JP2019189594A - Weight gain inhibiting and/or visceral fat accumulation inhibiting composition - Google Patents

Abstract

To provide a novel weight gain inhibiting and/or visceral fat accumulation inhibiting composition.SOLUTION: A weight gain inhibiting and/or visceral fat accumulation inhibiting composition contains polymethoxyflavone and ursolic acid as active ingredients.SELECTED DRAWING: Figure 1

Description

  The present invention relates to a composition for inhibiting weight gain and / or inhibiting visceral fat accumulation, comprising polymethoxyflavones and ursolic acid as active ingredients.

  Polymethoxyflavones are natural compounds having the structure of the following chemical formula (1).

Polymethoxyflavones have a taste improving effect (Patent Document 1), an muscular disease improving action (Patent Document 2), an anti-obesity action and a blood flow improving action (Patent Document 3), and a carcinogenesis suppressing action (Patent Document 4). Various actions such as) are known.
Citrus fruit peel is known as a plant rich in polymethoxyflavones, and a method of efficiently extracting it is also known (Patent Document 4). It is also contained in a large amount in ginger family plants, and among them, the hot water extract of black ginger (black ginger) contains a lot of polymethoxyflavones (Patent Document 5).
Black ginger extract is also attracting attention as a food for diet.

  On the other hand, ursolic acid is a compound specified by the following chemical formula (2).

Ursolic acid is a terpene present in many plants such as apple, basil, bilberry, cranberry, elderflower, peppermint, rosemary, lavender, oregano, thyme, hawthorn and prune.
This ursolic acid has also been found to have an anti-obesity action (Patent Documents 6 and 7), and has attracted attention.

JP 2013-121973 A JP 2016-193906 A JP 2017-119511 A JP 2010-037317 A JP 2013-192513 A International Publication No. 2003/011267 Special table 2008-508284

  The present inventors have been studying dietary foods and drinks. Research has been conducted based on the background art as described above, and it has been found that the combined use of polymethoxyflavones and ursolic acid synergistically exhibits an effect of suppressing body weight gain and / or visceral fat accumulation, and thus has made the present invention.

  That is, an object of the present invention is to provide a novel composition for suppressing weight gain and / or suppressing visceral fat accumulation.

The main configuration of the present invention is as follows.
(1) A composition for inhibiting weight gain and / or inhibiting visceral fat accumulation, comprising polymethoxyflavones and ursolic acid as active ingredients.
(2) The composition according to (1), containing 1 to 5 parts by mass of ursolic acid per 1 part by mass of polymethoxyflavones.
(3) The composition according to (1) or (2), wherein the polymethoxyflavones are derived from a black ginger (scientific name: Kaempferia parviflora) extract.
(4) The composition according to any one of (1) to (3), wherein ursolic acid is derived from a sage (scientific name: Salvia officinalis) extract.
(5) A composition for suppressing body weight gain and / or suppressing visceral fat accumulation containing a black ginger (scientific name: Kaempferia parviflora) extract and a sage (scientific name: Salvia officinalis) extract.
(6) A composition for activating gene expression that promotes energy metabolism in both brown adipose tissue and white adipose tissue containing polymethoxyflavones and ursolic acid as active ingredients.
(7) The composition according to (6), which is a gene system that controls a mechanism by which an activating gene is converted into heat by mitochondrial uncoupling protein 1, UCP1.

  The present invention provides a new composition for suppressing weight gain and / or suppressing visceral fat accumulation. The composition of the present invention exerts a diet effect without limiting the amount of meals or requiring excessive exercise. The composition of the present invention also activates gene expression that promotes energy metabolism in both brown and white adipose tissues.

It is a graph which shows the weight change of a test animal. It is a graph which shows the total food intake per 1 test animal. It is a graph which shows the white adipose tissue weight of a test animal. It is a graph which shows the quadriceps muscle weight of a test animal. It is a graph which shows the blood biochemical analysis result of a test animal. It is a graph which shows the analysis result of the blood hormone of a test animal. It is a graph which shows the result of having measured the expression level of UCP1, PGC1- (alpha), and PRDM16 gene of the epididymal white adipose tissue of a test animal. It is a graph which shows the result of having measured the expression level of UCP1, PGC1- (alpha), and PRDM16 gene of the brown adipose tissue of a test animal.

