JP2021109831A - Telangiectasia inhibitor - Google Patents

Abstract

To provide endothelin B receptor expression inhibitors, telangiectasia inhibitors, and skin redness improving agents, which are characterized by containing as an active ingredient the extract of Borago officinalis or Pueraria montana var. lobata.SOLUTION: The present invention is a cosmetic aimed at improving redness of the skin, a pharmaceutical, a quasi-drug, and a food, characterized by containing as an active ingredient the extract of Borago officinalis or Pueraria montana var. lobata. The extract of Borago officinalis or Pueraria montana var. lobata of the present invention has the excellent effect of inhibiting the expression of endothelin B receptor and has shown the effect of improving redness of the skin.SELECTED DRAWING: Figure 1

Description

The present invention relates to an endothelin B receptor expression inhibitor, a telangiectasia inhibitor, and a skin redness improving agent, which are characterized by containing an extract of borage or kudzu.

Endothelin is an endothelial cell-derived peptide hormone that acts on various cells and tissues through its receptors. For example, it is known that it causes an increase in intracellular calcium concentration in vascular smooth muscle cells and has a vasoconstrictive action (Non-Patent Documents 1 and 2 and Patent Document 1). Although the physiological actions of each receptor are diverse, endothelin A receptors basically increase blood pressure and fluid through vasoconstriction, cardiotonic action, enhancement of central sympathetic nerve activity, and promotion of aldosterone / catecholamine secretion in the adrenal gland. Causes retention. On the other hand, the endothelin B receptor behaves to antagonize the endothelin A receptor at most sites except vascular smooth muscle and adrenocortical cells, and exhibits a blood pressure lowering and diuretic promoting effect as a whole (Non-Patent Document 3).

Blood vessels such as arteries and veins are usually composed of vascular endothelial cells that further cover the lumen and wall cells (smooth muscle cells and pericite) that surround the lumen and control the support of vascular structures and the relaxation and contraction of blood vessels. .. On the other hand, capillaries do not have smooth muscle cells and are composed of vascular endothelial cells (Non-Patent Document 4). The endothelin B receptor exhibits a vasoconstrictive effect in smooth muscle cells like the endothelin A receptor, but exhibits a vasodilatory effect in vascular endothelial cells (Non-Patent Documents 3 and 5). Moreover, since endothelin A receptor does not exist in vascular endothelial cells, only endothelin B receptor is involved in the contraction and relaxation of blood vessels via the endothelin / endothelin receptor pathway (Non-Patent Document 3). Therefore, in capillaries with only vascular endothelial cells, vasodilation occurs via the endothelin / endothelin B receptor pathway.

Color unevenness is represented by spots, freckles, acne, etc., and occupies the top ranks of skin problems of Japanese women, and is an important research target in the fields of cosmetics and aesthetic medicine. The color unevenness includes color unevenness caused by melanin pigment such as spots and freckles, and color unevenness caused by hemoglobin represented by inflammation of acne (Non-Patent Document 6). The former is considered to be dull skin and the latter is considered to be reddish skin.

Redness of the skin is caused by a decrease in the barrier function against viruses and allergens, which makes it easier for an immune response to occur, causing inflammation and dilating capillaries in the skin. In addition, those who cited redness as a skin problem with sensitive skin have a large amount of blood flow, and several small blood vessels have been confirmed. Furthermore, the relationship between reddish face and angiogenic factor (VEGFA) has been pointed out. It is said that the reddish face seen in Westerners, especially rosacea, is partly due to seborrheic dermatitis due to excessive sebum secretion and telangiectasia caused by each (Non-Patent Document 7). As a previous study focusing on the endothelin B receptor, there is a finding that human keratinocytes produce and secrete endothelin and exert a strong growth-promoting effect on human melanocytes through the endothelin B receptor to cause stains (non-endothelin B receptor). Patent Document 8). However, its effect on skin redness has not been studied.

