated glass sphere breaks can be used for microorganism cells is broken.Under the situation of dissolved cell, take to use method, peptase processing or their appropriate combination of egg-white lysozyme (egg white lysozyme).

When purifying is derived from the IDO that produces the IDO microorganism, although be by using the enzyme solvent soln to come purifying IDO as parent material, if but not remaining not breaking or undissolved resistates, any resistates of centrifugal solvent soln and removal precipitation is favourable for purifying so again.

All normally used methods for the purifying normal enzyme can be used for purifying IDO, and the example comprises ammonium sulfate precipitation, gel permeation chromatography, ion exchange chromatography, hydrophobic interaction chromatography and hydroxyapatite.As a result, can obtain to have and contain the IDO fraction than high specific acitivity.

(ii) use the production method of recombinant DNA technology

Next, provide about using recombinant DNA technology to produce the explanation of the method for IDO.Exist many use recombinant DNA technologies to produce the known embodiment of useful proteins such as enzymes and physiologically active material, and the use of recombinant DNA technology make a large amount of the generation only be present in natural useful proteins with trace and become possibility.

Figure 11 is the schema for generation of the method for IDO of the present invention.

At first, the DNA (step S1) of preparation coding IDO of the present invention.

Secondly, the DNA for preparing is connected to produce recombinant DNA (step S2) with carrier DNA, and comes transformant to produce transformant (step S3) by described recombinant DNA.Then described transformant is cultivated in substratum, and allow IDO to form and accumulation (step S4) in substratum and/or cell.

Thereafter, described method proceeds to step S5, wherein produces the IDO of purifying by recovery and the described enzyme of purifying.

By in hydroxylation reaction, use the purifying IDO that produces at step S5 or any step S4 accumulated the substratum of IDO and/or cell can produce in a large number expectation (2S, 3R, 4S)-4HIL (step S6).

The DNA that is connected with carrier DNA can allow the expression of IDO of the present invention.

At this, the example that connects into the IDO gene of carrier DNA comprises as preamble at the DNA described in [I].

Using recombinant DNA technology to produce on a large scale under the situation of protein, cell such as bacterial cell, actinomyces (Actinomyces) cell, yeast cell, fungal cell, vegetable cell and zooblast can be as carrying out transformed host cells.The example of having developed the bacterial cell of host carrier system comprises Escherichia bacterial classification, Rhodopseudomonas bacterial classification, Clavibacter, genus arthrobacter bacterial classification, aspergillus bacterium and bacillus bacterial classification, and preferably uses intestinal bacteria and Corynebacterium glutamicum.This is because have many about using intestinal bacteria, Corynebacterium glutamicum or bacillus to produce the relevant knowledge of the technology of protein in a large number.The explanation that produces the method for L-Isoleucine dioxygenase about the intestinal bacteria of using through transforming hereinafter is provided.Be used for colibacillary following method and also can be used for Corynebacterium glutamicum or bacillus.

Be generally used for the promotor that heterologous protein produces in the intestinal bacteria and can express the promotor of the DNA of coding IDO, the example comprises (powerful) promotor such as T7 promotor, trp promotor, lac promotor, tac promotor and PL promotor by force.

For the form with the fusion rotein occlusion body produces IDO, the gene of the another kind of albumen (preferred hydrophilic peptide) of will encoding in antigen-4 fusion protein gene is connected to upstream or the downstream of IDO gene.The gene of the another kind of albumen of described coding can be such gene, the amount of the fusion rotein that it is increased accumulation and the solubility of enhancing fusion rotein after sex change and regeneration step, candidate's example of described gene comprises T7 gene 10, beta-galactosidase gene, dihydrofolate reductase gene (dehydrofolate reductase), interferon-gamma gene, interleukin-2 gene and prochymosin gene.

When these genes are connected with the gene of coding IDO, make codon read the frame coupling.Can connect described gene in suitable restriction enzyme sites or use the synthetic DNA of suitable sequence to connect.

In order to increase output, preferably with the form coupling transcription termination sequence of antigen-4 fusion protein gene downstream terminator.The example of this terminator comprises T7 terminator, fd phage terminator, T4 terminator, tetracycline resistance gene terminator and intestinal bacteria trpA gene terminator.

Gene for the fusion rotein of be used for encoding IDO or IDO and another kind of protein imports colibacillary carrier; preferred multi-copy vector, the example comprises plasmid such as pUC plasmid, pBR322 plasmid or their derivative with the replication orgin that is derived from Col E1." derivative " refers to pass through the plasmid that changes by base replacement, disappearance, insertion, interpolation or inversion at this.The variation of indication herein comprises by the sudden change of using mutagenic compound or UV irradiation handles the variation that causes or the variation that is caused by spontaneous mutation or random mutation.

In order to select transformant, preferred described carrier has mark such as ampicillin resistance gene.The example of these plasmids comprises the commercial expression vector that can obtain (for example pUC (Takara), pPROK (Clontech) and pKK233-2 (Clontech)) with strong promoter.

Recombinant DNA can obtain by connecting dna fragmentation, and wherein the gene of the fusion rotein of forming with promotor, coding IDO or by IDO and another kind of protein is connected with carrier DNA according to this order with terminator.

When using the recombinant DNA transformed into escherichia coli to cultivate these intestinal bacteria then, express and produce the fusion rotein of IDO or IDO and another kind of protein.The bacterial strain that is generally used for expression of heterologous genes can be used for described through host transformed, and coli strain JM109 (DE3) and coli strain JM109 are especially preferred.Method for transformation and method that be used for to select transformant are described among the 3rd edition, Cold Spring Harbor Laboratory Press (2001) at for example MolecularCloning.

Under the situation as expressing fusion protein, the sequence that can use identification not to be present among the IDO is downcut IDO as the restricted proteolytic enzyme of recognition sequence such as factor Xa or kallikrein.

Being generally used for cultivating colibacillary substratum can be as producing substratum (productionmedium), and the example comprises M9 casamino acids substratum and LB substratum.In addition, cultivate and produce marker that the condition of inducing can use according to carrier and the type of promotor, and the type of the host microorganism that uses is selected suitably.

Following method can be used for reclaiming the fusion rotein of IDO or IDO and another kind of protein.If IDO or its fusion rotein are dissolved in the microorganism cells, so after reclaiming described microorganism cells and breaking or dissolve the cell that reclaims, can be with the form use with rough enzyme solution of IDO or its fusion rotein.In addition, IDO or its fusion rotein also can use after other routine techniques purifying by precipitation, filtration, column chromatography or necessity.In this case, use the purifying antibody method of IDO or its fusion rotein also can use.

When forming the albumen occlusion body, make its dissolving with denaturing agent.Although it can be dissolved with microorganism cells albumen, consider follow-up purifying flow process, preferably with the occlusion body taking-up and then with its dissolving.Method well known in the prior art can be used for reclaiming occlusion body from microorganism cells.For example, can receive occlusion body back and forth by making the microorganism cells centrifugation then of breaking.The example of the denaturing agent of soluble protein occlusion body comprises Guanidinium hydrochloride (for example, 6M, pH 5-8) and urea (for example, 8M).

By removing these denaturing agents with handling (as dialysis), the albumen occlusion body can be regenerated as activated protein.Dialysis solution for example Tris-HCl damping fluid or phosphate buffered saline buffer can be used for dialysis, and concentration can be 20mM-0.5M, and pH can be pH5-pH8.

Protein concn in the regeneration step process is preferably maintained in the range of from about 500 μ g/ml or lower.For the IDO that prevents from regenerating carries out self-crosslinking, preferably 5 ℃ or lower of dialysis temperature.In addition, expection also can be rebuild activity as dilution and ultrafiltration by other method that is used for the removal denaturing agent outside the above-mentioned dialysis.

When the IDO GENE SOURCES belongs to the bacterium of bacillus certainly, can express and produce IDO as the host with a kind of preferred pattern by the bacterium of using Escherichia, Rhodopseudomonas, Corynebacterium, genus arthrobacter, Aspergillus or bacillus.

The copy number of gene can be by inserting multi-copy vector with gene, and then described carrier being imported microorganism increases.The carrier that can use comprises e. coli plasmid vector such as pMW118, pBR322, pUC19, pBluescript KS+, pACYC177, pACYC184, pAYC32, pMW119, pET22b, intestinal bacteria-subtilis shuttle vectors such as pHY300PLK, pGK12, pLF14, pLF22 etc., phage vector such as l1059, lBF101, M13mp9, Mu phage (Japanese Patent Application Publication No.2-109985) etc., and transposon (Berg, D.E. and Berg, C.M., Bio/Technol., 1,417 (1983)) as Mu, Tn10, Tn5 etc.Also possible is by the homologous recombination of utilizing plasmid gene integration to be gone into the copy number that karyomit(e) waits to increase gene.Host cell in this case and the example of expression system comprise that Shaw P. C. etc. is to the report (J GenMicobiol.134 (1988) p.903-911) of recombinant expression method in the genus arthrobacter bacterial classification, Sandu C. etc. are to biting report (Appl Environ Microbiol.71 (2005) p8920-8924) and the Morikawa of recombinant expression method in the nicotine Arthrobacter (Arthrobacternicotinovorans), M. wait report (the ApplMicrobiol Biotechnol. to recombinant expression method in the genus arthrobacter bacterial classification, 42 (1994), p.300-303).Equally, the expression system that has several reports to claim exploitation to be used for rod-like stem bacterial type bacterium (Coryneform bacteria) also can be used for genus arthrobacter bacterial classification (SanduC. etc.).Yet, as the bacillus bacterial classification bacterium of host cell and the expression system that can be used for bacillus IDO be not limited to as herein described those.