The present invention relates to a composition for suppressing weight gain and / or suppressing visceral fat accumulation, which contains polymethoxyflavones and ursolic acid as active ingredients.
Polymethoxyflavones are represented by the following general formula (1).

  The method for obtaining polymethoxyflavones is not particularly limited, but those extracted from plants may be used, or those chemically synthesized may be used. In the case of extraction from a plant, it can be extracted and purified from black ginger (scientific name: Kaempferia parviflora Kaempferia parviflora). Polymethoxyflavones that can be obtained from black ginger extract include 5,7-dimethoxyflavone, 5,7,4′-trimethoxyflavone, 3,5,7,3 ′, 4′-pentamethoxyflavone, 3,5,7,4′-tetramethoxyflavone, 5,7,3 ′, 4′-tetramethoxyflavone and the like are contained, and these compounds may be isolated and used in the present invention, or a mixture It may be used as It is easy to use as polymethoxyflavones which are a mixture of these compounds. When used as a mixture, the 5,7-dimethoxyflavone, 5,7,4′-trimethoxyflavone, 3,5,7,3 ′, 4′-pentamethoxyflavone, 3,5,7, The total content of 4′-tetramethoxyflavone and 5,7,3 ′, 4′-tetramethoxyflavone is defined as the total amount of polymethoxyflavones. In addition, when measuring content of polymethoxyflavone, it can quantify with a well-known HPLC method using the standard goods of each polymethoxyflavone compound.

When the polymethoxyflavones used in the present invention are extracted from black ginger, the extraction method disclosed in Patent Document 2 can be used. Specifically, rhizome is used for black ginger (black ginger) as an extraction raw material of black ginger extract.
When using the dried dried rhizome, it is preferable to pulverize the rhizome to about 40 mesh in advance with a pulverizer or the like in order to increase the extraction efficiency.

  The solvent and temperature conditions used for extraction are not particularly limited, and can be arbitrarily selected and set. As the extraction solvent, a non-organic solvent such as water, an acid, or a base, or an organic solvent such as a hydrophilic solvent or acetone can be selected. As the hydrophilic solvent, at least one selected from the group of lower alcohols consisting of methyl alcohol, ethyl alcohol, n-propyl alcohol, isopropyl alcohol and butyl alcohol is preferable from the viewpoint of operability and extraction efficiency. However, extraction with a non-organic solvent is preferable rather than extraction with an organic solvent, and water, hot water or hot water, water with a slight addition of acid, or ethanol is particularly preferable.

  The acid used at this time is not particularly limited. However, the use of acetic acid is preferred from the viewpoint of availability, safety, and post-treatment.

  Further, in the above extraction, it is preferable to repeat the extraction step once or more for the extraction residue. According to this method, the extraction efficiency can be improved. The solvent used for extraction in this case may be the same or different.

The above extract can be used as it is in the composition of the present invention, but it is preferable to remove insoluble substances and solvents by performing treatments such as filtration, centrifugation and fractional distillation. By performing such treatment, the purity becomes higher and the application range becomes wider.
Thereafter, the extract is subjected to treatments such as dilution, concentration, drying, and purification according to a conventional method to obtain a mixture of polymethoxyflavone compounds that can be used in the composition of the present invention as polymethoxyflavones.
Examples of purification methods for polymethoxyflavones include activated carbon treatment, resin adsorption treatment, ion exchange resin, liquid-liquid countercurrent distribution, and preparative liquid chromatography. When added to foods, etc., they may be used as they are unpurified.
The content of polymethoxyflavones is quantified by a known HPLC method using a standard product of the above compound, and the total value is defined as the amount of polymethoxyflavones.

As the polymethoxyflavone used in the present invention, a commercially available black ginger extract can be used. Examples of such commercially available products include black ginger extract (Oryza Oil Co., Ltd.) and black ginger extract (Maruzen Pharmaceutical Co., Ltd.). It is well known that black ginger extract is a safe extract with a long diet.
The black ginger extract used in the present invention preferably contains 20 to 40% by mass of polymethoxyflavones.

  Ursolic acid is a compound specified by the following chemical formula (2).