Borage is a plant of the genus Borage of the family Borage, a kind of herb, and has a scientific name: Borago officinalis. It is native to the Mediterranean coast of central Europe. So far, whitening agents, anti-wrinkle agents, anti-aging agents and skin cosmetics (Patent Document 2), moisturizers and skin cosmetics (Patent Document 3), which are characterized by containing an extract of Rurijisa as an active ingredient. Etc. are known. However, an endothelin B receptor expression inhibitor, a telangiectasia inhibitor, and a skin redness improving agent, which are characterized by containing an extract of borage as an active ingredient, are not known.

Kudzu is a climbing perennial plant belonging to the genus Kudzu of the family Leguminosae, and has a scientific name: Pueraria montana. Materials (Patent Document 4), wrinkle improving composition, antiaging composition, skin external composition (Patent Document 5) and the like are known. However, an endothelin B receptor expression inhibitor, a telangiectasia inhibitor, and a skin redness improving agent, which are characterized by containing an extract of kudzu as an active ingredient, are not known.

JP-A-2014-80369 JP-A-2018-203628 Japanese Patent Application Laid-Open No. 09-278641 JP 2012-046457 JP 2012-532098

Hirata Y et al, Biochem. Biophyss. Res. Commun. , 154 (3), 868-875 (1988) Yanagisawa M et al, Nature, 332 (6163), 411-415 (1988) Kazuhiko Nakayama, Heart, 45 (12), 1503-1511 (2013) Yuichi Oike, "Understanding Vascular Research from Basic to Clinical Applications", 28-36 (2004) Donald E. Kohan et al, Physiol. Rev. , 91 (1), 1-77 (2011) Yayoi Inoue, Cosmetics Magazine, 45 (3), 218-224 (2011) Year Iida, Incense Society Magazine, 37 (4), 263-267 (2013) Genji Imokawa, Fragrance Journal, 45 (9), 57-64 (2017)

The problem to be solved by the present invention is to find a plant-derived component that suppresses endothelin B receptor expression, and to use this as an active ingredient, a clear-point of action and an excellent endothelin B receptor expression inhibitor, telangiectasia. It is to provide an inhibitor and a redness improving agent for the skin.

As a result of diligent studies aimed at solving the above problems, the present inventors have found that an extract of borage or kudzu has an excellent endothelin B receptor expression inhibitory effect. Furthermore, the present inventors have found an excellent endothelin B receptor expression inhibitory effect, telangiectasia inhibitory effect, and skin redness improving effect in a composition containing an extract of borage or kudzu, and completed the present invention. I came to do it.

That is, the present invention relates to an endothelin B receptor expression inhibitor, a telangiectasia inhibitor, and a skin redness improving agent, which are characterized by containing an extract of borage or kudzu as an active ingredient.

The present invention includes the following inventions.
(1) An endothelin B receptor expression inhibitor containing an extract of borage and / or kudzu.
(2) The endothelin B receptor expression inhibitor according to claim 1, which suppresses endothelin B receptor expression in vascular endothelial cells.
(3) A telangiectasia inhibitor containing an extract of borage and / or kudzu.
(4) A skin redness improving agent containing an extract of borage and / or debris.

The extract of borage or kudzu of the present invention was excellent in the effect of suppressing the expression of endothelin B receptor. Further, the endothelin B receptor expression inhibitor, the telangiectasia inhibitor, and the skin redness improving agent, which are characterized by containing this extract, are safe and have an excellent effect of preventing telangiectasia or improving skin redness. rice field.

5 is a photomicrograph of a cell in which a fluorescent dye is incorporated into human vascular endothelial cells (HUVEC) in Experimental Example 5. The area surrounded by the dotted line is a blood vessel formed by accumulating HUVEC, and the width of the blood vessel was measured as the outer diameter of the lumen.

The endothelin B receptor in the present invention causes dilation of capillaries by binding to endothelin, which is a vasodilator. Also known as endothelin receptor B type, endothelin receptor B, endothelin receptor type B, endothelin B receptor, EDNRB, ETB, ET-B, ETB1, ETBR, ETRB, HSCR, WS4A, ABCDS, ET-BR, S.

