KR102188238B1 - Composition for improving fatigue recovery or exercise performance comprising angelica gigas nakai extract, cnidium officinale makino extract and paeonia japonica extract - Google Patents

Abstract

The present specification discloses a composition for recovering from fatigue or improving exercise performance, comprising an extract of Angelicae, Peony and Chungoong or a fraction thereof as an active ingredient. Angelica, an aspect of the present invention; Peony; And the composition comprising the extract or a fraction thereof as an active ingredient, can effectively improve the accumulated fatigue in the body by controlling various factors involved in the enhancement of physical fatigue and/or exercise performance ability, and exercise performance ability Can be enhanced. Specifically, the composition activates the Nrf-2 pathway and, as a result, increases the expression of HO-1, it is possible to effectively control factors related to fatigue. In addition, since the composition contains a natural plant extract or a fraction thereof as an active ingredient, it is completely harmless to the human body and can be used safely.

Description

A composition for recovering from fatigue or improving exercise performance, including angelica extract, cnidium extract, and peony extract {COMPOSITION FOR IMPROVING FATIGUE RECOVERY OR EXERCISE PERFORMANCE COMPRISING ANGELICA GIGAS NAKAI EXTRACT, CNIDIUM OFFICINALE MAKINO EXTRACT AND PAEONIA JAPONICA EXTRACT}

The present specification discloses a composition for recovering from fatigue or improving exercise performance, comprising an extract of Angelicae, Peony and Chungoong or a fraction thereof as an active ingredient.

Fatigue is largely divided into mental and physical fatigue. In general, physical fatigue is a condition in which the force required for muscle contraction activity is not fully exerted or maintained, and the physical or mental capacity is reduced to the extent that it cannot be recovered by rest due to overwork or energy exhaustion. It is defined as the state, the work efficiency, or the state in which the motor performance is reduced. Symptoms of fatigue are known as drowsiness, guidance, exhaustion, drowsiness, decreased concentration, headache, and muscle pain.

The causes of general physical fatigue are known as a lack or inability to use energy sources stored in the body, accumulation of fatigue substances such as free radicals due to metabolism, and loss of homeostasis in the body. In particular, it was found that active oxygen is produced by metabolism, and its occurrence is further increased due to excessive physical activity and excessive mental/physical stress. On the other hand, fatigue is not caused by a single factor, but is often caused by a combination of various factors.

In order to recover from physical fatigue, supply of sufficient energy sources, rest, suppression and removal of fatigue substances in the body are required, but in fact, sufficient nutrition and rest are not achieved in the busy modern society. Therefore, it is necessary to develop a material that can restore or suppress fatigue.

On the other hand, in recent years, the general consumer's reluctance to chemically synthesized drugs is increasing, and the need for the development of herbal medicines using natural products is increasing. Thus, anti-fatigue compositions using natural extracts have been studied, but materials that quickly and effectively improve fatigue have not been developed.

KR 10-1513240 B1

In one aspect, an object of the present invention is to provide a composition having an excellent effect of improving fatigue recovery or enhancing exercise performance.

In one aspect, the object of the present invention is to effectively improve physical fatigue without side effects, or to enhance exercise performance.

In order to achieve the above object, the present invention, in one aspect, Angelica; Peony; And it provides a composition for fatigue recovery or exercise performance enhancement comprising the extract or a fraction thereof as an active ingredient.

Angelica, an aspect of the present invention; Peony; And the composition comprising the extract or a fraction thereof as an active ingredient, physical fatigue and / or by controlling various factors involved in the enhancement of exercise performance can effectively improve the accumulated fatigue in the body. Specifically, the composition activates the Nrf-2 pathway and, as a result, increases the expression of HO-1, it is possible to effectively control factors related to fatigue and/or enhancement of exercise performance. In addition, since the composition contains a natural plant extract or a fraction thereof as an active ingredient, it is completely harmless to the human body and can be used safely.

