KR20200036715A - Composition for improving fatigue recovery or exercise performance comprising angelica gigas nakai extract, cnidium officinale makino extract and paeonia japonica extract - Google Patents

Abstract

Disclosed in the present specification is a composition for alleviating fatigue or enhancing athletic performance, comprising extracts of Angelica gigas, Paeonia lactiflora, and Cnidium officinale, or fractions thereof as effective components. According to one aspect of the present invention, the composition comprising extracts of Angelica gigas, Paeonia lactiflora, and Cnidium officinale, or fractions thereof as effective components, exerts multifaceted control on various factors involved in physical fatigue and/or athletic performance, and thus can effectively alleviate fatigue accumulated in the body and enhance athletic performance. More specifically, the composition activates the Nrf-2 pathway and increases the expression of HO-1, and as a result can effectively control fatigue-associated factors. In addition, since the composition contains as effective components, plant extracts which are natural products, or a fraction thereof, the composition is completely harmless to the human body and is therefore safe to use.

Description

Composition for promoting fatigue recovery or exercise performance, including Angelica extract, Cheongung extract, and Peony extract.

Disclosed herein is a composition for improving fatigue or exercise performance, comprising an extract of Angelica, peony, and celestial as an active ingredient.

Fatigue is largely divided into mental and physical fatigue, and in general, physical fatigue is a condition in which the force required for muscle contraction activity is not sufficiently exhibited or maintained, and physical or mental ability is reduced so as not to be recovered by rest due to overwork or energy exhaustion. It is defined as a state, a state in which work efficiency or ability to perform exercise is deteriorated. Symptoms of fatigue are drowsiness, guidance, exhaustion, drowsiness, decreased concentration, headache, and muscle pain.

The causes of general physical fatigue are known to be lack or inability to use energy sources stored in the body, accumulation of fatigue substances such as free radicals due to metabolic action, and loss of homeostasis in the body. In particular, it has been found that free radicals are produced by metabolism, resulting in increased occurrence due to excessive physical activity and excessive mental / physical stress. On the other hand, fatigue is not caused by one factor, but is often caused by a variety of factors.

In order to recover physical fatigue, it is necessary to provide sufficient energy sources and rest, and to suppress and eliminate the generation of fatigue substances in the body, but in reality, sufficient nutrition and rest are not achieved in a busy modern society. Therefore, it is necessary to develop a material capable of restoring or restraining fatigue.

On the other hand, in recent years, the general consumer's reluctance to chemical synthetic drugs has been heightened, and the need for the development of herbal medicines using natural products is increasing. Thus, anti-fatigue compositions and the like using natural extracts have been studied, but a substance that quickly and effectively improves fatigue has not been developed.

KR 10-1513 240 B1

In one aspect, an object of the present invention is to provide a composition excellent in fatigue recovery improvement effect or exercise performance enhancement effect.

In one aspect, the object of the present invention is to effectively improve physical fatigue without side effects, or to enhance athletic performance.

In order to achieve the above object, the present invention, in one aspect, Angelica; Peony; And it provides a composition for improving fatigue or exercise performance that includes the extract of the archery or its fraction as an active ingredient.

Angelica which is an aspect of the present invention; Peony; And the composition comprising the extract of the archery or its fraction as an active ingredient, it is possible to effectively improve the accumulated fatigue in the body by variously controlling various factors involved in physical fatigue and / or exercise performance enhancement. Specifically, the composition activates the Nrf-2 pathway, and as a result of increasing the expression of HO-1, it is possible to effectively control factors related to fatigue and / or increased athletic performance. In addition, since the composition contains a natural plant extract or a fraction thereof as an active ingredient, it is harmless to the human body and can be safely used.

1 is a view measuring the exercise distance (Figure 1a) and exercise time (Figure 1b) of the cylindrical rolling test according to the composition treatment of the present invention.
2 is a view showing the time from the forced swimming test according to the composition treatment of the present invention until exhaustion.
3 is a view showing a change in blood glucose concentration after the behavioral test according to the composition treatment of the present invention.
4 is a view showing the activity and concentration changes of Glycogen (Fig. 4a), LDH (Fig. 4b) in muscle tissue after the behavioral test according to the composition treatment of the present invention.
5 is a view showing changes in activity and concentration of MDA (FIG. 5A) and GPx (FIG. 5B) in liver tissue after behavioral testing according to the composition treatment of the present invention.
FIG. 6 is a diagram illustrating RT-PCR gene expression of Nrf-2 (FIG. 6A) and HO-1 (FIG. 6B) in liver tissue after behavioral testing according to the composition treatment of the present invention.
FIG. 7 is a diagram illustrating the gene expression of Nrf-2 (FIG. 7A) and HO-1 (FIG. 7B) in muscle tissue after RT-PCR after behavioral testing according to the composition treatment of the present invention.
250 mg / kg and 500 mg / kg in FIGS. 1 to 7 mean the dosages of Example 3.