[II] for generation of (2S, 3R, 4S)-method of 4-hydroxy-L-isoleucine

For generation of general formula of the present invention (I) representative (2S, 3R, 4S)-4-hydroxy-L-isoleucine ((2S, 3R, method 4S)-4HIL) comprises that direct enzymatic hydroxylation L-Isoleucine is to produce (2S, 3R, 4S)-and the single step reaction of 4HIL, it is represented by following reaction:

L-Isoleucine+α-Tong Wuersuan+O ₂→ 4HIL+ succsinic acid+CO ₂

Wherein said being reflected under the following existence carried out: as the L-Isoleucine of the acceptor molecule of a Sauerstoffatom, as the α-Tong Wuersuan of the acceptor molecule of another Sauerstoffatom, as oxygen molecule of the donor of two Sauerstoffatoms and the IDO of the described reaction of catalysis.

In the present invention, the meaning of " enzymatic hydroxylation " is the hydroxylation reaction that is undertaken by the IDO enzyme.Especially bacterium IDO is preferred.

IDO to the described reaction of catalysis is not specifically limited, and can use any protein, as long as the reaction that this protein can catalysis hydroxylation L-Isoleucine in the presence of α-Tong Wuersuan and oxygen.

The preferred embodiment of this IDO is to describe the IDO that illustrates in the part [1] of IDO.In the method for the invention, IDO can use in any form, enzyme or the rough enzyme of described any form such as bacterium (comprising culture, bacterial cell or treated cell), purifying, as long as comprising (incorporate) catalysis, it produces above-mentioned (2S, 3R, 4S)-the above-mentioned IDO of the reaction of 4HIL.When using bacterium to originate as IDO, (1) bacterium of natural generation IDO, as belonging to the microorganism of bacillus and (2) recombinant microorganism that is transformed by recombinant DNA described in part [1], these two all can be used for accumulating IDO by cultivating these microorganisms.

The protein sequence that is used for sign IDO classifies as L-Isoleucine dioxygenase (SEQ ID NO:2, SEQ ID NO:8 table 1).

L-Isoleucine dioxygenase of the present invention also comprises the protein that limits by following feature:

(B) described activity depends on divalent cation and comprises Fe ²⁺And

For example, produce at the bacterial cell that use to produce the IDO bacterium or transformed by recombinant DNA (2S, 3R, 4S)-step of 4HIL in, can when cultivating, substrate be added directly to substratum, perhaps can use with bacterial cell or the form through the washing bacterial cell of having separated with culture.In addition, broken or the treated bacterial cell that dissolves can directly use, perhaps can reclaim IDO and as rough enzyme solution from treated bacterial cell, perhaps use with enzyme purification after.That is, so long as have the form of the fraction of IDO, namely can be used on generation of the present invention (2S, 3R, 4S)-method of 4HIL in.

In order to use IDO to carry out hydroxylation reaction, the reaction soln that will comprise the protein of L-Isoleucine, α-Tong Wuersuan and the described reaction of catalysis or contain the IDO composition is adjusted to 20-50 ℃ suitable temp and allows it to leave standstill (stand undisturbed), the vibration or stirred 30 minutes to 5 days, keep pH5-12 simultaneously.

Also can be by adding divalent cation such as Fe to described reaction mixture ²⁺Improve speed of response.

When adding these divalent cations to reaction soln, although can use any salt, as long as it does not hinder reaction, however FeSO ₄Deng can preferably using.The concentration of these divalent cations can be determined by the simple preliminary study of being undertaken by those of ordinary skills.The scope that these divalent cations add can be at 0.01mM-50mM, in the scope of preferred 0.1mM-25mM.

Oxygen is by stirring from the air admission reaction, and culture volume is stationary state (withfixed regime of culture volume during cultivation) in culturing process.

The general formula that in described reaction mixture, forms (I) (2S, 3R, 4S)-4HIL can be according to the known technology isolated or purified, perhaps according to further use of present situation (as it is), particularly when described reaction is carried out with the recombinant microorganism of expressing IDO.

Separate and the example of purification process can comprise such method, wherein the general (2S, 3R, 4S)-4HIL contacts to adsorb basic aminoacids, carry out wash-out and crystallization thereafter with ion exchange resin; With such method, wherein the product that will obtain by wash-out is with activated carbon decolorizing and filter, its post crystallization with obtain (2S, 3R, 4S)-4HIL.

From the not note gene (non-annotated gene) of the coding IDO of other microorganism can by with the homology of known IDO gene, assess thereafter by the activity of proteins of these genes encodings and identify.

Homology between two aminoacid sequences can use known method to determine, for example, computer program BLAST 2.0, it calculates three parameters: score (score), identity (identity) and similarity (similarity).

Therefore, utilization is passed through PCR (polymerase chain reaction based on the primer of the known produced in fragments of amino acid and nucleotide sequence, referring to White, T.J. etc., Trends Genet., 5,185 (1989)) can obtain to encode total length IDO from bacillus thuringiensis bacterial strain 2-e-2 and bacillus thuringiensis (Israel's serovar; ATCC 35646) dna fragmentation of bacterial strain.Dna fragmentation from the coding IDO of other microorganism can obtain in a similar fashion.

Owing to may have some difference in the dna sequence dna between the bacterial isolates, the fragment of the above-mentioned coding IDO that uses is not limited to the nucleotide sequence shown in SEQ ID NO:1,7,12,16,20, Figure 18 or the table 1, but also can comprise and those the similar nucleotide sequences shown in SEQ ID NO:1,7,12,16,20, Figure 18 or the table 1.Therefore, can be had with respect to the complete amino acid sequence shown in SEQ ID NO:2,8,13,17,21, Figure 19 or the table 1 by said gene encoded protein qualitative change body and to be no less than 80%, preferably be no less than 90%, and most preferably be no less than 95% similarity, as long as the ability of the described reaction of this protein catalysis obtains keeping.

In addition, above-mentioned dna fragmentation can be expressed as such variant, its can be under stringent condition with nucleotide sequence shown in SEQ ID NO:1,7,12,16,20, Figure 18 or the table 1 or with probe hybridization based on these nucleotide sequences preparations, condition is their encoding function protein." stringent condition " is used for identical with aforementioned part " DNA of [1] (1) coding IDO " herein.

The immobilization product of the product that the example of the treated bacterial cell form that adopts among the present invention comprises the bacterial components of dry bacterial components (driedbacterial mass), freeze-drying, handle with tensio-active agent or organic solvent, the protein fraction that enzyme is handled product, supersound process product, mechanical mill product, solvent treatment product, bacterial components, bacterial components and through the bacterial components of processing.

IDO can separately prepare and be added in the reaction soln as mentioned above.The bacterium (host cell) of expressing the DNA of coding IDO can be by preparing with the functional expression vector that contains the DNA of described coding IDO of the form transfection that can express in having those active host cells.In addition, the preferred host cell that has the IDO activity of enhancing by the expression of gene that increases coding IDO that uses.

The meaning of phrase " increase expression of gene " is that described expression of gene is higher than not modified bacterial strain, for example, and wild type strain.The example of this modification comprises the copy number of the gene that increases each cell expressing, increases expression of gene level etc.For example, by restriction (restrict) chromosomal DNA, use the probe based on described gene order to carry out the Southern trace then, fluorescence in situ hybridization (FISH) waits to measure the amount of the copy number of expressing gene.The level of genetic expression can be measured by multiple known method, comprises Northern trace, quantitative RT-PCR etc.Amount by the protein of described genes encoding can be measured by currently known methods, carries out immunoblotting assay method (Western engram analysis) etc. after comprising SDS-PAGE.

The meaning of " with the DNA transform bacteria of coded protein " is that described DNA is imported bacterium, for example, imports by ordinary method.Transform this DNA and will cause the expression of gene of code book invention protein to increase, and will strengthen activity of proteins described in the bacterial cell.Method for transformation comprises any currently known methods of having reported so far.For example, increase cell to the method for the perviousness of DNA thereby handle recipient cell with calcium chloride, described method has been reported for e. coli k-12 (Mandel, M. and Higa, A., J.Mol.Biol., 53,159 (1970)), and can use this method.

The method of reinforcing gene expression comprises the increase gene copy number.Gene is imported the carrier that can bring into play function in bacterium of the present invention increases the copy number of described gene.For this reason, can preferably use multi-copy vector.Multi-copy vector be exemplified as pBR322, pMW119, pUC19, pET22b etc.

The enhancing of genetic expression also can be by realizing a plurality of copies of described gene by for example importing bacterial chromosome such as homologous recombination, Mu integration.For example, a Mu integrates the described gene that allows to import 3 copies of as many as in bacterial chromosome.

The increase of gene copy number also can import in the bacterial chromosomal dna by a plurality of copies with described gene and realize.For a plurality of copies with gene import in the bacterial chromosome, use the sequence that is present in the described chromosomal DNA with a plurality of copies to carry out homologous recombination as target.The sequence that has a plurality of copies in chromosomal DNA includes, but are not limited to repetition DNA or the terminal inverted repeats that exists of transposable element.Equally, disclosed in 889 as U.S. Patent No. 5,595, can incorporate gene into transposon, and allow described transposon to shift with a plurality of copies with described gene to import chromosomal DNAs.