FIG. 1 is a diagram measuring a movement distance (FIG. 1A) and a movement time (FIG. 1B) of a cylindrical rolling test according to the composition treatment of the present invention.
2 is a diagram showing the time from the forced swimming test to exhaustion according to the composition treatment of the present invention.
3 is a diagram showing a change in blood glucose concentration after a behavioral experiment according to treatment with the composition of the present invention.
4 is a diagram showing changes in the activity and concentration of Glycogen (FIG. 4A) and LDH (FIG. 4B) in muscle tissue after a behavioral experiment according to the composition treatment of the present invention.
5 is a diagram showing changes in the activity and concentration of MDA (FIG. 5A) and GPx (FIG. 5B) in liver tissue after a behavioral experiment according to the composition treatment of the present invention.
6 is a diagram illustrating the expression of genes of Nrf-2 (FIG. 6A) and HO-1 (FIG. 6B) in liver tissue by RT-PCR after the behavioral experiment according to the composition treatment of the present invention.
7 is a diagram illustrating the expression of genes of Nrf-2 (FIG. 7A) and HO-1 (FIG. 7B) in muscle tissue after a behavioral experiment according to the composition treatment of the present invention by RT-PCR.
In FIGS. 1 to 7, 250 mg/kg and 500 mg/kg refer to the dosage of Example 3.

Hereinafter, the present invention will be described in detail.

In one aspect, the present invention, Angelica; Peony; And it is a composition for recovering from fatigue or improving exercise performance, comprising the extract or fractions thereof as an active ingredient.

In the above aspect, the fatigue may include muscle fatigue.

Angelica gigas Nakai, a perennial aromatic grass belonging to the Ranunculus family, is distributed in Korea, China, and Japan. Angelica gigas Nakai, Angelica sinensis (Oliv.) Diels), and Angelica acutiloba are known. Charmdangwi is widely used as a blood pressure agent and anemia treatment because of its excellent blood-blood and activating effects.

Cnidium officinale is a perennial plant in the family Parsley family, and is distributed in Korea and Japan. From ancient times, the root of Chungoong has been used as a soothing, analgesic and tonic.

As used herein, the peony is, it is possible to sense the peony plant, peony plant, peony (Paeonia lactiflora), Paeonia japonica (Paeonia Japonica Miyabe & Takeda), jeokjakyak (Paeonia lactiflora Pall.), No. Peony (Paeonia lactiflora Pall. var. hirta Regel), and Champignon ( Paeonia lactiflora Pall. var. trichocarpa (Bunge) Stern), but may include one or more selected from the group consisting of, but is not limited thereto.

The peony plant is a perennial plant in the dicotyledonous plant peony family, and is used as a treatment for pain relief, abdominal pain, menstrual pain, amenorrhea, hemoemia, anemia, and bruises.

In one aspect, the Angelicae, peony and peony extract or fractions thereof may include each fruit extract or fraction, stem extract or fraction, leaf extract or fraction, or subterranean extract or fraction thereof, and the outpost extract or its Fractions may be included, but preferably each root extract or a fraction thereof.

In the present specification, "extract" includes all substances obtained by extracting components therein from natural products, regardless of the method of extracting or the kind of ingredients. For example, it may mean that a component soluble in a solvent is extracted from a natural product using water or an organic solvent.

The extract or a fraction of the extract may be used as it is, but may be concentrated after filtration and used in the form of an extract, and freeze-dried after concentration and used as a freeze-dried product.

In one aspect, each of the Angelicae, Peony, and Chungoung may be included in a weight ratio of 1-100:1-100:1-100. The extract of Angelicae, Peony and Cnidium cnidium, or fractions thereof, is preferably a weight ratio of 1 to 30: 1 to 30: 1 to 30, more preferably 1 to 10: 1 to 10: 1 to 10, more preferably It may be included in a weight ratio of 1-5:1-5:1-5, more preferably 0.8-1.2: 0.8-1.2: 0.8-1.2 weight ratio, and in one embodiment, a weight ratio of 1: 1: 1. Can be included.

The composition can obtain a remarkably excellent effect compared to the case of including only one plant extract or fraction by using the extract of each plant or its fraction together.

In addition, the composition may exhibit a remarkably excellent fatigue improvement effect or an exercise performance enhancement effect as compared to the case of including plant extracts or fractions thereof other than the angelica, peony, and cnidium.

In one aspect, the extract of Angelicae, Peony, and Cnidium cnidium, or a fraction thereof, may be included in an amount of 0.0001 to 90% by weight, based on the total weight of the composition. Preferably, the extract or its fractions may be included in an amount of 30 to 80% by weight, more preferably 35 to 70% by weight, and more preferably 40 to 65% by weight, based on the total weight of the composition.

In one aspect, the composition may activate the Nuclear factor erythroid 2-related factor-2 (Nrf-2) pathway.