Hereinafter, the present invention will be described in detail.

In one aspect, the present invention, Angelica; Peony; And it comprises a composition of the extract or a portion of the arch as an active ingredient, fatigue recovery or exercise performance enhancement composition.

In this aspect, the fatigue may include muscle fatigue.

Angelica is a perennial aromatic grass belonging to the Apiaceae family, and is distributed in Korea, China, and Japan. Angelica gigas Nakai, Angelica sinensis (Oliv.) Diels, Angelica acutiloba , etc. are known, Since Angelica Angelica has excellent blood-sparing and synergistic effects, it is widely used as a blood pressure and anemia treatment.

Cnidium officinale is a perennial plant of the family Apiaceae, and is distributed in Korea and Japan. Since ancient times, the roots of the sky have been used as a soothing, analgesic and tonic.

In the present specification, the peony may refer to a peony plant, and the peony plant is a peony ( Paeonia lactiflora ), a peony ( Paeonia Japonica Miyabe & Takeda ), a peony ( Paeonia lactiflora Pall.), A peony ( Paeonia lactiflora) Pall. Var. Hirta Regel), and a medicinal agent ( Paeonia lactiflora Pall. Var. Trichocarpa (Bunge) Stern).

The peony plant is a perennial plant with a dicotyledonous plant, and is used as a remedy for pain relief, abdominal pain, menstrual pain, amenorrhea, hemorrhage, anemia, and bruises.

In one aspect, the Angelica, peony and peony extract or a fraction thereof, each of the fruit extract or fraction, stem extract or fraction, leaf extract or fraction, or may include a subterranean extract or a fraction thereof, outpost extract or Fractions may be included, but preferably each of the root extract or a fraction thereof.

In the present specification, "extract" means any material obtained by extracting a component therefrom from a natural product, and includes all of the method regardless of the extraction method or the type of component. For example, it may mean that a component dissolved in a solvent is extracted from a natural product using water or an organic solvent.

The extract or a fraction of the extract may be used as it is, but may be filtered and concentrated to use as an extract, and concentrated and freeze-dried to be used as a freeze-dried product.

In one aspect, the Angelica, peony, and each of the archery may be included in a weight ratio of 1 to 100: 1 to 100: 1 to 100. The extract of Angelica, peony and celestial or fractions thereof is preferably 1 to 30: 1 to 30: 1 to 30 in weight ratio, more preferably 1 to 10: 1 to 10: 1 to 10 in weight ratio, more preferably Preferably, a weight ratio of 1 to 5: 1 to 5: 1 to 5, more preferably 0.8 to 1.2: 0.8 to 1.2: may be included in a weight ratio of 0.8 to 1.2, and in one embodiment, a weight ratio of 1: 1: 1 Can be included.

The composition, by using the extract or the fraction of each of the plants in combination, it is possible to obtain a remarkably excellent effect compared to the case of containing only one plant extract or fraction.

In addition, the composition, as compared to the case containing the plant extracts or fractions other than the Angelica, peony and celestial, can exhibit a remarkably excellent fatigue improvement effect or exercise performance enhancement effect.

In one aspect, the extract of Angelica, peony and celestial or fractions thereof, based on the total weight of the composition, may be included in 0.0001 to 90% by weight. Preferably, the extract or its fraction may be included in an amount of 30 to 80% by weight, more preferably 35 to 70% by weight, and more preferably 40 to 65% by weight, based on the total weight of the composition.

In one aspect, the composition can activate the Nrf-2 (Nuclear factor erythroid 2-related factor-2) pathway.

In addition, the composition can increase the expression of HO-1 (heme oxygenase-1).

In the above aspect, the extraction solvent of the extract may include water, an organic solvent or an aqueous solution of the organic solvent.