  Ursolic acid can be extracted from many plants such as apple, basil, bilberry, cranberry, elderflower, peppermint, rosemary, sage, lavender, oregano, thyme, hawthorn and prune. The ursolic acid used in the present invention is preferably a plant extract or a purified product extracted from the plant extract. Of these, extracts from rosemary and sage are preferred.

  In the present invention, ursolic acid is usually obtained from sage (scientific name: Salvia officinalis), which is a perennial or evergreen shrub of the family Lamiaceae. Extraction from sage can be carried out by a normal solvent extraction method. Similar to sage, an extraction method from rosemary containing a high content of ursolic acid is disclosed in Japanese Patent Application Laid-Open No. 2017-149673, and ursolic acid can be extracted from sage according to this method. An example of extraction is as follows.

Extract the extract by adding 95% ethanol to the dried sage leaves. The extract is concentrated under reduced pressure to remove ethanol and then filtered to remove solids. The precipitate formed by cooling is dissolved in an ethanol / ammonia solution, and after removing impurities by filtration, the precipitate is concentrated. Allow to stand after concentration to separate solids. This solid is washed with pure water and vacuum dried to obtain a sage extract containing 50% or more of ursolic acid. The content of ursolic acid in the sage extract can be quantified by a known HPLC method using a standard product. For example, a C18 or ODS column is used for the HPLC column, a solution in which methanol and acetonitrile are mixed at 30:70 is used for the mobile phase, and the flow rate is 0.6 ml / min. The detection of ursolic acid uses a 210 nm UV or PDA detector.
The sage extract used in the present invention preferably contains 30 to 70% by mass of ursolic acid.

  In addition, in order to prepare the composition of this invention, what is marketed as a sage extract containing ursolic acid can also be purchased and used. An example of such a commercially available product is “Sage Extract” manufactured by Sabinsa Japan Corporation. This “sage extract” contains 50% ursolic acid. It is well known that sage extract is a safe extract with a long dietary experience.

In the composition for suppressing body weight gain and / or visceral fat accumulation according to the present invention, 0.1 to 10 parts by mass, preferably 0.5 to 7 parts by mass of ursolic acid with respect to 1 part by mass of polymethoxyflavones. Parts, particularly preferably 1 to 5 parts by mass. In order to exert an anti-obesity effect, in humans, it is effective by ingesting 0.01 to 50 g, preferably 0.05 to 20 g, particularly preferably 0.1 to 10 g of ursolic acid per day. To do.
The composition for suppressing weight gain and / or suppressing visceral fat accumulation according to the present invention may be blended in foods and beverages, and is preferably taken at the same time as a meal.

The composition of the present invention can be used as it is or in the form of a pharmaceutical preparation and blended into health foods or supplement tablets.
In the preparation, excipients and other active ingredients can be used as long as the purpose of the composition of the present invention is not impaired. Specifically, dietary fibers and thickeners such as cyclodextrin, hemicellulose, lignin, guar gum, konjac mannan, isagole, alginic acid, agar, carrageenan, chitin, carboxymethylcellulose, polydextrose, edible oil, calcium, iron, Minerals such as sodium, zinc, copper, potassium, phosphorus, magnesium, iodine, manganese, selenium; fat-soluble or water-soluble such as vitamin A, vitamin C, vitamin D, vitamin E, vitamin K, niacin, folic acid, pantothenic acid Emulsifiers and dispersants such as vitamins, glycerin fatty acid ester, sucrose fatty acid ester, sorbitan fatty acid ester, propylene glycol fatty acid ester, phospholipid, gum arabic, xanthan gum, tragacanth gum, locust bean gum, Quantitatives, preservatives / antioxidants, flavor modifiers and fragrances, flavoring agents such as sodium chloride, sodium glutamate, glycine, succinic acid, sodium lactate, citric acid, sodium citrate, acetic acid, adipic acid, fumaric acid, Acidulants such as malic acid, low calorie sweeteners such as maltitol and aspartame, and coloring agents.

Test examples using the composition of the present invention are shown below to further explain the present invention.
<1. Animal test for confirmation of anti-obesity effect>
Test animals were C57BL / 6j mice, male, 4 weeks old, purchased from Charles River, and subjected to the test from 5 weeks of age after a one week acclimatization period.