The vascular endothelial cells in the present invention are cells that further cover the lumen of blood vessels.

The improvement of skin redness in the present invention indicates that the skin redness caused by hemoglobin caused by skin troubles of sensitive skin such as ultraviolet rays and oxidative stress is improved.

Borage used in the present invention is a plant, a kind of herb, and is native to the Mediterranean coast of central Europe. The height is about 30 to 60 cm, and the pale green leaves and stems are covered with white hair, and blue and white star-shaped flowers come in summer. Also known as borage, borage, borage, borage, borage, borage, and borage.

As the extract of borage in the present invention, borage (scientific name: Borago officinalis) of the genus Borage of the family Borages of Lamiales is used, and as a part, a part of a plant such as flowers, fruits, seeds, leaves, stems and roots. Or it is extracted from whole plant. The extraction method is not particularly limited, and for example, it may be heat-extracted or room-temperature extracted. Further, for the extraction, the plant body may be used as it is, or may be subjected to treatments such as drying, crushing, and shredding.

Among the vine perennials of the genus Kudzu of the leguminous family, the kudzu used in the present invention includes, for example, kudzu (Pueraria lobata, P. montana, P. tunbergiana), Thai one kudzu (P. omeiensis, P. tonkinensis), and Shinano kudzu (P. tonkinensis). Somesonii, P. chinensis) can be used. The kudzu extract used in the present invention is a part or whole plant of a plant such as a kudzu flower, fruit, seed, leaf, stem, root, etc., and preferably an extract of a kudzu rhizome. For the extraction, these plants may be used as they are, or may be subjected to treatments such as drying, crushing, and shredding. Also known as Umanobotamoch, Kusu, Kakkonto, Kuzune, and Kakkon.

The extraction method is not particularly limited, but can be carried out by a method of stirring or column extraction using water or hot water, or a mixed solvent of water and an organic solvent. Examples of the extraction solvent include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.) and liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, etc.). , Glycerin, etc.), Ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.) Etc.). Polar solvents such as water, lower alcohols and liquid polyhydric alcohols are preferred, and water, ethanol, 1,3-butylene glycol and propylene glycol are particularly preferred. These solvents may be used alone or in admixture of two or more. Particularly preferable extraction solvents include water and water-ethanol mixed polar solvents. The amount of the solvent used is not particularly limited, and may be, for example, 10 times or more, preferably 20 times or more, based on the whole plant of borage or the rhizome (dry weight) of kudzu, but may be concentrated after extraction. It is preferably 100 times or less for convenience of operation in the case of isolation. The extraction temperature and time can be appropriately selected depending on the type of solvent used, the pressure at the time of extraction, and the like.

The above extract may be used as it is in the extracted solution, but if necessary, concentration (concentration by vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon, etc. is performed within the range in which the effect of the present invention is exhibited. , Deodorization, ethanol precipitation, etc. may be performed before use. Further, the extracted solution may be subjected to treatments such as concentrated drying, spray drying, freeze drying and the like, and used as a dried product.

In the present invention, the above-mentioned extract may be used as it is, and fats and oils, waxes, and carbonized components used in cosmetics, non-pharmaceutical products, pharmaceuticals, foods, etc., as long as the effects of the extracts are not impaired. Hydrogens, fatty acids, alcohols, esters, surfactants, metal soaps, pH regulators, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents , Chelating agents, excipients, film agents, sweeteners, acidity agents and the like may be contained.

The present invention can be used for any of cosmetics, non-pharmaceutical products, pharmaceuticals, and foods, and the dosage forms thereof include, for example, cosmetics, creams, emulsions, gels, aerosols, essences, packs, and cleaning agents. , Baths, foundations, dusting, lipsticks, ointments, poultices, tablets, capsules, chocolates, gums, candy, beverages, powders, granules, tablets, sugar-coated tablets, syrups, pills, suspensions, liquids , Emulsion, suppository, solution for injection and the like.