Reinforcing gene expression also can be by placing DNA of the present invention the regulation and control of the strong promoter realization of getting off.For example, the P of Ptac promotor, lac promotor, trp promotor, trc promotor, lambda particles phage _ROr P _LPromotor is known as strong promoter.The use of strong promoter can be combined with the increase of gene copy.

Perhaps, can strengthen the effect of promotor, by for example importing sudden change is positioned at this promotor downstream with increase gene transcription level to described promotor.In addition, replace several Nucleotide in the known transcribed spacer between ribosome bind site (RBS) and initiator codon, particularly in the sequence of the next-door neighbour upstream of initiator codon, replace several Nucleotide, the translation ability of remarkably influenced mRNA.For example, depend on the initiator codon character of three Nucleotide before, found 20 times expression level variation range (Gold etc., Annu.Rev.Microbiol., 35,365-403,1981; Hui etc., EMBO J., 3,623-629,1984).Before, proved that the rhtA23 sudden change is at replacement (the ABSTRACTS of 17th International Congress ofBiochemistry and Molecular Biology in conjugation with 1997Annual Meetingof the American Society for Biochemistry and Molecular Biology with respect to the G of A of ATG initiator codon-1 position, San Francisco, California August 24-29,1997, abstract No.457).

In addition, also Nucleotide can be replaced in the promoter region that imports the above gene of bacterial chromosome, it causes stronger promoter function.For example, the change of expression regulation sequence can replace identical mode to be carried out according to the gene with the responsive plasmid of use temperature, as open among the open WO 00/18935 in the world and the Japanese Patent Application Publication No.1-215280.

Include, but are not limited to digest and be connected DNA, conversion, selection as oligonucleotide of primer etc. for the preparation of the method for plasmid DNA, or other method well known to those skilled in the art.These methods are described among the Cold SpringHarbor Laboratory Press (2001) at for example " Molecular Cloning A Laboratory Manual, Third Edition ".

Embodiment

Will the present invention will be described in more detail with reference to illustrated embodiment hereinafter, however the invention is not restricted to this.

Embodiment 1. screenings have the bacterial strain of L-Isoleucine hydroxylase

＜1〉bacterial strain and the nutrient solution analysis of 4-hydroxyisoleucine produced in screening

By using the L-Isoleucine as substrate, the microorganism with the ability that produces the 4-hydroxyisoleucine is screened.In water, the Zulkovsky starch of dissolving 0.4% (w/v), 0.4% yeast extract, 1% malt extract (malt extract) and 0.2% L-Isoleucine, then solution is adjusted to pH7-7.5 with the acquisition substratum, and soil bacteria is seeded in the described substratum.After 28 ℃ of shaking culture 2 days, by the amino acid analysis of centrifuged supernatant is analyzed the 4-hydroxyisoleucine.

The amino acid analysis condition

By using Waters AccQ-Tag ^TMMethod detects the 4-hydroxyisoleucine.With the amino acid derivatize in a usual manner that is diluted in the 5 μ l reaction mixtures of proper concn, and analyze to measure the output of 4-hydroxyisoleucine by HPLC.As a result, finding that a kind of bacterial isolates (bacterial strain 2-e-2) has produces the activity that shows the material of identical retention time with the 4-hydroxyisoleucine.Analyze based on 16S rDNA, 2-e-2 is accredited as bacillus thuringiensis with bacterial strain.Therefore, other bacillus is also screened, and at Bacillus licheniformis (strains A KU 223, bacterial strain IAM 11054), also found similar activity in Bacillus sphaericus (strains A KU 227, bacterial strain NBRC 3526) and the bacillus thuringiensis (strains A KU238, bacterial strain NBRC 3958).

Identify product

To being identified from the material that the L-Isoleucine as substrate produces by the Bacillus strain that obtains in the above-mentioned screening.At first, analyzed the molecular weight of described product by MS, found that molecular weight is 145, littler by 2 than the molecular weight of 4-hydroxyisoleucine.In addition, estimate constitutional chemistry formula (composition formula) when using high resolution mass spectrometer (Q-TofMS) to measure by accurate mass, obtained C ₆H ₁₁NO ₃And find that the hydrogen atom that has lacks 2 than the 4-hydroxyisoleucine on number.Above presentation of results may be 2-amino-3-ketone-4-methylvaleric acid (AMKP) by the material that above-mentioned Bacillus strain produces.Produce the experimental technique of describing in the report of AMKP (Bioorganic Chemistry, Vol.6, pp.263-271,1977) according to relevant bacillus, synthetic and purifying AMKP.And then according to Bioorganic Chemistry, Vol.6, pp.263-271,1977 AMKP purification process from the substratum purifying of above-mentioned bacillus product, and carried out the NMR analysis.As a result, the two has all shown similar chemical shift.

Above content illustration the bacillus in this experiment, found produce AMKP.The amount of the AMKP that is produced by bacterial strain 2-e-2 is about 1-2mM.On the other hand, by Bioorganic Chemistry, Vol.6, pp.263-271, the estimated value of the AMKP that bacillus described in 1977 produces is 0.04mM, has confirmed that therefore the high AMKP of bacterial strain 2-e-2 produces active.

＜2〉set up for separating of with the method for analyzing AMKP and HIL

Since found bacillus (as bacterial strain 2-e-2) have AMKP produce active, therefore find to be necessary to set up for separating of with the method for analyzing AMKP and 4-hydroxyisoleucine.After the multiple investigation, by revising Waters AccQ-Tag ^TMMethod set up for separating of with the method for analyzing AMKP and 4-hydroxyisoleucine.Particularly, post is become XBridge C18 5mm, 2.1 * 150mm (Waters) becomes MeOH with Eluent B (eluent B), and the eluent flow velocity is become 0.3ml/min.The gradient of eluent is shown in following table.

Table 2: the eluent condition of analyzing HIL and AMKP simultaneously

Under these conditions, the AMKP in the substratum was at about 11.0 minutes wash-outs, and therefore the 4-hydroxyisoleucine can separate these products at about 11.9 minutes wash-outs.

＜3〉change AMKP output by in culturing process, adding cofactor

Produce active mechanism as AMKP, considered the possibility by hydroxylation picked-up molecular oxygen.Therefore, by cofactor NAD (P) H of interpolation monooxygenase in the culturing process of bacterial strain 2-e-2, or the cofactor Fe of interpolation dioxygenase ²⁺, 2-oxoglutaric acid and xitix analyze AMKP and produce active.

By using the substratum that uses in the previous screening in contrast, 10mM NADP and 10mM NADPH interpolation group have been compared, Fe ²⁺Interpolation group, and Fe ²⁺, 2-oxoglutaric acid and xitix interpolation group AMKP produce active.Culture temperature is 30 ℃, and cultivating practice is 22 hours.Measured the AMKP concentration in the culture supernatant.The results are shown in table 3.

Table 3: the interpolation of cofactor produces active influence to AMKP in the cultivation of bacterial strain 2-e-2

This explanation dioxygenase may participate in the production process of AMKP.

＜4〉bacterial strain 2-e-2 nutrient solution over time

AMKP is produced substratum (Zulkovsky starch of 0.4% (w/v), 0.4% yeast extract, 1% malt extract, 0.2% L-Isoleucine, 0.5% glucose, 1mM xitix, 1mM 2-oxoglutaric acid, 1mM CaCl ₂, 1mM MgSO ₄, pH 7-7.5) and place 3 liters of Sakaguchi flasks, and at 23 ℃ of shaking culture bacterial strain 2-e-2.After cultivating

beginning

0,6,8,10,12,14,16,18 and 20 hour, sampling nutrient solution (culture broth), and by above-described＜2〉described in 4-hydroxyisoleucine and AMKP in the method quantitative culture liquid.In addition, also measured turbidity (OD ₆₆₀).

The concentration of 4-hydroxyisoleucine (HIL) and AMKP is shown in Fig. 1.The turbidity of nutrient solution is shown in Fig. 2.The total amount of 4-hydroxyisoleucine and AMKP increases and reaches platform subsequently at logarithmic phase.Further, after level reached platform, the 4-hydroxyisoleucine reduced gradually, and AMKP increases gradually.

At each above-mentioned incubation time, obtain the cell of bacterial strain 2-e-2 from the described nutrient solution of 200 μ l, with the physiological saline washing, be suspended in 100 μ l dioxygenase reaction mixture (10mM Isoleucine, 1mM Fe then ²⁺, 10mM 2-oxoglutaric acid, 10mM xitix, 50mM potassium phosphate buffer (pH 7.0)) in, make to be reflected at 30 ℃ and under oscillating condition, to carry out 1 hour, and measure the output of 4-hydroxyisoleucine and AMKP in the supernatant liquor.As a result, only when the cell that uses at logarithmic phase, can confirm the generation of 4-hydroxyisoleucine and AMKP, although they produce with trace, as shown in Figure 3.

＜5〉with bacterial strain 2-e-2 lysis deposits yields HIL

Cell is cultivated until reaching OD in AMKP generation substratum ₆₆₀Be 3.2, in mortar, make and collect and the bacterial strain 2-e-2 cell rupture through washing, be suspended in then and suspend with having the suspension (lysate) of about 10mg/ml protein concn with acquisition in the damping fluid (50mMHEPES (pH 7.0), 10% glycerine, Complete Mini (Roche)), and obtained the centrifugal sediment of described suspension.The most described centrifugal sediment be suspended in the isopyknic physiological saline of described cell lysate in.With each and isopyknic 2x dioxygenase reaction mixture (10mM Isoleucine, the 2mM Fe in these ²⁺, 10mM2-ketoisocaproic, 10mM xitix, 100mM HEPES (pH 7.0)) mix, and make and be reflected at 30 ℃ and carried out 1 hour.Similarly, wash the resting cell for the preparation of described cell lysate, and be suspended in the physiological saline with 10 times of concentration in nutrient solution, with described suspension and isopyknic 2x dioxygenase reaction mixture, and it is reacted.The output of AMKP and 4-hydroxyisoleucine is shown in Fig. 4 in the sample.

