KR101225486B1 - Pharmaceutical compositions comprising extract from smilax china linne for preventing or treating obesity hyperlipidemia or fatty liver - Google Patents

Abstract

PURPOSE: A pharmaceutical composition containing a Smilax china Linne extract is provided to reduce body fat and fat and visceral fat and to prevent or treat obesity. CONSTITUTION: A pharmaceutical composition for preventing or treating obesity contains a Smilax china Linne extract as an active ingredient. The Smilax china Linne extract is prepared from Smilax china Linne stems or leaves. The composition reduces liver fat or visceral fat. The fat includes neutral lipid, cholesterol, or free fatty acid. The visceral fat includes epididymal fat, or mesenteric fat. The composition reduces the expression of LXRalpha(liver X receptor alpha), SREBP1-C(sterol response element binding protein), CD36(fatty acid translocase) or aP2(fatty acid binding protein). A food composition for treating or relieving obesity contains the extract as an active ingredient.

Description

Pharmaceutical Compositions Comprising Extract from Smilax China Linne for Preventing or Treating Obesity Hyperlipidemia or Fatty Liver}

The present invention relates to a pharmaceutical composition for the prevention or treatment of obesity, hyperlipidemia or fatty liver comprising the Tobokyeong extract as an active ingredient.

The World Health Organization has warned that over 1 billion overweight obese people (BMIs above 30) will mass produce serious health problems, reaching 50 billion people in 2015, up 50% (September 22, 2005). Obesity is a cause of various diseases, with 80% of diabetics and 21% of heart diseases being caused by obesity, and the socioeconomic loss from obesity is huge [about US $ 116 billion annually in the United States; In Korea, it increased from 1.1.7 trillion won in 2001 to 1.8 trillion won in 2005. Therefore, the development of safe and effective treatment for obesity can reduce the enormous socioeconomic loss. However, medicines that can solve the market situation are limited to appetite suppressants and fat absorption inhibitors, which are not as expected, and there are various side effects shown below. Xenical (Roche) induces the inhibition of lipase secreted by the pancreas and digestive system to inhibit fat absorption, accompanied by low weight loss of 2-3% and side effects such as frequent diarrhea and fatty stools. In addition, reductil (Abbott) suppresses appetite by suppressing resorption of serotonin and noradrenaline, which has a 5-10% weight loss effect but has side effects of cardiovascular diseases such as stroke and myocardial infarction. (EMA) and the US Food and Drug Administration (FDA) exited the market with prescriptions, suspensions and voluntary recall recommendations, and were discontinued by the Food and Drug Administration in October 2010 in Korea. In addition, many anti-obesity products have been banned due to serious side effects. For example, aminophylline has been reported to have a wide range of adverse effects on the mental nervous system, circulatory system, and digestive system in spite of the excellent body fat decomposition effect, and penfluramine, dexfenfluramine, topirameye, ephedrine, And sales were prohibited. As such, the value of natural medicines is newly emerging due to the limitations of western medicine due to the side effects of synthetic drugs and the overcoming of chronic diseases.

Non-alcoholic fatty liver disease (NAFLD) refers to a disease in which triglycerides accumulate in the liver regardless of drinking, and include steatosis and non-alcoholic steatohepatitis (NFLD). NASH). Simple fatty liver is thought to be a benign benign disease with good clinical prognosis. However, NASH with inflammation or fibrosis with fatty liver is a progressive liver disease and is recognized as a disease causing cirrhosis or liver cancer.

Obesity and insulin resistance are risk factors for representative nonalcoholic fatty liver disease. Risk factors for progression of hepatic fibrosis include obesity (BMI> 30), blood liver function index (AST / ALT> 1) and diabetes, especially if hepatitis C carriers are non-alcoholic fatty liver. The need for prevention and treatment is emerging. 69-100% of nonalcoholic fatty liver patients are obese, 20-40% of obese patients are accompanied by nonalcoholic fatty liver, and in particular, the prevalence of liver disease in male obese patients is higher than that of female obese. In Western society, 3-30% of normal weight adults as well as obese patients are reported to have non-alcoholic fatty liver disease. The prevalence of non-alcoholic fatty liver in Japan, which is similar to ours, is estimated at 20%, of which 1% is estimated to be NASH. Non-alcoholic fatty liver is a problem not only in adults but also in obese children. 10-77% of obese children (residents in Europe, the United States and Asia) develop non-alcoholic fatty liver lesions because obesity is the most important risk factor for non-alcoholic liver disease.