When the solvent of the extract is water, it may include a cold water extract or a hot water extract.

The organic solvent is not particularly limited, and methanol, ethanol, isopropyl alcohol, n-propyl alcohol, n-butanol and isobutanol and lower alcohols of C _{1 to 5} , glycerol, ethylene glycol, propylene glycol, 1, Polyhydric alcohols such as 3-butylene glycol, hydrocarbon solvents such as methyl acetate, ethyl acetate, benzene, n-hexane, diethyl ether, dichloromethane and chloroform, and petroleum ether, methyl acetate, benzene, hexane, chloroform, and methylene Non-polar organic solvents such as chloride, dimethyl ether, and ethyl acetate.

The concentration of the organic solvent aqueous solution may be 1 to 90% (v / v).

In one aspect, the fraction can include a polysaccharide fraction.

In one embodiment, the composition may include a mixture of the extract and fraction.

When the composition is a mixture of extracts and fractions, the extracts and fractions may be included in a weight ratio of about 40-80: 20-60, preferably 45-75: 25-55, most preferably 50- 70: may be included in a weight ratio of 30-50.

In addition, in the above aspect, the fraction, based on the total content of the extract and fraction, may be included in 10 to 60% by weight, preferably 20 to 50% by weight, more preferably, 25 to 45% by weight % May be included, and more preferably 30 to 40% by weight.

In one aspect, the composition can effectively improve physical fatigue and / or enhance exercise performance by controlling various factors involved in fatigue and / or exercise performance.

For example, the composition, as a result of the behavioral experiment, may increase the moving distance and exercise time, and may exhibit an increase in athletic performance. In addition, the composition may increase the concentration of glucose in the blood, increase the concentration of glycogen in the muscle, and decrease the concentration of lactate dehydrogenase (LDH). In addition, the composition, the concentration of MDA (malondialdehyde) in the liver can be reduced, the concentration of GSH-Px can be increased. In addition, the composition may increase the concentration or expression level of Nrf-2 (Nuclear factor erythroid 2-related factor-2) and HO-1 (Heme oxygenase-1) in the liver and muscle.

Specifically, the composition, by activating the Nrf-2 pathway, inhibits reactive oxygen species through promoting HO-1 activity, reduces MDA, LDH, and increases the activity of GPx to increase the antioxidant reaction It can promote fatigue recovery.

HO-1 is known as a representative cellular defensive phase 2 detoxifying antioxidant enzyme. Induction of HO-1 acts as an important mechanism for various diseases or conditions associated with oxidative stress or tissue inflammatory damage. In addition, Nrf-2 is a very important transcription factor in protecting cells against oxidative stress and carcinogenic processes, and activates transcription of antioxidant enzymes and phase 2 detoxifying enzymes.

In one aspect, the composition may include a pharmaceutical composition or a food composition.

In addition, the pharmaceutical composition may be formulated and used in the form of oral dosage forms, external preparations, and sterile injectable solutions, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., according to a conventional method. In the case of formulation, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents and surfactants are usually used. The solid preparation may include at least one excipient in addition to the active ingredient, for example, starch, calcium carbonate, sucrose or lactose, gelatin. In addition, lubricants such as magnesium stearate can be included in addition to simple excipients. Liquid preparations for oral use include suspensions, liquid solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, may be included. Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, and lyophilized preparations. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

The dosage of the extracts disclosed herein may vary depending on the patient's condition and body weight, the extent of the disease, the type of drug, the route and duration of administration, and may be selected from a range commonly used in the art. In one aspect, the daily dose of the active ingredient may be 0.0001 to 1 g / kg on a dry weight basis.

The food composition may include a health functional food composition, and the health functional food composition includes various foods, beverages, chewing gum, tea, vitamin complexes, health supplements, and the like, powders, granules, tablets, capsules, or beverages. It can be used in the form of phosphorus. The food composition of each formulation can be formulated by appropriately selecting the ingredients commonly used in the field other than the active ingredients according to the formulation or purpose of use without difficulty, and synergistic effects may occur when applied simultaneously with other raw materials.

In one embodiment, the composition may contain other components and the like that can give a synergistic effect to the main effect within a range not impairing the main effect desired by the present invention. For example, in order to improve physical properties, additives such as perfumes, pigments, disinfectants, antioxidants, preservatives, moisturizers, thickeners, inorganic salts, emulsifiers, and synthetic polymer materials may be further included.