By using cell lysate, can confirm to use Ile to produce the activity of 4-hydroxyisoleucine as substrate beyond all doubtly.

＜6〉cofactor is to the effect of the enzyme in the bacterial strain 2-e-2 cell lysate

By using the cell lysate at the bacterial strain 2-e-2 of logarithmic phase cell, checked cofactor to produce the effect of the reaction of 4-hydroxyisoleucine by hydroxylation Ile.Make in the described 50mMHEPES of being reflected at (pH 7) reaction mixture and carry out, containing final concentration in described reaction mixture is one of 5mMIle and many kinds of cofactors of 5mM, and by above-mentioned＜5〉in the cell lysate of logarithmic phase bacterial strain 2-e-2 cell (lysate) of the method preparation described, and measured the output of 4-hydroxyisoleucine.As shown in table 4, Fe ²⁺(Fe) and 2-oxoglutaric acid (a-KG) be crucial for the generation of 4-hydroxyisoleucine, and by further adding the maximum production that xitix (Asc.) makes the 4-hydroxyisoleucine.Therefore, illustrated that effectively dioxygenase may relate to the hydroxyisoleucine by hydroxylation Isoleucine generation 4-.

Table 4: multiple cofactor produces active effect to the 4-hydroxyisoleucine of bacterial strain 2-e-2 cell lysate

＜7〉sterie configuration of the product of use bacterial strain 2-e-2 cell lysate acquisition

The 4-hydroxyisoleucine has unsymmetrical carbon 3 positions, and has diastereomer and 4 pairs of enantiomers of 8 types.Particularly, described 4 pairs of enantiomers be (2S, 3S, 4S) and (2R, 3R, 4R) enantiomer (after be also referred to as HIL1), (2S, 3S, 4R) and (2R, 3R, 4S) enantiomer (after be also referred to as HIL2), (2S, 3R is 4R) with (2R, 3S, 4S) enantiomer (after be also referred to as HIL3), and (2S, 3R, 4S) and (2R, 3S, 4R) enantiomer (after be also referred to as HIL4).The naturally occurring HIL that exists in the Semen Trigonellae etc. is (2S, 3R, 4S) enantiomer.Since in the present invention will (2S, 3S)-Isoleucine is as substrate, the 4-hydroxyisoleucine that produces by hydroxylation reaction be (2S, 3R, 4S) or (2S, 3R, 4R) enantiomer.Therefore, decision will be determined the sterie configuration by the 4-hydroxyisoleucine of bacterial strain 2-e-2 generation.

Right as different enantiomers, (2R, 3R, 4R): HIL1 is with (4R): HIL3 is according to Tetrahedron 47 (32) for 2S, 3R, 6469-6482, (1991) obtain, and (2R, 3R, 4S): HIL2 and (2S, 3R, 4S): HIL4 is according to Eur.J.Org.Chem.834-839, and (2002) obtain.When in above-mentioned＜2〉described in analyze simultaneously when analyzing the HIL1 to HIL4 that is obtained by chemosynthesis under the condition of 4-hydroxyisoleucine and ANKP, retention time is as shown in table 5.

The retention time of the diastereomer of table 5:4-hydroxyisoleucine

When analyzing above-mentioned＜6〉in preparation contain the sample of 4-hydroxyisoleucine the time, retention time is 11.99 minutes.When it being mixed with the 4-hydroxyisoleucine of HIL4 standard substance and analyze, the peak mates fully.Therefore, proved when use (2S, 3S)-Isoleucine is during as substrate, in issuable HIL3 and HIL4, the 4-hydroxyisoleucine that is produced by this kind of enzyme is HIL4, that is, and naturally occurring 4-hydroxyisoleucine.

＜8〉optimal pH of the enzyme in the bacterial strain 2-e-2 cell lysate

By using according to above-mentioned＜5〉in the method described from OD ₆₆₀Be the cell lysate of 7 bacterial strain 2-e-2 cell preparation, assessed the 4-hydroxyisoleucine and produced active pH dependency.Measured by 5mM Ile, 5mM Fe ²⁺, the dioxygenase reaction mixture formed of 5mM 2-oxoglutaric acid, 5mM xitix and 100mM GTA after reaction composition and the pH of described reaction mixture.Temperature of reaction is 30 ℃.By＜2〉described in methods analyst the 4-hydroxyisoleucine that produces.Activity in a plurality of pH values is illustrated in Fig. 5 according to the relative activity ratio, and described ratio is calculated based on the HIL amount (get and do 100%) that produces at the pH that maximum production is provided.Confirmed described activity at pH 5-8.

＜9〉optimum temperuture of the enzyme in the bacterial strain 2-e-2 cell lysate

By using according to above-mentioned＜5〉in the method described from OD ₆₆₀Be the cell lysate of 7 bacterial strain 2-e-2 cell preparation, assessed the 4-hydroxyisoleucine and produced active temperature dependency.The composition of dioxygenase reaction mixture is by 5mM Ile, 5mM Fe ²⁺, 5mM 2-oxoglutaric acid, 5mM xitix and 100mM GTA (pH 6) form, and temperature of reaction is 15-50 ℃.By＜2〉described in methods analyst the 4-hydroxyisoleucine that produces.Activity in a plurality of temperature is illustrated in Fig. 6 according to the relative activity ratio, and described ratio is calculated based on the 4-hydroxyisoleucine amount that produces in the temperature that maximum production is provided (get and do 100%).Optimum temperuture is lower than 45 ℃.

＜10〉temperature stability of the enzyme in the bacterial strain 2-e-2 cell lysate

By using according to above-mentioned＜5〉in the method described from OD ₆₆₀Be the cell lysate of 7 bacterial strain 2-e-2 cell preparation, assessed the 4-hydroxyisoleucine and produced active temperature stability.Cell lysate 0-50 ℃ of incubation 1 hour, is measured Ile hydroxylation activity then.The composition of substrate reactions mixture is by 5mM Ile, 5mM Fe ²⁺, 5mM 2-oxoglutaric acid, 5mM xitix and 100mM HEPES (pH 7) form, and temperature of reaction is 30 ℃.By methods analyst described in the embodiment 2 the 4-hydroxyisoleucine that produces.Temperature stability in a plurality of temperature is illustrated in Fig. 7 according to the relative activity ratio, and described ratio is calculated based on the 4-hydroxyisoleucine amount that produces in the temperature that maximum production is provided (get and do 100%).Described enzyme is at 50 ℃ or higher temperature inactivation.

＜11〉the substrate reactions characteristic of enzyme in the bacterial strain 2-e-2 cell lysate

By using according to above-mentioned＜5〉in the method described from OD ₆₆₀Be the cell lysate of 7 bacterial strain 2-e-2 cell preparation, assessed the response characteristic of multiple amino acids.Cell lysate and substrate solution are mixed, make then to be reflected at 30 ℃ and to carry out 1 hour, and assess the generation of novel substance by TLC or amino acid analysis.The composition of substrate reactions mixture is by 5mM amino acid, 5mM Fe ²⁺, 5mM 2-oxoglutaric acid, 5mM xitix and 100mM HEPES (pH 7) form.Except the L-Isoleucine, L-leucine, L-Xie Ansuan, L-L-glutamic acid and L-Methionin have also independently been assessed as amino acid.By methods analyst described in the embodiment 1 the 4-hydroxyisoleucine that produces.The results are shown in table 6.Can't confirm the generation of novel substance for the amino acid except the L-Isoleucine.Therefore, illustrated that this kind of enzyme is Isoleucine specificity dioxygenase.

Table 6: for the reactivity of multiple amino acids

＜12〉inhibitor is to the effect of the enzyme in the bacterial strain 2-e-2 cell lysate

By using according to above-mentioned＜5〉in the method described from OD ₆₆₀Be the cell lysate of 7 bacterial strain 2-e-2 cell preparation, checked inhibitor that the 4-hydroxyisoleucine is produced active effect.Used according to above-mentioned＜5〉in the method described from OD ₆₆₀It is the cell lysate of 7 bacterial strain 2-e-2 cell preparation.The composition of dioxygenase reaction mixture is by 5mM Ile, 5mM Fe ²⁺, 5mM 2-oxoglutaric acid, 5mM xitix and 100mM HEPES (pH 6) form, temperature of reaction is 30 ℃, and the reaction times is 1 hour.Measured as the every kind of inhibitor from 10mM to reaction system (EDTA, the Cu that add ²⁺, Zn ²⁺) time 4-hydroxyisoleucine amount that produces.By above-mentioned＜2〉described in methods analyst the 4-hydroxyisoleucine.Isoleucine hydroxylation activity is lost because of described inhibitor.