In the case of external use, the content of the extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight in terms of solid matter. Further, 0.01 to 5% by weight is most preferable. If it is less than 0.0001% by weight, it is difficult to expect a sufficient effect. If it exceeds 10% by weight, the enhancement of the effect is hardly recognized and it is uneconomical.

For internal use, the intake varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, and the like. Usually, the daily intake per adult is preferably 5 mg or more, and more preferably 10 mg to 5 g. Further, 20 mg to 2 g is most preferable.

Next, in order to explain the present invention in detail, examples of production, experiment, and formulation of the extract used in the present invention will be given as examples, but the present invention is not limited thereto. The% shown in the production example means% by weight, and the content part shown in the formulation example means a weight part.

An extract of borage or kudzu was produced as follows. In Production Examples 1 to 4, borage whole plant was used as the extraction material, and in Production Examples 5 to 8, the rhizome of waste was used as the extraction material.

(Production Example 1) Preparation of hot water extract of borage 200 mL of water was added to 10 g of a dried borage, and the mixture was extracted at 95 to 100 ° C. for 2 hours. The obtained extract was filtered, the filtrate was concentrated, and lyophilized to obtain 1.4 g of a hot water extract of borage.

(Production Example 2) Preparation of 50% Ethanol Extract of Borage 10 g of a dried borage was immersed in 200 mL of a 50% ethanol aqueous solution at room temperature for 7 days for extraction. The obtained extract was filtered and then concentrated to dryness with an evaporator to obtain 1.1 g of a 50% ethanol extract of borage.

(Production Example 3) Preparation of Ethanol Extract of Borage 10 g of a dried borage was immersed in 200 mL of ethanol at room temperature for 7 days for extraction. The obtained extract was filtered and then concentrated to dryness with an evaporator to obtain 0.4 g of an ethanol extract of borage.

(Production Example 4) Preparation of 1,3-butylene glycol extract of borage 10 g of a dried product of borage was immersed in 200 mL of 1,3-butylene glycol at room temperature for 7 days for extraction. The obtained extract was filtered to obtain 192 g of borage 1,3-butylene glycol extract.

(Production Example 5) Preparation of hot water extract of kudzu rhizome 150 mL of water was added to 10 g of dried kudzu rhizome from which the root bark had been removed, and the mixture was extracted at 95 to 100 ° C. for 2 hours. The obtained extract was filtered, the filtrate was concentrated, and freeze-dried to obtain 1.2 g of a hot water extract of rhizome of waste.

(Production Example 6) Preparation of 50% ethanol extract of kudzu rhizome 10 g of dried kudzu rhizome from which the root bark has been removed is immersed in 150 mL of a 50% ethanol aqueous solution for 7 days at room temperature, and shake-extracted at a rate of 180 rpm. went. The obtained extract was filtered and then concentrated to dryness with an evaporator to obtain 2.0 g of a 50% ethanol extract of the rhizome of waste.

(Production Example 7) Preparation of ethanol extract of kudzu rhizome 10 g of dried kudzu rhizome from which the root bark was removed was immersed in 100 mL of ethanol for 7 days at room temperature, and shake-extracted at a rate of 180 rpm. The obtained extract was filtered and then concentrated to dryness with an evaporator to obtain 0.4 g of an ethanol extract of the rhizome of waste.

(Production Example 8) Preparation of 1,3-butylene glycol extract of kudzu rhizome 10 g of dried kudzu rhizome from which the root bark was removed was immersed in 200 mL of 1,3-butylene glycol at room temperature for 7 days at 180 rpm. Shaking extraction was performed at a rate. The obtained extract was filtered to obtain 190 g of 1,3-butylene glycol extract of the rhizome of waste.