In addition, the composition may increase the expression of HO-1 (heme oxygenase-1).

In the above aspect, the extraction solvent of the extract may include water, an organic solvent, or an aqueous solution of an organic solvent.

When the solvent of the extract is water, it may include a cold water extract or a hot water extract.

The organic solvent is not particularly limited, and C _1-5 lower alcohols such as methanol, ethanol, isopropyl alcohol, n-propyl alcohol, n-butanol and isobutanol, glycerol, ethylene glycol, propylene glycol, 1, Polyhydric alcohols such as 3-butylene glycol, methyl acetate, ethyl acetate, benzene, n-hexane, diethyl ether, dichloromethane, hydrocarbon solvents such as chloroform, and petroleum ether, methyl acetate, benzene, hexane, chloroform, methylene It may be a non-polar organic solvent such as chloride, dimethyl ether, ethyl acetate, or the like.

The concentration of the organic solvent aqueous solution may be 1 to 90% (v/v).

In one aspect, the fraction may include a polysaccharide fraction.

In one embodiment, the composition may include a mixture of the extract and fractions.

When the composition is a mixture of extracts and fractions, the extracts and fractions may be included in a weight ratio of about 40 to 80:20 to 60, preferably 45 to 75: 25 to 55, most preferably 50 to 70: may be included in a weight ratio of 30-50.

In addition, in the same aspect, the fraction, based on the total content of the extract and the fraction, may be included in 10 to 60% by weight, preferably 20 to 50% by weight, more preferably, 25 to 45% by weight It may be included in %, more preferably 30 to 40% by weight.

In one aspect, the composition may effectively improve physical fatigue and/or increase exercise performance by controlling various factors involved in fatigue and/or exercise performance.

For example, the composition may increase movement distance and exercise time as a result of behavioral experiments, and may exhibit an increase in exercise capacity. In addition, the composition may increase the concentration of blood glucose, increase the concentration of glycogen in the muscle, and decrease the concentration of lactate dehydrogenase (LDH). In addition, the composition may reduce the concentration of MDA (malondialdehyde) in the liver, and may increase the concentration of GSH-Px. In addition, the composition may increase the concentration or expression amount of Nuclear factor erythroid 2-related factor-2 (Nrf-2) and Heme oxygenase-1 (HO-1) in liver and muscle.

Specifically, the composition, by activating the Nrf-2 pathway, inhibits reactive oxygen species through promotion of HO-1 activity, decreases MDA and LDH, and increases the activity of GPx, resulting in an antioxidant reaction. It can improve fatigue recovery through

HO-1 is known as a representative cellular defensive phase 2 detoxifying antioxidant enzyme. Induction of HO-1 acts as an important mechanism for various diseases or conditions related to oxidative stress or tissue inflammatory damage. In addition, Nrf-2 is a very important transcription factor in protecting cells against oxidative stress and carcinogenesis, and activates transcription of antioxidant enzymes and phase 2 detoxifying enzymes.

In one aspect, the composition may include a pharmaceutical composition or a food composition.

In addition, the pharmaceutical composition may be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, and sterile injectable solutions according to a conventional method. When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants are usually used. In addition to the active ingredient, such a solid preparation may include at least one excipient, such as starch, calcium carbonate, sucrose, lactose, or gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be included. Liquid preparations for oral use include suspensions, liquid solutions, emulsions, syrups, etc., and various excipients, such as wetting agents, sweeteners, fragrances, preservatives, etc., in addition to water and liquid paraffin, which are commonly used simple diluents, may be included. Formulations for parenteral administration may include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, and freeze-dried formulations. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like may be used as the non-aqueous solvent and suspension.

The dosage of the extract disclosed herein may vary depending on the condition and weight of the patient, the severity of the disease, the form of the drug, the route and duration of administration, and may be selected from a range commonly used in the art. In one aspect, the daily dosage of the active ingredient may be 0.0001 to 1 g/kg based on dry weight.

The food composition may include a health functional food composition, and the health functional food composition includes various foods, beverages, gum, tea, vitamin complexes, health supplement foods, etc., and powders, granules, tablets, capsules or beverages It can be used in phosphorus form. In the food composition of each formulation, in addition to the active ingredients, ingredients commonly used in the field may be appropriately selected and blended by a person skilled in the art according to the formulation or purpose of use without difficulty, and synergistic effects may occur when applied simultaneously with other ingredients.