Separation and the purifying of embodiment 2.L-Ile hydroxylase

(1) preparation of cell-free extract

The AMKP that bacterial strain 2-e-2 is cultivated 2 liters of cumulative volumes produces in the substratum until OD ₆₆₀Reach 6.0, then cell is washed with physiological saline.(10mg/ml lyase (SIGMA), 5mg/ml cellulase " ONOZUKA " R-10 (Yakult), Yatalase (Takara Bio), 1mg/ml N,O-Diacetylmuramidase (SIGMA) are dissolved in 0.2M NaH in the cytolemma treatment soln with described cell suspension ₂PO ₄With 0.6M KCl (pH5.5)) in, then 30 ℃ of incubations 1 hour.To wash with physiological saline through the cell of incubation, be suspended in buffer A (50mM HEPES (pH 7.0) then, 10% glycerine, 2mM DTT, 1mM EDTA, Complete (Roche)) in, and under with ice-cooled condition, make described cell rupture by use Ultrasonic Cell Disruptor (Branson).With this treated suspension centrifugal 60 minutes of 4 ℃ and 18,500x g to obtain supernatant.Follow-up separation and purification step all 4 ℃ or with ice-cooled condition under carry out.

(2) anion-exchange chromatography

The filter that the supernatant that obtains in the abovementioned steps is passed through aperture 0.45 μ m filters, and puts on the DEAE post (16mm * 100mm, GE HealthcareBio-Sciences) of using the buffer A balance in advance.Wash this post with buffer A, and carry out wash-out with the sodium-chlor of the linear concentration gradient that is dissolved in buffer B (50mM HEPES (pH 7.0), 10% glycerine, 2mM DTT, 1mM EDTA, 0.5M NaCl, Complete (Roche)).

(3) detection of active fraction

Every kind of fraction is used for carrying out 30 minutes the Ile hydroxylation active reaction mixture that uses at 30 ℃, and (final concentration is 100mM HEPES (pH 6.0), 5mM L-Ile, 5mM Fe ²⁺, 5mM 2-oxoglutaric acid, 5mM xitix) reaction.Make enzyme deactivation at 100 ℃, separate the amount of coming quantitative 4-hydroxyisoleucine with measuring method with HIL by aforementioned AMKP then.The 4-hydroxyisoleucine of mentioning in subsequent analysis only means basically by the material of forming with the isomer that naturally occurring 4-hydroxyisoleucine has identical retention time.The enzymic activity that per minute is produced 1nmol HIL is defined as 1U.

(4) cation-exchange chromatography

The active fraction that obtains in the abovementioned steps is replaced with damping fluid C (50mM MES (pH 5.2), 10% glycerine, 2mM DTT, 1mM EDTA, Complete (Roche)) in desalting column (GE Healthcare Bio-Sciences).This alternative fraction is put on the MonoS post (10mm * 100mm, GE Healthcare Bio-Sciences) of using damping fluid C balance in advance.Wash this post with damping fluid C, then with being dissolved in damping fluid D (50mM MES (pH 5.2), 10% glycerine, 2mM DTT, 1mM EDTA, 0.5M NaCl, the sodium-chlor of linear concentration gradient Complete (Roche)) carries out wash-out, and measures the Ile hydroxylation activity of every kind of fraction.

(5) ammonium sulfate precipitation

The soluble fraction that obtains in the abovementioned steps is added 2M ammonium sulfate and dissolving.Fully stir described solution, become soluble fraction and precipitation fraction by centrifugal classification then, and described precipitation fraction is dissolved in the buffer A.When the Ile hydroxylation of measuring every kind of fraction is active, detect the described activity in the precipitation fraction.

(6) size exclusion chromatography

Sample on the active fraction that obtains in the abovementioned steps is extremely used in advance the Superdex75 post (10mm * 300mm, GE Healthcare Bio-Sciences) of buffer A balance.Carry out wash-out with buffer A, and measured the Ile hydroxylation activity of every kind of fraction.

(7) hydrophobic interaction chromatography

The active fraction that obtains in the abovementioned steps is replaced with damping fluid E (50mM MES (pH6.5), 10% glycerine, 2mM DTT, 1mM EDTA, 1M ammonium sulfate, Complete (Roche)).To put on the Resource PHE post (1ml, GEHealthcare Bio-Sciences) of using damping fluid E balance in advance through the sample that damping fluid substitutes.Wash this post with damping fluid E, the fraction that comprises the enzyme with Ile hydroxylation activity then by the ammonium sulfate that uses the reverse linear concentration gradient with damping fluid F wash-out (50mM MES (pH6.5), 10% glycerine, 2mM DTT, 1mM EDTA, Complete (Roche)).

Purifying and the high-level summary that separates the L-Ile hydroxylase are in table 7.

Table 7: the summary of separation and purifying

Fraction	Gross protein (mg)	Specific activity (U/mg)	Gross activity (U)	Productive rate (%)
					Cell-free extract	678.173	3.8	2593.7	100.0
DEAE	73.324	17.8	1306.5	50.4
					monoS	3.639	96.5	351.0	13.5
Ammonium sulfate precipitation	0.578	209.5	121.1	4.7
					GPC	0.093	1222.8	113.4	4.4
Resource PHE	0.004	3694.9	13.2	0.5

The sign of embodiment 3.L-Ile hydroxylase

＜1〉by electrophoretic analysis

By sodium dodecyl sulfate-polyacrylamide gel electrophoresis (polyacrylamide gel: PAG Mini " Daiichi " 15/25 (13 hole), by Daiich Pure Chemicals Co., Ltd. produce, molecular weight standard: Prestained SDS-PAGE Standards (prestained SDS-PAGE standard substance), Low Range is produced by Bio-Rad) analyze the purification of samples that obtains among the embodiment 2.Found that described enzyme is basically by identical (uniform) subunit composition with about 31,000 ± 20,000 molecular weight.

＜2〉effect of interpolation cofactor

Checked cofactor to produce the effect of the reaction of 4-hydroxyisoleucine by hydroxylation Ile by using purifying enzyme.To be used for the described reaction of 100mMHEPES (pH6) reaction mixture by the L-Ile hydroxylase of the preparation of method described in the embodiment 2, this reaction mixture comprises by one of final concentration 5mM L-Ile and many kinds of cofactors of 5mM, and has measured the output of 4-hydroxyisoleucine.As shown in table 8, Fe ²⁺With 2-oxoglutaric acid be crucial for the generation of 4-hydroxyisoleucine, and make the maximum production of 4-hydroxyisoleucine by further interpolation xitix.Therefore, illustrated that effectively dioxygenase may participate in producing by the 4-hydroxyisoleucine of hydroxylation L-Isoleucine.This result is identical with the assay of using cell lysate.

Table 8: multiple cofactor produces active effect to the 4-hydroxyisoleucine of purifying enzyme

Extract	Substrate (L-Ile)	Cofactor	HIL(mM)
				+	-	-	0.00
+	+	-	0.00
				+	+	α-KG	0.00
+	+	Xitix	0.00
				+	+	Fe ²⁺	0.00
+	+	α-KG+ xitix	0.00
				+	+	α-KG+Fe ²⁺	0.02
+	+	Xitix+Fe ²⁺	0.00
				+	+	α-KG+ xitix+Fe ²⁺	0.26

＜3〉optimal pH

By using the L-Isoleucine hydroxylase according to the preparation of method described in the embodiment 2, assessed the 4-hydroxyisoleucine and produced active pH dependency.The composition of enzyme reaction solution is by 5mM L-Ile, 5mM Fe ²⁺, 5mM 2-oxoglutaric acid, 5mM xitix and 200mM GTA (pH 3 to 12) form.Temperature of reaction is 30 ℃.Activity in multiple pH value is illustrated in Fig. 8 according to the relative activity ratio, and described ratio is calculated based on the 4-hydroxyisoleucine amount that produces at the pH that maximum production is provided (get and do 100%).Confirm activity at pH 4 to 8, and confirmed the high reactivity at pH 5 to 8.

＜4〉optimum temperuture

By using the L-Ile hydroxylase according to the preparation of method described in the embodiment 2, assessed the 4-hydroxyisoleucine and produced active optimum temperuture.The composition of enzyme reaction solution is by 5mM Ile, 5mM Fe ²⁺, 5mM 2-oxoglutaric acid, 5mM xitix and 100mM HEPES (pH 6) form.Activity in various temperature is illustrated in Fig. 9 according to the relative activity ratio, and described ratio is calculated based on the 4-hydroxyisoleucine amount that produces in the temperature that maximum production is provided (get and do 100%).Temperature range at 0 to 40 ℃ has been confirmed high reactivity.

＜5〉temperature stability

By using the L-Ile hydroxylase according to the preparation of method described in the embodiment 2, assessed the 4-hydroxyisoleucine and produced active temperature stability.The enzyme solution of pH7.0 0 to 70 ℃ of incubation 1 hour, is measured Ile hydroxylation activity then.The composition of enzyme reaction solution is by 5mM Ile, 5mM Fe ²⁺, 5mM2-ketoisocaproic, 5mM xitix and 100mM HEPES (pH 6) form, and temperature of reaction is 30 ℃.Temperature stability at all temps is illustrated in Figure 10 according to the relative activity ratio, and described ratio is calculated based on the hydroxyisoleucine amount that produces at the storage temperature that maximum production is provided (get and do 100%).Described enzyme is at 60 ℃ or higher temperature inactivation.