The causes of non-alcoholic fatty liver can be explained by two mechanisms. The first is that the increase in free fatty acids inhibits fatty acid oxidation in hepatocytes, causing fatty acids to accumulate in the hepatocytes, and the second mechanism is known to be caused by all the mechanisms of action associated with inflammation and fibrosis progression. In other words, the increase of fatty acid increases the expression of cytochrome peroxidase 2E1 (CYP2E1), and produces free radicals, leading to lipid peroxidation of hepatocellular membranes, and the increase of LPS and oxidative stress leads to TNF-α. Increase to induce apoptosis of hepatocytes and progress liver damage. Insulin resistance and fatty acid accumulation lead to mitochondrial dysfunction, the latter increasing reactive oxygen species and nitric oxide synthase (NOS), resulting in cell death.

The best way to treat NAFDL is to lose weight through lifestyle changes (typically exercise). However, if exercise alone is difficult to cure, treatment with drugs may be selected in parallel, and the therapeutic agents used for non-alcoholic fatty liver patients so far are classified into two concepts. The first is to improve the fatty liver by correcting risk factors such as obesity treatment (Zenical), insulin resistance treatment (Metformin, pioglitazone, rosiglitazone), hyperlipidemia treatment (clofibrate, gemfibrozil, bezafibrate, atorvastatin, simvastatin) Drugs that treat and improve it belong here. That is, metformin increases the oxidation of fatty acids, decreases fat-forming enzymes, and has the effect of improving insulinemia and insulin resistance. On the other hand, chiazolidinedione, rosiglitazone and pioglitazone activate PPARγ, a nuclear hormone receptor, to promote sugar absorption in muscle. The second type of treatment is a drug that repairs hepatocellular damage independent of risk factor correction for non-alcoholic fatty liver. Hepatoprotective agents (ursodioxycholic acid and taurine), antioxidants (vitamins E and C) and nutrition Supplements (lecithin, betaine, N-acetylcysteine), etc. belong to this, but to date, there is no ideal drug that is effective in treatment without side effects.

According to the Korean herbal medicine specification, Tobok-Ryeong is a stem root plant belonging to Liliaceae , and its scientific name is Smilax. china Linne . Tobok-ryeong is a blue vine, a mango tree, a persimmon tree, an oak tree, a cactus vine, a barbed thorn, a mountain ear, a persimmon, a hooked bag, a crab bag, a bell, a betel nut, a persimmon tree, a blacktail, a blueberry bush, a rebellion Also known as the various tinnitus. Tobok-ryeong is native to Japan, China, and Korea. The area of Tobok-ryeong, which has been used as a herbal medicine, is root, 5-15 cm in length and 2-5 cm in diameter, uneven in shape, and sometimes has a knot-shaped cylinder. The outer side is grayish yellowish brown, and the upper side protrudes in several places. Tobokyeong's roots have little smell and taste.

Tobok-ryeong has traditionally been known to have the effects of gongupup, diuresis, detoxification and swelling, joint pain, horseshoe, tree species, enteritis, dysentery, lymphadenitis, red baekdaedae, syphilis It has been used as a therapeutic agent for carcinoma. The pharmacological effects of Tobok-ryeong scientifically proven so far include anti-diabetic, anti-inflammatory, antioxidant, and anti-cancer effects. It has been reported that the administration of Tobok-Ryong extract reduced the fasting blood glucose levels in albino rats induced by diabetes with aloxane (Rajesh Bhatii., Et al, Asian Journal of Traditional Medicines , 6: 218-223 (2011). Tobok-Ryung extract has also been shown to exhibit anti-inflammatory activity by reducing cyclooxygenase 2 activity and inhibiting PGE2 accumulation in macrophage cells induced by LPS (Xiao-Shun Shu., Et al. Journal of Ethnopharmacology 103: 327-332 (2006)), has been reported to be effective as an antioxidant for removing reactive oxygen species (Lee SE., Et al. Exp Mol Med . 33: 263-268 (2001). In addition, anticancer activity of Tobok-Ryong extract has been confirmed in breast cancer cell line (MCF-7) (Li-Sheng Wu., Et al. Journal of Ethnopharmacology . 130: 460-464 (2010). The active substances contained in Tobok-ryeong are known as silax saponin, prosapogenin A, diosin, gracillin, pseudoprotodiocin, methylgracillin, methylprotodiocin and the like (Kim, SW et al. 20: 145-146 (1989), Sashida, Y. et al, Phytochemistry 31: 2439-2443 (1992).