(Prescription example 1) Toner prescription content (part)
1. 1. Borage hot water extract (Production Example 1) 2.0
2.1,3-butylene glycol 8.0
3. 3. Glycerin 2.0
4. Xanthan gum 0.02
5. Citric acid 0.01
6. Sodium citrate 0.1
7. Ethanol 5.0
8. Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40EO) 0.1
10. Appropriate amount of fragrance 11. [Manufacturing method] Ingredients 1 to 6 and 11 and components 7 to 10 are uniformly dissolved in purified water to make the total amount 100, and both are mixed and filtered to obtain a product.

(Comparative Formulation Example 1) Conventional Toner In Formulation Example 1, the hot water extract of borage was replaced with purified water, and the conventional lotion was used.

(Prescription example 2) Cream prescription content (part)
1. 1. 50% ethanol extract of kudzu rhizome (Production Example 6) 1.0
2. Squalene 5.5
3. 3. Olive oil 3.0
4. Stearic acid 2.0
5. Beeswax 2.0
6. Octyldodecyl myristate 3.5
7. Polyoxyethylene cetyl ether (20EO) 3.0
8. Behenyl alcohol 1.5
9. Glycerin monostearate 2.5
10. Fragrance 0.1
11. Methyl paraoxybenzoate 0.2
12.1,3-butylene glycol 8.5
13. [Manufacturing method] Ingredients 2 to 9 having a total amount of 100 in purified water are melted by heating and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 1 and 11 to 13 are heated and dissolved and mixed, and kept at 75 ° C. to prepare an aqueous phase. An aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring, component 10 is added at 45 ° C., and the mixture is further cooled to 30 ° C. to obtain a product.

(Comparative Formulation Example 2) Conventional Cream In Formulation Example 2, a cream obtained by replacing the 50% ethanol extract of the rhizome of kudzu with purified water was used as a conventional cream.

(Prescription example 3) Emulsion prescription content (part)
1. 1. Borage ethanol extract (Production Example 3) 0.01
2. Squalene 5.0
3. 3. Olive oil 5.0
4. Jojoba oil 5.0
5. Cetanol 1.5
6. Glycerin monostearate 2.0
7. Polyoxyethylene cetyl ether (20EO) 3.0
8. Polyoxyethylene sorbitan monooleate (20EO) 2.0
9. Fragrance 0.1
10. Propylene glycol 1.0
11. Glycerin 2.0
12. Methyl paraoxybenzoate 0.2
13. [Manufacturing method] Ingredients 1 to 8 having a total amount of 100 in purified water are melted by heating and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 10 to 13 are heated and dissolved, mixed, and kept at 75 ° C. to prepare an aqueous phase. An aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring, component 9 is added at 45 ° C., and the mixture is further cooled to 30 ° C. to obtain a product.

(Prescription example 4) Gel preparation Prescription content (part)
1. 1. Borage 1,3-butylene glycol extract (Production Example 4) 1.0
2. Ethanol 5.0
3. 3. Methyl paraoxybenzoate 0.1
4. Polyoxyethylene hydrogenated castor oil (60EO) 0.1
5. Appropriate amount of fragrance 6.1,3-butylene glycol 5.0
7. Glycerin 5.0
8. Xanthan gum 0.1
9. Carboxyvinyl polymer 0.2
10. Potassium hydroxide 0.2
11. [Manufacturing method] Ingredients 2 to 5 and components 1 and 6 to 11 having a total amount of 100 in purified water are uniformly dissolved, and the two are mixed to obtain a product.

(Prescription example 5) Pack prescription content (part)
1. 1. Hot water extract of kudzu rhizome (Production Example 5) 5.0
2. Polyvinyl alcohol 12.0
3. 3. Ethanol 5.0
4.1,3-butylene glycol 8.0
5. Methyl paraoxybenzoate 0.2
6. Polyoxyethylene hydrogenated castor oil (20EO) 0.5
7. Citric acid 0.1
8. Sodium citrate 0.3
9. Appropriate amount of fragrance 10. [Manufacturing method] Ingredients 1 to 10 having a total amount of 100 are uniformly dissolved in purified water to prepare a product.