  AIN-93M manufactured by Oriental Yeast Co., Ltd. was used as the normal food, and D12492 manufactured by Research Diet was used as the high fat food. The high fat food was divided into small portions and stored in a freezer until just before use. The composition of D12492 is as shown in Table 1 below.

“Black ginger” marketed by Maruzen Pharmaceutical Co., Ltd. was used as a raw material for preparing test feeds. This product contains 33% by weight of black ginger extract, 5,7-dimethoxyflavone, 5,7,4′-trimethoxyflavone, 3,5,7,3 ′, 4′-pentamethoxy as polymethoxyflavones. A total of 8.0% or more of flavone, 3,5,7,4′-tetramethoxyflavone and 5,7,3 ′, 4′-tetramethoxyflavone are contained.
As ursolic acid, 100% of sage extract sold by Savinsa Japan Corporation was used. This product contains 50% by mass of ursolic acid.

  Polymethoxyflavones and ursolic acid were added to and mixed with animal rearing feed to prepare test foods shown in Table 2 below.

The test feed was ad libitum for 12 weeks. The test group was 10 animals per group.
During the acclimatization period, all mice were fed a normal diet. On the day before the start of feeding the test meal, the grouping was carried out as follows by a random sampling method according to body weight so that the average body weight was equal.
Test group 1: Normal food group (normal group)
Test group 2: high fat diet (control group)
Test group 3: high fat diet + 1.5% black ginger * group
Test group 4: High fat diet + 0.5% sage group Test group 5: High fat diet + 1.5% black ginger * + 0.5% sage group (*: Black ginger raw material is 33% by mass of the above-mentioned black ginger extract And 67% by mass of excipient, and 1.5% black ginger group will administer 0.5% by mass of black ginger extract.)

Measurement items General conditions such as appearance, posture, behavior and excrement abnormalities during the test breeding period were observed, and any abnormalities were recorded. Body weight was measured once a week on a small animal balance. The amount of food intake was 3 times a week, and the amount of food intake and the amount of residual food was measured with a balance.
Feeding amount per day per animal = (feeding amount−remaining feeding amount) ÷ 5 (number of animals accommodated) ÷ number of days

  After administration for 12 weeks from the start of feeding the test food, the bed was placed in a cage and a net for preventing fecal eating was laid and fasted for 16 hours. Under isoflurane inhalation anesthesia, whole blood was collected from the abdominal vena cava and euthanized. The blood collected from the abdominal vena cava was left at room temperature and then centrifuged (4 ° C., 5,000 rpm, 10 min) within 30 minutes from the blood collection, and the serum was stored at −80 ° C. Peritesticular fat, perirenal fat, mesenteric fat, brown fat, liver, soleus, gastrocnemius and quadriceps were sampled and the weight of each tissue was measured. Various adipose tissues were placed in RNAlater and stored at −80 ° C. The liver was immersed in RNAlater in 5 mm pieces and stored at −80 ° C., and the remaining liver lobe was stored frozen at −80 ° C. as it was.

  Serum is glucose (quick auto neo GLU / HK, Shinotest), neutral fat (L-type Wako TG / M, Wako Pure Chemical), total cholesterol (L-type Wako CHO / M, Wako Pure Chemical), HDL-cholesterol ( Collestest N HDL, Sekisui Medical), LDL-cholesterol (Cholestest LDL, Sekisui Medical), free fatty acids (NEFA-HR, Wako Pure Chemical Industries), insulin (ultra-sensitive mouse insulin measurement kit, Morinaga Bioscience Institute), Leptin (mouse / rat leptin measurement kit, Morinaga Bioscience Institute) and adiponectin (mouse / rat adiponectin ELISA kit, Otsuka Pharmaceutical) were measured.

  All the measurement results are shown as an average value ± standard deviation. Comparison between the normal group and the control group was calculated using the Excel function t-test. The comparison between the control group fed with a high fat diet and the material addition group is EXCEL statistics Ver. 7.0 was used to perform a Tukey-kramer multiple comparison. The significance level was less than 5% on both sides.