＜6〉substrate reactions characteristic

By using the L-Ile hydroxylase according to the preparation of method described in the embodiment 2, assessed the response characteristic of multiple amino acids.With enzyme solution and described reaction mixture, make then to be reflected at 30 ℃ and to carry out 1 hour, and analyze to assess the generation of novel substance by HPLC.The composition of enzyme reaction solution is by 5mM amino acid, 5mM Fe ²⁺, 5mM 2-oxoglutaric acid, 5mM xitix and 100mMHEPES (pH 6) form.Except the L-Isoleucine, D-Isoleucine, L-leucine, L-Xie Ansuan, L-L-glutamic acid and L-Methionin have also independently been assessed as amino acid.By methods analyst described in the embodiment 1 the 4-hydroxyisoleucine that produces.The results are shown in table 9.As the assay of using cell lysate, can't confirm the generation of novel substance for the amino acid except the L-Isoleucine.Therefore, illustrated that described enzyme is L-Isoleucine specificity dioxygenase, and had the activity that produces naturally occurring HIL, with similar shown in the assay of using cell lysate.

Table 9: the reactivity of every seed amino acid

＜7〉effect of inhibitor

By using the L-Ile hydroxylase according to the preparation of method described in the embodiment 2, checked inhibitor that the 4-hydroxyisoleucine is produced active effect.The composition of enzyme reaction solution is by 5mM Ile, 5mMFe ²⁺, 5mM 2-oxoglutaric acid, 5mM xitix and 100mM HEPES (pH 6) form, temperature of reaction is 30 ℃, and the reaction times is 1 hour.Measured as the every kind of inhibitor from 10mM to reaction system (EDTA, the Cu that add ²⁺, Zn ²⁺) time 4-hydroxyisoleucine amount that produces.Add the 4-hydroxyisoleucine generation activity of observing under the condition of inhibitor and be shown in table 10 according to relative reactivity, described relative reactivity is for 4-hydroxyisoleucine observed under the condition of not adding inhibitor produces active (get and do 100%).Isoleucine hydroxylation activity is lost because of described inhibitor.

Table 10: the effect of inhibitor

Inhibitor	Relative reactivity (%)
		Do not have	100
EDTA	0
		Cu ²⁺	0
Zn ²⁺	0

＜8〉-terminal amino acid

L-Ile hydroxylase according to the method preparation of describing among the embodiment 2 is carried out electrophoresis according to the method for embodiment 3, be transferred to pvdf membrane (sequi-Blot ^TMPvdf membrane Bio-Rad), and is used for PPSQ-10 (it is the protein sequencer of being produced by Shimadzu Corporation).N-end sequence as the enzyme that obtains by aforesaid method has obtained following result.

1 LysMetSerGlyPheSerIleGluGluLys 10

11 ValHisGluPheGluSerLysGlyPheLeu 20

(SEQ ID NO：5)

Embodiment 4. is from bacillus thuringiensis (2-e-2) bacterial strain purifying IDO

The screening of the environmental microorganism that the present inventor is provided has disclosed the unique microorganism with α-Tong Wuersuan dependency L-Isoleucine dioxygenase activity.It is accredited as bacillus thuringiensis, and as bacillus thuringiensis bacterial strain 2-e-2 (FERM BP-10688) preservation (stock).

1.1. culture condition.In experiment, used following substratum:

CM1 (Tryptones 10g/l; Yeast extract 10g/l; PH 7.0 by the NaOH adjusting);

CM6 (Tryptones 10g/l; Yeast extract 40g/l; PH 7.0 by the NaOH adjusting).

1.2. inoculum preparation.Bacillus thuringiensis bacterial strain 2-e-2 is being supplemented with 90mM KPi damping fluid (90mM KH ₂PO ₄(pH 7) are regulated by KOH) the CM1 substratum in 30 ℃ of overnight incubation.Then, add the glycerine of as many as 20% to the biomass of finishing growth.With pack into 1.9ml bottle and be stored in-70 ℃ until use of the cell suspension branch that obtains.

1.3. fermentation condition.Use the Marubischi fermentation container to carry out bacillus thuringiensis bacterial strain 2-e-2 fermentation.Used following culture parameters: starting culture volume-600ml; Stir-800 rev/mins; Ventilation (air)-1: 1; Use 1H NaOH/HCl feed supplement to be stabilized in pH 7.0.Use is from freezing suspension (referring to preceding paragraph) the inoculation 600ml CM6 substratum of a bottle (1.9ml).Bacterial strain 2-e-2 was cultivated about 7.5 hours.Then by centrifugal cell harvesting and be stored at-70 ℃ until use.

1.4.IDO activation measurement.By 4 ℃ centrifugal from 25-100ml bacillus thuringiensis bacterial strain 2-e-2 culture harvested cell, and cell is resuspended in the 2ml buffer A (50mM MOPS, 10% glycerine, 1mM EDTA, 1mM DTT, proteinase inhibitor, pH 7.2).Use French cell press (French-pressure cell) (3X is at 1000Psi) smudge cells.Reaction mixture (50 μ l) comprises 50mM HEPES pH 7.0; 5mM Ile; The 5mM xitix; 10mM FeSO ₄The aliquots containig of 5mM α-Tong Wuersuan and protein prepared product.To be reflected under the oscillating condition 34 ℃ of incubations 40 minutes.Use the synthetic 4HIL of TLC analyzing and testing.With developing solvent (2-propyl alcohol: acetone: ammonia: water=100: 100: 25: 16) develop with the thin-layer silicon offset plate of aliquots containig (the 1-2 μ l) point sample of reaction soln (10 * 15cm), and use ninhydrin reagent to detect 4HIL.Carried out the HPLC analysis as described in example 4 above.

1.5 from bacillus thuringiensis bacterial strain 2-e-2 purifying and evaluation IDO

Use 100 systems (Amersham Pharmacia Biotech) carry out all chromatographic step.The purifying rules may further comprise the steps.Freezing cell (62g weight biomass) thawed and be resuspended in the 150ml buffer A [50mM TRIZMA, 5% glycerine, 1mM EDTA, 1mM DTT, proteinase inhibitor, the pH 7 that regulates by HCl].

Step 1. makes cell rupture by twice through (2passages) French cell press (maximum P=1000Psi), and centrifugal (14000g, 4 ℃, 20 minutes) are to remove cell debris thereafter.The protein Preparation thing that obtains is added into the DEAE resin of 150ml balance in buffer A.With final suspension under soft oscillating condition about 10 minutes of 4 ℃ of incubations.Then, with the resin transfer of having adsorbed albumen to post (26 * 30cm) and carry out two step protein wash-outs.At first, by being dissolved in the 50mM NaCl washing pillar of buffer A.Then, by being dissolved in the 250mM NaCl wash-out IDO activity of buffer A.

It is active and be resuspended in about 3ml buffer B [1mM EDTA, 1mM DTT, 100mM NaCl, pH 7 for 50mM TRIZMA, 5% glycerine] that step 2. concentrates IDO by ammonium sulfate precipitation (with 1.9M).

Step 3. obtains 1.5ml to put on the Superdex 200HR 10/30A post of using the buffer B balance from the prepared product of step 2.Carry out isocratic elution with the 0.5ml/min flow velocity.Compile active fraction.

Step 4. will obtain to put on the 1.6mlSourse15Q post of using the buffer A balance from the protein Preparation thing of step 3.Carry out wash-out with the 0.5ml/min flow velocity by the linear gradient 0-0.5M NaCl (10 column volume) that is dissolved in buffer B.Collect each 1ml fraction.Compile active fraction.

As a result, with about 120 times of IDO purifying (seeing Table 11).The SDS-PAGE of final protein Preparation thing has only shown a main band (gross protein about 70%, see Figure 12).

1.6 identify IDO.

Extracted main protein from SDS-PAGE, and analyzed by mass spectroscopy.Gel Treatment, trypsin hydrolyzing, proteins extraction and the mass analysis by the substance assistant laser desorpted ionization flight time (MALDI-TOF) are according to by Govorun, V.M. etc., (The proteomecomparative analysis of Helicobacter pylori clinical isolates.Biochemistry (Mosc), 68,1,42-49 (2003)) rules of Miao Shuing are carried out.Use Mascot software (the photodissociation peptide quality evalution of Matrix Science, Peptide Fingerprint USA) (peptide fingerprint) the option described protein by in groups this protein.Analyzing the identification of proteins that will analyze by MS is from bacillus thuringiensis (Israel's serovar; ATCC 35646) the RBTH_06809 albumen (Figure 13) of inferring of bacterial strain.

Embodiment 5. is from bacillus thuringiensis bacterial strain 2-e-2 and bacillus thuringiensis (Israel's serum Modification, ATCC 35646) bacterial strain clone IDO gene

Sample to purifying in SDS (15-25%) polyacrylamide gel carries out electrophoresis.In room temperature with 1mA cm ²In 1 hour process, protein transduction is moved on the PVDF membrane.After with CBB dyeing, the IDO band is downcut and uses protein sequencer PPSQ-10 type (Shimadzu Co.Ltd., Kyoto, Japan) the automatic edman degradation that carries out (Edman degradation).Preceding 20-terminal amino acids of described protein purification have been measured.

The-terminal amino acid of measuring the 31-kDa polypeptide is KMSGFSIEEKVHEFESKGFL (SEQID NO:5).After the blast search, this aminoacid sequence with shown high homology from the hypothetical protein RBTH_06809 of bacillus thuringiensis (Israel's serovar) ATCC 35646 with from the BC1061 of bacillus cereus ATCC 14579, as shown in table 1.Only there is a potential IDO translation starting point to the sequential analysis of RBTH_06809ORF with to the mensuration explanation of the-terminal amino acid of protein purification, because typical SD sequence is positioned at ATG upstream from start codon 8bp place (Figure 14).Yet Lys (7) is the-terminal amino acid of purifying protein.Infer that the terminal processing of N-(cutting of-terminal amino acid) is that IDO is active required.Seem that this cutting is the feature (attribute) of specific protease, the IDO coexpression in described proteolytic enzyme and the bacillus bacterial classification, but in intestinal bacteria, lack this proteolytic enzyme.So, in order in intestinal bacteria, to produce ripe IDO, made up special recombinant plasmid.