In addition, auxiliary components such as water-soluble vitamins, oil-soluble vitamins, polymer peptides, polymer polysaccharides, and seaweed extract may be further included. The above ingredients can be appropriately selected and blended without difficulty by a person skilled in the art depending on the formulation or purpose of use, and the amount of addition can be selected within a range that does not impair the objects and effects of the present invention. For example, the amount of the components added, based on the total weight of the composition, may be in the range of 0.01 to 5% by weight, more specifically 0.01 to 3% by weight.

[Production Example] Preparation of the composition

[Production Example 1-1] Preparation of extract

The roots of Angelica root, the root of the celestial arch, and the roots of peony are mixed in shades and shreds, and then mixed with the same weight, 10 times distilled water (1000 ml of distilled water per 100 g of herbal medicine) is added, followed by hot water extraction for 4 hours. . Solid content was removed from the extract, and concentrated under reduced pressure to obtain an extract (Example 1).

[Production Example 1-2] Polysaccharide fraction preparation

After taking a portion of the extract from Preparation Example 1, adding 100% ethanol 4 times the volume, standing at 25 ° C. or lower for 16 hours, and centrifuging to collect the precipitated crude polysaccharide fraction (Example 2) was used. .

[Production Example 1-3] Preparation of composition

The mixture prepared by mixing the extract prepared in Preparation Example 1-1 (Example 1) and the crude polysaccharide fraction prepared in Preparation Example 1-2 (Example 2) in a weight ratio of about 65-70: 30-35 (Example 3) ).

[Experimental Example]

Using a laboratory mouse, a cylindrical rod test and a forced swimming test (FST) were performed.

As a test mouse, a 6-week-old ICR mouse was used, and it was used in an experiment after being adapted for 1 week in a sterile breeding apparatus.

[Experimental Example 1] Cylindrical rolling test

Cylindrical rolling test (Rotarod test) is performed by pre-training twice during the purification period, and then administering a sample (Examples 1 to 3, and creatine, which is a positive control group) for 3 weeks from the first day after the purification period. Did. Pre-training was carried out at a speed up to 4-40 rpm.

After starting the sample administration, 30 minutes after the sample administration, the Rotarod test was conducted once a week to measure the latency time and the moving distance. In this test, the rotarod cylinder was accelerated at 4-40 rpm within 10 minutes to measure fall latency and travel distance, and the average value was repeated 3 times.

As a result, in the group to which the Example was administered, it was confirmed that the movement distance and the movement time increased compared to the control group (control), and it was found that the exercise performance and endurance increased (FIG. 1). In particular, more excellent effects were confirmed in Example 3, which is a mixture of extracts and fractions, among Examples.

[Experimental Example 2] Forced Swimming Exercise (FST)

After the administration of the sample, 30 minutes after the administration of the sample, a forced swim training was performed once a week (* measurement time until exhaustion), and a forced swimming exercise was performed even on the day of autopsy. The temperature of the water during the swimming was 25 ± 5 ° C, and a weight of 5% of the body weight was added, and the average value repeated 3 times was obtained.

After FST, time to exhaustion and concentration change of factors related to fatigue were measured. Specifically. On the day of autopsy, FST experiments were conducted after the cylindrical rolling test, and autopsy was performed immediately, and gastrocnemius in the blood, liver, and hind legs were collected.

* The time when the nose of the mouse sinks below the water surface for 5 seconds or more is considered as the exhaustion time.

[Experimental Example 3] Measurement of factors related to fatigue recovery / exercise performance enhancement

After separating serum from blood collected from the heart, the concentration of Glucose in serum was measured, the concentration of Glycogen and Lactate dehydrogenase (LDH) in muscle was measured, and malondialdehyde (MDA) and Glutathione peroxidase (GSH-Px) in liver The concentration of was measured.