Results and Discussion (1) Change in body weight FIG. 1 shows the change in body weight during the test period, and FIG. 2 shows the total intake per test animal during the test period.
As for the body weight of the control group fed with the high fat diet, a significant increase in body weight was observed compared to the normal diet group after 15 days from the start of administration (t-test, P <0.05). Confirmed that it was established. The 1.5% black ginger group showed a significant suppression of weight gain compared to the control group at 64 and 71 days after administration, but the weight gain suppression effect was weak. In the 0.5% sage group, no statistically significant increase in body weight was observed compared to the control group. The body weight of the 1.5% black ginger + 0.5% sage group, which is the composition of the present invention, shows a significant body weight increase inhibitory effect as compared with the control group after the 36th day of administration, and is 0 after the 50th day. A significant inhibitory effect was seen compared to the 5% sage group, and after 64 days there was also a significant inhibitory effect compared to the 1.5% black ginger group. The synergistic effect of the combined use of black ginger and sage Was confirmed. That is, it has been confirmed that the composition of the present invention is a composition that significantly suppresses weight gain due to intake of a high fat diet.

During the test period, animals were housed 5 cages in 2 cages per group. Although the food intake of the high fat diet group was slightly lower than that of the normal diet group, there was no difference in food intake between the groups fed with the high fat diet as shown in FIG.
Therefore, the weight suppression effect of the composition of the present invention was expected to be an effect relating to energy metabolism, not to the amount of meal.

(2) Tissue Weight The white adipose tissue weight is shown in FIG. White fat was determined by adding the testicular fat, perirenal fat, and mesenteric adipose tissue weight. In the 1.5% black ginger group, the effect of suppressing fat accumulation was not observed. In the 0.5% sage group, there was no change in mesenteric fat, but peritesticular fat and perirenal fat showed a significant fat accumulation inhibitory effect.

  In the 1.5% black ginger + 0.5% sage group, fat accumulation was significantly suppressed as compared with the control group, and also significant between the 1.5% black ginger group and the 0.5% sage group. Since the fat accumulation inhibitory effect was seen, the synergistic fat accumulation inhibitory effect by the combined use of black ginger and sage was confirmed. That is, it was confirmed that the composition of the present invention has an effect of significantly suppressing fat accumulation due to intake of a high fat diet.

  The weight of the quadriceps muscle is shown in FIG. In the 1.5% black ginger + 0.5% sage group, the increase in body weight and white fat increased muscle mass per body weight of the quadriceps.

  From the results of the weight measurement of adipose tissue and muscle tissue, the composition of the present invention is considered to promote energy metabolism and suppress fat accumulation.

(3) Blood biochemistry test The results of blood biochemistry test are shown in FIG. Neutral fat (hereinafter referred to as TG), total cholesterol (T-CHO), HDL-cholesterol (hereinafter referred to as HDL-C), LDL-cholesterol (hereinafter referred to as LDL-C), free fatty acid (hereinafter referred to as As a result of measuring NEFA), changes in TG, HDL-C, and LDL-C were not observed. NEFA significantly decreased in the 1.5% black ginger + 0.5% sage group. The blood glucose level (hereinafter referred to as GLU) was significantly higher in the 1.5% black ginger + 0.5% sage group than in the control group.

  The blood biochemical test results are shown in FIG. Leptin, a hormone secreted from fat cells and acting on feeding suppression and energy metabolism renewal, is 1.5% black ginger group, 0.5% sage group, 1.5% black ginger +0 compared to the control group. There was a significant decrease in the 5% sage group. The leptin value in the 1.5% black ginger + 0.5% sage group was also significantly lower than the 1.5% black ginger group and the 0.5% sage group. That is, it is synergistically reduced by the combined use of polymethoxyflavones and ursolic acid.

  Adiponectin is a hormone that promotes fatty acid burning and sugar uptake to improve insulin resistance. This adiponectin was significantly reduced in the 1.5% black ginger group, the 0.5% sage group, the 1.5% black ginger + 0.5% sage group, as compared with the control group. The adiponectin value of the 1.5% black ginger + 0.5% sage group was also significantly reduced compared to the 1.5% black ginger group and the 0.5% sage group. That is, it is synergistically reduced by the combined use of polymethoxyflavones and ursolic acid.