2.1. bacterium.Bacillus thuringiensis (Israel's serovar, ATCC 35646) bacterial strain obtains from Russian state-run industrial microorganism preservation center (VKPM), accession number B-197.

2.2 make up pMW119-IDO (Lys, 32) plasmid.In order to make up pMW119-IDO (Lys, 32), following steps have been carried out.

Use oligonucleotide SVS 170 (SEQ ID No:3) and SVS 169 (SEQ ID No:4) as the chromosomal DNA of primer (specifically referring to Figure 15) and purifying as template amplification the 0.8kb dna fragmentation of bacillus thuringiensis (Israel's serovar, ATCC 35646) strain chromosome.Used following PCR rules: initial cycle be 94 ℃ 30 seconds; 94 ℃ of 4 circulations 40 seconds, 49 ℃ 30 seconds, 72 ℃ 40 seconds; 94 ℃ of 35 circulations 30 seconds, 54 ℃ 30 seconds, 72 ℃ 30 seconds.PCR fragment BamHI and SacI endonuclease digestion with obtaining are connected in the pMW119 carrier of the identical restriction enzyme of previous usefulness (restrictase) processing then.

2.3 make up pMW119-IDO (Lys, 23) plasmid.Use oligonucleotide SVS 170 (SEQ IDNo:3) and SVS 169 (SEQ ID No:4) as the chromosomal DNA of primer (specifically referring to Figure 15) and purifying as template amplification the chromosomal 0.8kb dna fragmentation of bacillus thuringiensis bacterial strain 2-e-2.Used following PCR rules: initial cycle be 94 ℃ 30 seconds; 94 ℃ of 4 circulations 40 seconds, 49 ℃ 30 seconds, 72 ℃ 40 seconds; 94 ℃ of 35 circulations 30 seconds, 54 ℃ 30 seconds, 72 ℃ 30 seconds.PCR fragment BamHI and SacI endonuclease digestion with obtaining are connected in the pMW119 carrier of the identical restriction enzyme treatment of previous usefulness then.

With the cell that connects mixture transformed into escherichia coli bacterial strain TG1.Select institute's DCRP (blue/white test) at the X-gal/IPTG agar plate.Then, detect IDO activity in selected clone's the rough cell lysate.

As a result, selected TG1[pMW119-(Lys, 32)] and TG1[pMW119-(Lys, 23)] two clones.Separate corresponding plasmid, and carried out sequential analysis (referring to Figure 16, Figure 17) for the clone BamHI-SacI fragment of each plasmid.

The dna sequence dna of assay determination has shown the difference (Figure 18, Figure 19) between cloned genes and known RBTH_06809ORF.In addition, measured IDO (Lys on plasmid pMW119,23) point mutation in the regulatory region, the extended translation that causes eliminating the TAA terminator codon of leading peptide (1) and make it be to TGA terminator codon (leading peptide (2)), itself and ATG initiator codon overlapping (referring to Figure 15 A, C).To extra sudden change, wherein A has replaced C (referring to Figure 15, C) in " 2 " position detection.

The mensuration of IDO activity in the rough cell lysate of (2.4.TG1[pMW119-IDO Lys, 23) and TG1[pMW119-IDO (Lys, 32) bacterial strain.For the IDO activity in the rough cell lysate of studying recombinant escherichia coli strain, following steps have been carried out.By centrifugally having gathered in the crops cell from the 5ml culture at 4 ℃, be resuspended in the 0.5ml buffer A ^*In (50mM TRIZMA, 5% glycerine, 1mMEDTA, 1mM DTT, the pH 7 that regulates by HCl) and by the supersound process at 4 ℃ it is broken.Reaction mixture (50 μ l) comprises 50mM HEPES pH 7.0; 5mM Ile; 0.5mM α-Tong Wuersuan; The 5mM xitix; 5mM FeSO ₄Aliquots containig with the protein Preparation thing.To be reflected under the oscillating condition 34 ℃ of incubations 1 hour.Use TLC or HPLC to analyze and detect synthetic 4HIL as described in example 4 above.The result is summarised in the table 12.

Embodiment 6. uses the IDO activity that the bio-transformation of L-Isoleucine is 4HIL

In the LB substratum that has replenished penbritin (100mg/l), cultivate recombinant escherichia coli strain TG1[pMW119-IDO (Lys, 23)] and TG1[pMW119-IDO (Lys, 32)] cell, until reaching optical density(OD) A ₅₄₀=4-5 (about 6 hours).By centrifugal from 2ml nutrient solution harvested cell, be resuspended in 1ml solution MI50 (100mM KH thereafter ₂PO ₄(regulating pH 7 by NaOH), NH ₄Cl 20mM, MgSO ₄2mM, CaCl ₂0.1mM, penbritin 150 μ g/ml, Ile 50mM, 0,5mM α-Tong Wuersuan, glycerine 1%, yeast extract-0.005g/l).

Then, with about 12 hours of cell cultures.Thereafter, the concentration by TLC (HPLC) analytical review 4HIL.The data that obtain are summarised in the table 13.As can be seen from Table 12, with TG1[pMW119-IDO (Lys, 32)] compare TG1[pMW119-IDO (Lys, 23)] caused the accumulation of relatively large 4HIL.

Embodiment 7. usefulness HPLC measure the 4-hydroxy-L-isoleucine of accumulation

HPLC analyzes: used have spectrophotofluorometer 1100 series (Agilent, high pressure chromatograph USA) (Waters, USA).Selected detection ripple scope: excitation wavelength 250nm, emission wavelength ranges 320-560nm.At post Nova-Pak ^TMC18 150 * 3.9mm, (Waters is USA)+400 ℃ of separation of carrying out by accq-tag (accq-mark) method for 4 μ m.The injection volume of sample is 5 μ l.Separating according to Waters manufacturer's recommendation (Liu, H. etc., J.Chromatogr.A, 828,383-395 (1998) of the formation of amino acid derivative and they; Waters accq-tag chemistry package.Instruction manual.Millipore Corporation, pp.1-9 (1993)) carry out.In order to obtain to have the amino acid derivative of 6-quinolylamine-N-hydroxy-succinamide carbamate (6-aminoquinolil-N-hydroxysuccinymidyl carbamate), used test kit Accq-Fluor ^TM(Waters, USA).(Waters USA) has carried out analysis by the accq labelling method to the Accq-tagEluent A that use to concentrate.Complete soln uses the preparation of Milli-Q water, standardized solution is stored at+4 ℃.

Embodiment 8. is from bacillus cereus ATCC 14597, bacillus thuringiensis AKU238 and Wei Family name genus bacillus KBAB4 clone ido gene

(1) preparation chromosomal DNA

With in bacillus cereus ATCC 14579, bacillus thuringiensis AKU238 and each comfortable 5ml LB substratum of Webster genus bacillus KBAB4 28 ℃ of overnight incubation (pre-cultivate).Use the 1.5ml nutrient solution as seed, in 50ml LB substratum, lead cultivation (main culture).After being cultured to logarithmic phase, by centrifugal (12000 * g, 4 ℃, 15 minutes) from 50ml nutrient solution harvested cell.According to conventional methods from these cell preparation chromosomal DNA.

(2) obtain the ido gene by PCR

Based on disclosed genome sequence column information about bacillus cereus ATCC 14579 (GenBank accession number AE016877), synthesized following primer:

CATATGGAGGTTTTTATAATGACGTTTGTT(SEQ ID NO：10)

CTCGAGTTTTGTCTCCTTATAAGAAAATGT(SEQ ID NO：11)

Primer by using preparation and the chromosomal DNA of bacillus cereus ATCC 14578 use PrimeSTAR (TaKaRa) to carry out pcr amplification under the following conditions as template: 98 ℃ of 30 circulations 10 seconds, 52 ℃ of 15 seconds and 72 ℃ 1 minute.

The PCR product that obtains is carried out agarose gel electrophoresis and observes the fragment of about 750bp that increased.Collect described dna fragmentation, with NdeI and XhoI endonuclease digestion, and be cloned among the expression vector pET21b (Novagene) that uses identical endonuclease digestion.Measure nucleotide sequence then and its encoding amino acid sequence of deriving (SEQ ID NO:12 and 13).As a result, confirm to have obtained homology ido gene based on the homology of gained dna fragmentation.Be 98% with respect to the ido gene that is derived from Israel bacillus thuringiensis (B.thuringiensis israelensis) ATCC 35646 in the homology of nucleotide sequence level, and be 98% with respect to the ido gene that is derived from bacillus thuringiensis 2-e-2 in the homology of nucleotide sequence level.

As for bacillus thuringiensis AKU238, by being used for from the primer (SEQ ID NO:14 and 15) of bacillus thuringiensis 2-e-2 clone ido gene, by PCR cloned the ido gene and according to above similar mode check order (SEQ ID NO:16 and 17).Be 98% with respect to the ido gene that is derived from the Israel bacillus thuringiensis in the homology of nucleotide sequence level, and be 98% with respect to the ido gene that is derived from bacillus thuringiensis 2-e-2 in the homology of nucleotide sequence level.