In one embodiment, the composition may contain other components that can give a synergistic effect to the main effect within a range that does not impair the main effect targeted by the present invention. For example, additives such as fragrances, pigments, disinfectants, antioxidants, preservatives, moisturizers, thickeners, inorganic salts, emulsifiers, and synthetic polymer substances may be further included in order to improve physical properties.

In addition, auxiliary components such as water-soluble vitamins, oil-soluble vitamins, polymer peptides, polymer polysaccharides, and seaweed extract may be further included. The above ingredients may be appropriately selected and blended by a person skilled in the art according to the formulation or purpose of use, and the amount added may be selected within a range not impairing the object and effect of the present invention. For example, the amount of the ingredients added may range from 0.01 to 5% by weight, more specifically from 0.01 to 3% by weight, based on the total weight of the composition.

[Production Example] Preparation of composition

[Production Example 1-1] Preparation of extract

The roots of Angelica Angelica, the root diameter of Chunkyul, and the roots of peony were shaded and minced, mixed with the same weight, and then 10 times of the total weight of each herbal medicine was added (1000ml of distilled water per 100g of herbal medicines) and hot water was extracted for 4 hours . Solid content was removed from the extract, and concentrated under reduced pressure to obtain an extract (Example 1).

[Preparation Example 1-2] Preparation of a polysaccharide fraction

A portion of the extract in Preparation Example 1 was taken, 4 times the volume of 100% ethanol was added and left to stand at 25°C or less for 16 hours, and then the precipitated crude polysaccharide fraction (Example 2) was collected and used. .

[Production Example 1-3] Preparation of the composition

The extract prepared in Preparation Example 1-1 (Example 1) and the crude polysaccharide fraction prepared in Preparation Example 1-2 (Example 2) were mixed in a weight ratio of about 65 to 70: 30 to 35, and a mixture (Example 3 ) Was prepared.

[Experimental Example]

Using the experimental mouse, a cylindrical rolling test (Rotarod test) and a forced swimming test (FST) were performed.

Experimental mice were 6-week-old ICR mice (male), and were used in the experiment after acclimating for 1 week in a sterile breeding device.

[Experimental Example 1] Cylindrical rolling test

The Rotarod test was conducted by pre-training twice during the acclimatization period, and then administering samples (Examples 1 to 3 and positive control creatine) for 3 weeks from the first day after the acclimatization period. I did. Pre-training was carried out while increasing the speed to 4-40 rpm.

After starting the sample administration, 30 minutes after the sample administration, the Rotarod test was performed once a week, and the latency time and the moving distance were measured. In this test, the rotarod cylinder was accelerated at 4-40rpm within 10 minutes to measure the fall latency and moving distance, and the average value was obtained by repeating 3 times.

As a result, it was confirmed that the exercise movement distance and exercise time increased compared to the control group in the group to which the Example was administered, and the exercise performance ability and endurance were increased (FIG. 1). In particular, among the examples, a more excellent effect was confirmed in Example 3, which is a mixture of extracts and fractions.

[Experimental Example 2] Forced Swimming (FST)

After the start of sample administration, 30 minutes after sample administration, forced swimming training (*measurement of time until exhaustion) was performed once a week, and forced swimming exercise was also performed on the day of autopsy. The temperature of the water in which swimming was conducted was 25±5°C, and a weight of 5% of the body weight was added and the average value was obtained by repeating 3 times.

After FST, the time until exhaustion and the change in concentration of factors related to fatigue were measured. Specifically. On the day of the autopsy, a cylindrical rolling test was performed, followed by an FST test, followed by an autopsy immediately, and blood, liver, and gastrocnemius in the hind legs were collected.

* The point at which the mouse's nose sinks below the surface for 5 seconds or more is the point of exhaustion.

[Experimental Example 3] Measurement of factors related to fatigue recovery/exercise performance improvement

After separating the serum from the blood collected from the heart, the concentration of glucose in the serum was measured, the concentrations of Glycogen and Lactate dehydrogenase (LDH) were measured in the muscles, and Malondialdehyde (MDA), Glutathione peroxidase (GSH-Px) in the liver were measured. The concentration of was measured.