  There was no difference between groups in HOMA as an index of insulin and insulin resistance.

<2. Measurement of expression levels of UCP1, PGC1-α and PRDM16 in adipose tissue>
UCP1 (mitochondrial uncoupling protein 1) and PGC1-α (PPARγ coactivator 1α), PRDM16 (PRD1- (PRD1-)) involved in the epididymal white adipose tissue and brown adipose tissue collected in the above animal test were used. The effect of the administration composition on gene expression of BF1-RIZ1 homologous domain containing 16) was confirmed.

(1) Method 1) RNA was extracted from the collected tissues with TRIzol Reagent (Molecular Research Center Inc.) and purified with RNeasy Micro Kit (QIAGEN).
2) The RNA concentration was measured (NANODROP ONEC spectrophotometer, Thermo Scientific), and reverse transcription was performed with PrimeScript RT Reagent Kit (Takara Bio) (Simple Amp Thermal Cycler, used apparatus).
3) The obtained cDNA was subjected to real-time PCR by Quant Studio Real Time PCR system using TB Green Prex Ex Taq (Takara Bio) (applied equipment: applied bioscience thermoscientific).
4) Using the gene hypoxanthine phosphoryltransferase 1 (HPRT1) as an endogenous control, the expression level of the measured gene was normalized.
In addition, the primer used for the measurement was purchased from Perfect Real time support system (Takara Bio).

The used primer sequences are as follows.
Hprt1 forward TTGTTGTTGGATATGCCCTTGACTA (SEQ ID NO: 1)
reverse AGGCAGATGGCCACAGGACTA (SEQ ID NO: 2)
Ucp1 forward CACTCAGGATTGGCCTCTACGAC (SEQ ID NO: 3)
reverse GCTCTGGGCTTGCATTCTGAC (SEQ ID NO: 4)
Pgc1-α forward CACTCCAGCAGAATGAGTGACA (SEQ ID NO: 5)
reverse GGTCCTCACCAACCAGAGCA (SEQ ID NO: 6)
Prdm16 forward CCTAGCCCTGAGCGATACTGTGA (SEQ ID NO: 7)
reverse ACAGACAATGGCTGGAATGGTG (SEQ ID NO: 8)

(2) Results FIG. 7 shows the results of measuring the expression levels of UCP1, PGC1-α, and PRDM16 in the epididymal white adipose tissue and FIG. 8 in the brown adipose tissue. 7 and 8, it can be seen that the composition of the present invention activates the expression of genes involved in fat burning in the epididymal white adipose tissue and brown adipose tissue. Particularly in the epididymal white adipose tissue, the composition of the present invention significantly activated the expression of UCP1, PGC1-α, and PRDM16. From this result, the composition of the present invention not only activates the genes involved in the energy production of brown adipose tissue, but also the white adipose tissue, which is a fat accumulation tissue, burns fat like brown adipose tissue, It was thought that it acted to produce.
That is, it can be said that the composition of this invention has the effect | action which acts on a fat tissue directly and burns fat.

Claims (7)

A composition for inhibiting weight gain and / or inhibiting visceral fat accumulation, comprising polymethoxyflavones and ursolic acid as active ingredients. 2. 1 to 5 parts by mass of ursolic acid per 1 part by mass of polymethoxyflavones
A composition according to 1. The composition according to claim 1 or 2, wherein the polymethoxyflavones are derived from an extract of black ginger (scientific name: Kaempferia parviflora). Ursolic acid is sage (scientific name: Salvia officinalis Salvia offic
The composition according to any one of claims 1 to 3, which is derived from an inalis extract. Black Ginger (Scientific name: Kaempferia Parviflora Kaempferia
parviflora) extract and sage (scientific name: Salvia officinalis Salv
a composition for suppressing body weight gain and / or suppressing visceral fat accumulation, comprising an ia officinalis) extract.   A composition for activating gene expression that promotes energy metabolism in both brown adipose tissue and white adipose tissue, comprising polymethoxyflavones and ursolic acid as active ingredients.   The composition according to claim 6, which is a gene system that controls a mechanism by which an activating gene is converted to heat by a mitochondrial uncoupling protein 1, UCP1.