(Prescription example 6) Foundation prescription content (part)
1. 1. 50% ethanol extract of borage (Production Example 2) 1.0
2. Stearic acid 2.4
3. 3. Polyoxyethylene sorbitan monostearate (20EO) 1.0
4. Polyoxyethylene cetyl ether (20EO) 2.0
5. Cetanol 1.0
6. Liquid lanolin 2.0
7. Liquid paraffin 3.0
8. Isopropyl myristate 6.5
9. Sodium Carboxymethyl Cellulose 0.1
10. Bentonite 0.5
11. Propylene glycol 4.0
12. Triethanolamine 1.1
13. Methyl paraoxybenzoate 0.2
14. Titanium dioxide 8.0
15. Talc 4.0
16. Bengala 1.0
17. Yellow iron oxide 2.0
18. Appropriate amount of fragrance 19. [Manufacturing method] Ingredients 2 to 8 having a total amount of 100 in purified water are dissolved by heating and kept at 80 ° C. to prepare an oil phase. Ingredient 9 is well swollen with ingredient 19, then ingredients 1 and 10-13 are added and mixed uniformly. Ingredients 14 to 17 pulverized and mixed by a pulverizer are added thereto, and the mixture is stirred with a homomixer and kept at 75 ° C. to prepare an aqueous phase. The aqueous phase is added to this oil phase while stirring to emulsify. Then, the mixture is cooled, component 18 is added at 45 ° C., and the product is cooled to 30 ° C. with stirring to obtain a product.

(Prescription example 7) Prescription content for bath (part)
1. 1. Ethanol extract of kudzu rhizome (Production Example 7) 1.0
2. Sodium bicarbonate 50.0
3. 3. Yellow No. 202 (1) Appropriate amount 4. Appropriate amount of fragrance 5. [Manufacturing method] Ingredients 1 to 5 having a total amount of 100 with sodium sulfate are uniformly mixed to prepare a product.

(Prescription example 8) Ointment prescription content (part)
1. 1. 1,3-butylene glycol extract of kudzu rhizome (Production Example 8) 5.0
2. Polyoxyethylene cetyl ether (30EO) 2.0
3. 3. Glycerin monostearate 10.0
4. Liquid paraffin 5.0
5. Cetanol 6.0
6. Methyl paraoxybenzoate 0.1
7. Propylene glycol 10.0
8. [Manufacturing method] Ingredients 2 to 5 having a total amount of 100 in purified water are melted by heating and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 1 and 6 to 8 are heated, dissolved and mixed, and kept at 75 ° C. to prepare an aqueous phase. An aqueous phase is added to the oil phase to emulsify, and the product is cooled to 30 ° C. with stirring.

(Prescription example 9) Powder prescription content (part)
1. 1. Borage hot water extract (Production Example 1) 0.5
2. Hot water extract of kudzu rhizome (Production Example 5) 0.5
3. 3. Dried cornstarch 39.0
4. Microcrystalline Cellulose 60.0
[Manufacturing method] Ingredients 1 to 4 are mixed to prepare a powder.

(Prescription example 10) Tablet prescription content (part)
1. 1. Borage ethanol extract (Production Example 3) 2.5
2. Ethanol extract of kudzu rhizome (Production Example 7) 2.5
3. 3. Dried cornstarch 25.0
4. Carboxymethyl Cellulose Calcium 20.0
5. Microcrystalline Cellulose 40.0
6. Polyvinylpyrrolidone 7.0
7. Talc 3.0
[Manufacturing method] Ingredients 1 to 5 are mixed, and then an aqueous solution of ingredient 6 is added as a binder to form granules. Ingredient 7 is added to the molded granules and the mixture is locked. One tablet weighs 0.52 g.