[Experimental Example 4] RNA extraction and semi-quantitative RT-PCR

-actin; Forward( 5'->3'):GCCATGTACGTAGCCATCCA, Reverse( 5'->3'):GAACCGCTCATTGCCGATAG). Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany), and RNA was quantified using a NanoDrop 2000 UV-Vis spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA). For cDNA synthesis, total RNA extracted using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Carlsbad, CA, USA) was reverse transcribed. The synthesized cDNA was amplified using AccuPower PCR Premix (Bioneer, Daejeon, Korea), and the gene amplification (Polymerase Chain Reaction) was performed using primers that can specifically amplify the Nrf-2 and HO-1 genes. (Nrf-2; Forward( 5'->3'):TTCCTCTGCTGCCATTAGTCAGTC, Reverse( 5'->3'):GCTCTTCCATTTCCGAGTCACTG, HO-1; Forward( 5'->3'):CTGGAAGAGGAGATAGAGCGAA, Reverse( 5'- >3'):TCTTAGCCTCTTCTGTCACCCT,

-actin; Forward( 5'->3'):GCCATGTACGTAGCCATCCA, Reverse( 5'->3'):GAACCGCTCATTGCCGATAG).

-actin을 대조군으로 하고 Image J Software (NIH, Framingham, MA, USA)를 사용하여 수치화 후 비교분석 하였다. RT-PCR을 이용하여 간과 근육조직에서 항산화와 관련된 관련 유전자 Nrf-2, HO-1의 발현양을 측정하였다.The amplified cDNA was electrophoresed on a 1.8% agarose gel, stained with ethidium bromide (EtBr), and then the expression level of the target mRNA was measured.

-actin was used as a control, and numerically analyzed using Image J Software (NIH, Framingham, MA, USA). RT-PCR was used to measure the expression levels of antioxidant-related genes Nrf-2 and HO-1 in liver and muscle tissue.

As a result, in the case of the group to which the Example was administered, it was found that the exercise performance increased, the movement distance during exercise increased, and the time until exhaustion was increased (Figs. 1 and 2), and the fatigue-related factors were also improved. Could be confirmed. Specifically, compared to the control group, it was confirmed that the glucose content in the blood of the group to which the Example was administered was significantly increased (FIG. 3). As a result of the analysis in the muscles, a tendency to increase significantly in the case of glycogen was confirmed, and a tendency to decrease significantly in LDH was confirmed (FIGS. 4A, 4B). It was confirmed that the liver MDA content significantly decreased compared to the control group (FIG. 5A) and significantly increased in the case of GPx (FIG. 5B).

In addition, as a result of confirming the related factors Nrf-2 and HO-1 by RT-PCR, it was confirmed that there was a significant increase in the 500 mg/kg administration group in both liver and muscle, thereby having an effect on improving fatigue (FIGS. 6 and 7). .

In this experiment, HO-1 and Nrf-2 increased by the administration of the examples could be identified, and from the results of other antioxidant-related factors, this extract activated Nrf-2 to promote the expression of HO-1, and accordingly , It was confirmed that the antioxidant-related factors, MDA and GPx, also affected the results.

Claims (10)

delete As a food composition for recovering from fatigue or improving exercise performance,
The composition is composed of a hot water extract and an ethanol polysaccharide fraction thereof in which the active ingredient is angelica, peony and cnidium in a weight ratio of 1:1:
The hot water extract and the ethanol polysaccharide fraction is a weight ratio of 65:35,
The composition is a food composition for fatigue recovery or exercise performance enhancement comprising one or more of the following characteristics:
i) increased glucose;
ii) increased glycogen;
iii) lactate dehydrogenase (LDH) reduction;
iv) reduction of malondialdehyde (MDA);
v) increased GPx (Glutathione Peroxidase);
vi) increased Nuclear factor erythroid 2-related factor-2 (Nrf-2); And
vii) Increased expression of heme oxygenase-1 (HO-1). The method of claim 2,
The fatigue is a food composition for improving fatigue recovery or exercise performance, including muscle fatigue. delete The method of claim 2,
The hot water extract and the ethanol polysaccharide fraction of the angelica, peony and cnidium in a weight ratio of 1:1:1,
Based on the total weight of the composition, containing 0.001 to 90% by weight, fatigue recovery or exercise performance improvement food composition. The method of claim 2,
The composition is a food composition for activating the Nrf-2 (Nuclear factor erythroid 2-related factor-2) pathway, recovering from fatigue or improving exercise performance. delete delete delete delete

Images