[Experimental Example 4] RNA extraction and semi-quantitative RT-PCR

-actin; Forward( 5'->3'):GCCATGTACGTAGCCATCCA, Reverse( 5'->3'):GAACCGCTCATTGCCGATAG). Total RNA was extracted using an RNeasy Mini Kit (Qiagen, Hilden, Germany), and RNA was quantified using a NanoDrop 2000 UV-Vis spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA). To synthesize cDNA, total RNA extracted using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Carlsbad, CA, USA) was reverse transcribed. The synthesized cDNA was amplified using AccuPower PCR Premix (Bioneer, Daejeon, Korea), and gene amplification (Polymerase Chain Reaction) was performed using primers capable of specifically amplifying Nrf-2 and HO-1 genes. (Nrf-2; Forward (5 '->3'): TTCCTCTGCTGCCATTAGTCAGTC, Reverse (5 '->3'): GCTCTTCCATTTCCGAGTCACTG, HO-1; Forward (5 '->3'): CTGGAAGAGGAGATAGAGCGAA, Reverse (5'- > 3 '): TCTTAGCCTCTTCTGTCACCCT,

-actin; Forward (5 '->3'): GCCATGTACGTAGCCATCCA, Reverse (5 '->3'): GAACCGCTCATTGCCGATAG).

-actin을 대조군으로 하고 Image J Software (NIH, Framingham, MA, USA)를 사용하여 수치화 후 비교분석 하였다. RT-PCR을 이용하여 간과 근육조직에서 항산화와 관련된 관련 유전자 Nrf-2, HO-1의 발현양을 측정하였다.The amplified cDNA was electrophoresed on a 1.8% agarose gel, stained with ethidium bromide (EtBr), and the expression level of the target mRNA was measured.

-actin was used as a control and was analyzed after digitization using Image J Software (NIH, Framingham, MA, USA). RT-PCR was used to measure the expression levels of the related genes Nrf-2 and HO-1 in liver and muscle tissue.

As a result, in the group administered with the Example, it was found that the movement performance increased due to the increase in the ability to perform the exercise, and the time until the exhaustion increased (FIG. 1, FIG. 2), and the fatigue-related factors also improved. Could confirm. Specifically, compared to the control (control), it was confirmed that the glucose content in the blood of the group to which the example was administered significantly increased (FIG. 3). As a result of the analysis in the muscle, it was confirmed that the tendency to increase significantly in the case of glycogen, and the trend to decrease significantly in LDH (FIGS. 4A and 4B). It was confirmed that the MDA content of liver tended to decrease significantly compared to the control group (FIG. 5A), and increased significantly for GPx (FIG. 5B).

In addition, as a result of confirming the related factors Nrf-2 and HO-1 by RT-PCR, it was confirmed that it was effective in improving fatigue by significantly increasing in the 500 mg / kg administration group in both liver and muscle (FIGS. 6 and 7). .

In this experiment, the increased HO-1 and Nrf-2 were confirmed by the administration of the Examples. From the results of other antioxidant-related factors, the extract activates Nrf-2 to promote the expression of HO-1, and accordingly , It was confirmed that the factors related to antioxidants, MDA and GPx, also influenced the results.

Claims (10)

Angelica; Peony; And a composition for enhancing fatigue or exercise performance, comprising the extract of the archery or its fraction as an active ingredient. According to claim 1,
The fatigue comprises a muscle fatigue, fatigue recovery or composition for improving exercise performance. According to claim 1,
The extract of Angelica, Peony and Cheongung or its fraction, in order,
1 to 100: 1 to 100: 1 to 100 contained in a weight ratio, fatigue recovery or exercise performance enhancement composition. According to claim 1,
The Angelica, peony and the extract of the archery or a fraction thereof,
Based on the total weight of the composition, contained in 0.001 to 90% by weight, fatigue recovery or composition for improving exercise performance. According to claim 1,
The composition, Nrf-2 (Nuclear factor erythroid 2-related factor-2) to activate the pathway, fatigue recovery or exercise performance enhancement composition. According to claim 1,
The composition, a composition for increasing the expression of HO-1 (heme oxygenase-1), fatigue recovery or exercise performance. According to claim 1,
The extraction solvent of the extract,
A composition comprising water, an organic solvent, or an aqueous solution of an organic solvent, to improve fatigue recovery or exercise performance. The method of claim 7,
The concentration of the organic solvent aqueous solution is 1 ~ 90% (v / v), fatigue recovery or exercise performance enhancement composition. According to claim 1,
The fraction,
A composition for recovering fatigue or enhancing exercise performance, comprising a polysaccharide fraction. The method according to any one of claims 1 to 9,
The composition comprises a food composition or a pharmaceutical composition, fatigue recovery or exercise performance enhancement composition.

Images