(Prescription example 11) Tablet confectionery prescription content (part)
1. 1. Borage ethanol extract (Production Example 3) 1.0
2. Ethanol extract of kudzu rhizome (Production Example 7) 1.0
3. 3. Dried cornstarch 49.8
4. Erythritol 40.0
5. Citric acid 5.0
6. Sucrose fatty acid ester 3.0
7. Fragrance 0.1
8. Purified water 0.1
[Manufacturing method] Ingredients 1 to 5 and 8 are mixed and granulated. Ingredients 6 and 7 are added to the molded granules and the mixture is locked. One grain is 1.0 g.

(Prescription example 12) Beverage prescription content (part)
1. 1. Borage hot water extract (Production Example 1) 0.025
2. Hot water extract of kudzu rhizome (Production Example 5) 0.025
3. 3. Stevia 0.05
4. Malic acid 5.0
5. Fragrance 0.1
6. Purified water 94.8
[Manufacturing method] Ingredients 3 and 4 are dissolved in a small amount of water. Then, ingredients 1, 2, 5 and 6 are added and mixed.

Next, in order to explain the effect of the present invention in detail, an experimental example will be given.

Experimental Example 1 Effect of extracts of rurigisa and debris on the expression of genes encoding endothelin B receptor protein in human vascular endothelial cells The expression level of endothelin B receptor mRNA was measured. Human vascular endothelial cells (HUVEC) were seeded on a 6-well plate and cultured in HuMedia-EG2 (Kurabo) medium at 37 ° C. and 5% CO ₂ conditions. When it became confluent, it was replaced with HuMedia-EG2 in which the borage extract (Production Example 1) or the waste extract (Production Example 5) was dissolved so as to have a final concentration of 10 μg / mL. Total RNA was extracted 24 hours after the addition. Extraction of total RNA from cells was performed using RNAiso Plus (Takarabio), and the total amount of RNA was determined by absorbance at 260 nm using a spectrophotometer (NanoDrop). The mRNA expression level was measured by the real-time RT-PCR method based on the total RNA extracted from the cells. For the real-time RT-PCR method, High Capacity RNA-to- cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. That is, after a reverse transcription reaction of 500 ng of total RNA, a PCR reaction (95 ° C: 15 seconds, 60 ° C: 60 seconds, 40 cycles) was performed. For other operations, the expression level of endothelin B receptor mRNA was determined as a ratio to the expression level of β-actin mRNA, which is an internal standard, according to a predetermined method. The endothelin B receptor expression suppression rate was calculated as the ratio of the expression level of endothelin B receptor mRNA in the sample-added group to the expression level of endothelin B receptor mRNA in the control (non-sampled) group. The primers used to measure the expression level of each gene are as follows.

Primer set for endothelin B receptor CAAGGACCCATCGAGATACAG (SEQ ID NO: 1)
CGAACACAAGGCAGGACACA (SEQ ID NO: 2)
Primer set for β-actin CACTTTCCAGCCTTCCTTCC (SEQ ID NO: 3)
GTGTTGGGCGTACAGGTCTTG (SEQ ID NO: 4)

The results are shown in Table 1. The expression level of endothelin B receptor mRNA in human vascular endothelial cells was decreased by borage and kudzu extract. The same effect was observed in the borage extract (Production Examples 2, 3 and 4) and the kudzu extract (Production Examples 6, 7 and 8).