CATATGAAAATGAGTGGCTTTAGCATAGAA(SEQ ID NO：14)

CTCGAGTTTTGTCTCCTTATAAGAAAATGT(SEQ ID NO：15)

As for Webster genus bacillus KBAB4, by the primer based on disclosed genome sequence column information about Webster genus bacillus KBAB4 (GenBank accession number NZ_AAOY01000001), synthesized following primer: (SEQ ID NO:18 and 19), by PCR cloned the ido gene and according to above-mentioned similar mode check order (SEQ ID NO:20 and 21).Be 78% with respect to the ido gene that is derived from the Israel bacillus thuringiensis in the homology of nucleotide sequence level, and be 78% with respect to the ido gene that is derived from bacillus thuringiensis 2-e-2 in the homology of nucleotide sequence level.

CATATGCTAACAACAGTTTCTAATAAGACA(SEQ ID NO：18)

CTCGAGTTTTGGCTCCTTATAAGAAAACGT(SEQ ID NO：19)

Embodiment 9. produces HIL at expression in escherichia coli ido gene with from Ile

(1) ido expression of gene in the intestinal bacteria

The expression that makes up among the embodiment 8 is derived from the plasmid importing intestinal bacteria Rosetta2 (DE3) of the ido gene of bacillus cereus ATCC 14579, bacillus thuringiensis AKU238 or Webster genus bacillus KBAB4, and the gained transformant is cultivated (the pre-cultivation) in the LB substratum that is being supplemented with 50 μ g/ml penbritins under the oscillating condition.Pre-nutrient solution is seeded in the 50ml LB substratum with 1%, leads cultivation at 37 ℃.Cultivate initial after 2 hours, with final concentration 1mM interpolation IPTG, and will cultivate and carry out again 3 hours.After cultivation was finished, with cell harvesting, wash, be suspended among the 20mM Tris-HCl (pH 7.6) of 1ml, and (INSONATOR 201M KUBOTA) broke it with ultrasonic apparatus.With lysate centrifugal 10 minutes of 15000rpm to obtain supernatant liquor, with described supernatant liquor as rough enzyme solution.

(2) use rough enzyme solution to produce HIL from Ile

Use the rough enzyme solution of preparation in (1), measure the activity that Ile is converted into HIL.Reaction mixture has composition as described below.Under oscillating condition (300rpm) measures the HIL that produces by HPLC then 28 ℃ of reactions 3 hours with described reaction mixture.Measurement result is shown in table 14.

Reaction mixture

Table 14 produces the amount of HIL from Isoleucine

HIL(μM)

Israel bacillus thuringiensis ATCC35646 2150

Bacillus thuringiensis 2e2 2321

Bacillus thuringiensis AKU238 2016

Bacillus cereus ATCC 14,579 90

Webster genus bacillus KBAB4 3116

Contrast (pET21b) 11

As a result, when using the bacterial strain of expressing the ido gene that is derived from bacillus cereus ATCC 14579 and the plasmid of expressing the ido gene that is derived from bacillus thuringiensis AKU238 or Webster genus bacillus KBAB4, clearly observe the generation of HIL.Thus, confirmed that these genes can be used for HIL and produce.

The sequence explanation

1: the nucleotide sequence that is derived from the IDO gene of bacillus thuringiensis bacterial strain 2-e-2

2: the aminoacid sequence that is derived from the IDO of bacillus thuringiensis bacterial strain 2-e-2

3: primer svs 170; Be used for amplification IDO gene

4: primer svs 169; Be used for amplification IDO gene

5: the N-end sequence that is derived from the IDO of bacillus thuringiensis bacterial strain 2-e-2

6: the IDO conserved sequence in the bacillus

7: the nucleotide sequence that is derived from the IDO gene of bacillus thuringiensis bacterial strain ATCC 35646

8: the aminoacid sequence that is derived from the IDO of bacillus thuringiensis bacterial strain ATCC 35646

9: the 16S rDNA nucleotide sequence of bacillus thuringiensis bacterial strain 2-e-2

10: be used for from the primer of bacillus cereus ATCC 14579 amplification IDO genes

11: be used for from the primer of bacillus cereus ATCC 14579 amplification IDO genes

12: the nucleotide sequence that is derived from the IDO gene of bacillus cereus ATCC 14579

13: the aminoacid sequence that is derived from the IDO of bacillus cereus ATCC 14579

14: be used for from the primer of bacillus thuringiensis AKU238 amplification IDO gene

15: be used for from the primer of bacillus thuringiensis AKU238 amplification IDO gene

16: the nucleotide sequence that is derived from the IDO gene of bacillus thuringiensis AKU238

17: the aminoacid sequence that is derived from the IDO of bacillus thuringiensis AKU238

18: be used for from the primer of Webster genus bacillus KBAB4 amplification IDO gene

19: be used for from the primer of Webster genus bacillus KBAB4 amplification IDO gene

20: the nucleotide sequence that is derived from the IDO gene of Webster genus bacillus KBAB4

21: the aminoacid sequence that is derived from the IDO of Webster genus bacillus KBAB4

Industrial applicibility

According to the present invention, the method for using enzyme to produce the 4-hydroxyisoleucine is provided, described enzyme is derived from the reaction that microorganism and catalysis produce the 4-hydroxyisoleucine by direct hydroxylation Isoleucine.The present invention is very useful at medicine and field of food.

L-Isoleucine dioxygenase of the present invention is a kind of new dioxygenase, the hydroxylation reaction of its catalysis L-Isoleucine, and can be preferably used for synthesizing (2S, 3R, 4S)-the 4-hydroxy-L-isoleucine, (2S, 3R, 4S)-the 4-hydroxy-L-isoleucine can be as the composition of the pharmaceutical composition with insulinotropic activity.

Claims

1. method that produces 4-hydroxyisoleucine or its salt comprises the step that produces the 4-hydroxyisoleucine, wherein by make L-Isoleucine or its salt in the presence of the dioxygenase that is derived from the microorganism that belongs to bacillus with Fe ²⁺, xitix and 2-oxoglutaric acid carry out hydroxylation reaction and produce the 4-hydroxyisoleucine from the L-Isoleucine as cofactor,

Wherein said dioxygenase is the protein of being made up of SEQ ID No:2,8,13,17 or 21 aminoacid sequence.

2. according to the production method of claim 1, the wherein said microorganism that belongs to bacillus is to be selected from following microorganism: bacillus thuringiensis, bacillus cereus and Webster genus bacillus.

3. according to each production method among the claim 1-2, wherein said hydroxylation reaction carries out in the presence of the cell lysate of the microorganism cells of logarithmic phase in preparation.

4. according to the production method of claim 1, wherein the L-Isoleucine is carried out hydroxylation reaction.

5. one kind is selected from down the DNA that organizes:

(a) DNA that is formed by the nucleotide sequence of SEQ ID No:1;

(b) protein DNA of encoding and being formed by the aminoacid sequence of SEQ ID No:2.

6. recombinant DNA, it will be by being connected acquisition according to the DNA of claim 5 with carrier DNA.

7. one kind by the recombinant DNA cell transformed according to claim 6.

8. one kind for generation of the method for protein with L-Isoleucine dioxygenase activity, it comprises: will be according to the protein that the cell of claim 7 is cultivated in substratum and accumulation has L-Isoleucine dioxygenase activity in substratum and/or cell.

9. protein, its aminoacid sequence by SEQ ID No:2 is formed.

One kind for the preparation of (2S, 3R 4S)-method of 4-hydroxy-L-isoleucine or its salt, comprise step:

In the presence of at least a L-Isoleucine dioxygenase of being formed by SEQ ID No:2,8,13,17 or 21 aminoacid sequence, use Fe ²⁺, xitix and 2-oxoglutaric acid react the L-Isoleucine as cofactor in aqueous solvent; With

The separation generation (2S, 3R, 4S)-the 4-hydroxy-L-isoleucine.

11. one kind for the preparation of (2S, 3R 4S)-method of 4-hydroxy-L-isoleucine or its salt, comprise step:

In the presence of the bacterium that comprises the L-Isoleucine dioxygenase of being formed by SEQ ID No:2,8,13,17 or 21 aminoacid sequence, use Fe ²⁺, xitix and 2-oxoglutaric acid react the L-Isoleucine as cofactor in aqueous solvent; With

The separation generation (2S, 3R, 4S)-the 4-hydroxy-L-isoleucine.

12. according to the method for claim 11, wherein said bacterium is modified to strengthen L-Isoleucine dioxygenase activity.

13. according to the method for claim 12, wherein the activity of L-Isoleucine dioxygenase strengthens by the expression of gene that increases the described L-Isoleucine dioxygenase of coding.

14. according to the method for claim 13, the expression of wherein said L-Isoleucine dioxygenase by modifying the described L-Isoleucine dioxygenase of coding the expression of gene regulating and controlling sequence or the copy number of the gene by increasing the described L-Isoleucine dioxygenase of coding increase.

15. according to each method among the claim 12-14, wherein said bacterium belongs to Escherichia, Rhodopseudomonas, Corynebacterium, genus arthrobacter, Aspergillus or bacillus.

16. according to the method for claim 15, wherein said bacterium belongs to intestinal bacteria, Arthrobacter simplex, Corynebacterium glutamicum, Arthrobacter globiformis, sulphur Arthrobacter, mucus Arthrobacter or subtilis.

17. according to the method for claim 12, wherein said bacterium is bacterial cultures, cell or cell lysate.