Experimental Example 2 Effect of extracts of ruridisa and debris on changes in endothelin B receptor expression by UVA irradiation in human vascular endothelial cells Human vascular endothelial cells (HUVEC) were seeded on a 6-well plate and used as a medium for HuMedia-EG2 (Kurabou). The cells were cultured at 37 ° C. _{under 5% CO 2 conditions.} When the confluent state was reached, HUVEC was washed with PBS (−) and then irradiated with ^{UVA 10 J / cm 2 in the presence of PBS (−).} After the irradiation, the borage extract (Production Example 1) or the waste extract (Production Example 5) was replaced with HuMedia-EG2 dissolved so as to have a final concentration of 10 μg / mL. This operation was repeated for 3 days, and after culturing for 24 hours after the final irradiation, total RNA was extracted. Extraction of total RNA from cells was performed using RNAiso Plus (Takarabio), and the total amount of RNA was determined by absorbance at 260 nm using a spectrophotometer (NanoDrop). The mRNA expression level was measured by the real-time RT-PCR method based on the total RNA extracted from the cells. For the real-time RT-PCR method, High Capacity RNA-to- cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. That is, after a reverse transcription reaction of 500 ng of total RNA, a PCR reaction (95 ° C: 15 seconds, 60 ° C: 60 seconds, 40 cycles) was performed. For other operations, the expression level of endothelin B receptor mRNA was determined as a ratio to the expression level of β-actin mRNA, which is an internal standard, according to a predetermined method. The endothelin B receptor expression suppression rate was calculated as the ratio of the expression level of endothelin B receptor mRNA in the sample-added group to the expression level of endothelin B receptor mRNA in the control (non-sampled) group.

The results are shown in Table 2. The borage and kudzu extracts were found to have the effect of reducing the endothelin B receptor mRNA expression level increased by UVA irradiation. The same effect was observed in the borage extract (Production Examples 2, 3 and 4) and the kudzu extract (Production Examples 6, 7 and 8).

Experimental Example 3 Vasodilation of human vascular endothelial cells by UVA irradiation and effects of borage and debris extracts Human vascular endothelial cells (HUVEC) were seeded on a 60 mm dish and placed in a medium of HuMedia-EG2 (Kurabo) at 37 ° C. Cultured under 5% CO _{2 conditions.} When the confluent state was reached, HUVEC was washed with PBS (−) and then irradiated with ^{UVA 10 J / cm 2 in the presence of PBS (−).} After culturing for 24 hours after irradiation, CellTracker ^TM Orange CMRA Dye (Invitrogen) was replaced with diluted HuMedia-EG2. After washing with PBS (-) after 30 minutes, the cells were detached using trypsin-EDTA, and Cellmatlix Type 1-A (Nitta Gelatin) was previously placed in the insert of ThinCert CELL CULTURE ENCERT FOR 6 WELL PLATES (Greener). ) Was added in an amount of 500 mL, and 1 × 10 ⁵ cells were seeded on the solidified collagen gel. After the cells adhere, 500 mL of Cellmatlix Type 1-A is added from above to solidify the collagen gel, and the borage extract (Production Example 1) or waste extract (Production Example 1) or waste extract (manufacturing example 1) or waste extract is added so that the final concentration inside and outside the insert is 10 μg / mL. Example 5) was filled with dissolved HuMedia-EG2. Twenty-four hours after the addition, the observation was carried out with a fluorescence microscope (Keyence).

The results of angiogenesis by HUVEC are shown in FIG. 1, and the measurement results of the outer diameter are shown in Table 3. Since the outer diameter of the blood vessels formed by HUVEC dilated by UVA irradiation was reduced by the borage and debris extracts, the effect of suppressing telangiectasia was observed in the borage and debris extracts. The same effect was observed in the borage extract (Production Examples 2, 3 and 4) and the waste extract (Production Examples 6, 7 and 8).

The endothelin B receptor expression inhibitor, telangiectasia inhibitor, and skin redness improving agent, which are related to the present invention and are characterized by containing an extract of borage or waste as an active ingredient, are used for the purposes of each agent. Demonstrates an excellent improvement effect. Therefore, it is possible to provide cosmetics, pharmaceuticals, quasi-drugs and foods for the purpose of improving redness of the skin.

Claims (4)

An endothelin B receptor expression inhibitor comprising an extract of borage and / or kudzu. The endothelin B receptor expression inhibitor according to claim 1, which suppresses endothelin B receptor expression in vascular endothelial cells. A telangiectasia inhibitor characterized by containing an extract of borage and / or debris. A skin redness improving agent characterized by containing an extract of borage and / or debris.

Images