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have made diligent research to effectively prevent or treat obesity, hyperlipidemia or fatty liver, and to develop substances that are safe for the human body, especially plant-derived substances. The present invention has been completed by discovering that it is very effective in preventing or treating.

Accordingly, an object of the present invention to provide a pharmaceutical composition for the prevention or treatment of metabolic diseases selected from the group consisting of obesity, hyperlipidemia and fatty liver comprising the extract of Tobokyeong as an active ingredient.

Another object of the present invention is to provide a food composition for improving or alleviating metabolic diseases selected from the group consisting of obesity, hyperlipidemia and fatty liver comprising the extract of Tobokyeong as an active ingredient.

Other objects and advantages of the present invention will become apparent from the following detailed description and claims.

According to one aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating metabolic diseases selected from the group consisting of obesity, hyperlipidemia and fatty liver comprising the extract of Tobokyeong as an active ingredient.

The present inventors have made diligent research to effectively prevent or treat obesity, hyperlipidemia or fatty liver, and to develop substances that are safe for the human body, especially plant-derived substances. It has been found to be very effective in preventing or treating.

The compositions of the present invention act very effectively in the prevention or treatment of obesity, hyperlipidemia or fatty liver.

According to the present invention, when ingesting a high fat diet containing the Tobokyeong extract, the concentration of plasma lipids such as visceral fat mass, triglyceride concentration, total cholesterol concentration, free fatty acid concentration, and the like decreased than when only high fat control diet In addition, changes in lipid concentrations and liver function levels in liver tissues were found to have significant effects.

According to the present invention, Tobok-Ryung extract is effective in relieving obesity induced by a high fat diet by causing a decrease in weight and visceral fat, plasma triglycerides, total cholesterol, free fatty acid concentrations and hepatic triglycerides. Exert. In addition, by reducing the expression of nuclear transcription factors and their target genes, which have been increased in liver tissue by high-fat diets, it significantly improves fatty liver by inhibiting fat production in liver tissue.

Tobokyeong used as an active ingredient in the composition of the present invention means a stem root plant belonging to Liliaceae .

When the Tobokyeong extract used in the composition of the present invention is obtained by treating the extraction solvent to Tobokyeong, various extraction solvents may be used. Preferably, a polar solvent or a nonpolar solvent can be used. Suitable polar solvents include (i) water, (ii) alcohols (preferably methanol, ethanol, propanol, butanol, normal-propanol, iso-propanol, normal-butanol, 1-pentanol, 2-butoxyethanol Or ethylene glycol), (iii) acetic acid, (iv) dimethyl-formamide (DMFO) and (v) dimethyl sulfoxide (DMSO). Suitable as nonpolar solvents are acetone, acetonitrile, ethyl acetate, methyl acetate, fluoroalkane, pentane, hexane, 2,2,4-trimethylpentane, decane, cyclohexane, cyclopentane, diisobutylene, 1- Pentene, 1-chlorobutane, 1-chloropentane, o -xylene, diisopropyl ether, 2-chloropropane, toluene, 1-chloropropane, chlorobenzene, benzene, diethyl ether, diethyl sulfide, chloroform, dichloro Methane, 1,2-dichloroethane, anneal, diethylamine, ether, carbon tetrachloride and THF.

More preferably, the extraction solvent used in the present invention is (a) water, (b) anhydrous or hydrous lower alcohol having 1 to 4 carbon atoms (methanol, ethanol, propanol, butanol, etc.), (c) the lower alcohol and water Mixed solvent with (d) acetone, (e) ethyl acetate, (f) chloroform, (g) butyl acetate, (h) 1,3-butylene glycol, (i) hexane and (j) diethyl ether Include. Most preferably, the extract of the present invention is obtained by treatment of water, methanol, ethanol or a combination thereof with Tobok-ryeong.

As used herein, the term "extract" has the meaning commonly used as a crude extract in the art as described above, but also broadly includes a fraction additionally fractionating the extract. That is, the Tobok-Ryung extract includes not only those obtained by using the aforementioned extraction solvent, but also those obtained by additionally applying a purification process thereto. For example, fractions obtained by passing the extract through an ultrafiltration membrane having a constant molecular weight cut-off value, separation by various chromatography (manufactured for separation according to size, charge, hydrophobicity or affinity), etc. The fraction obtained through the purification method is also included in the Tobokyeong extract of the present invention.

Tobokyeong extract used in the present invention may be prepared in a powder state by an additional process such as distillation under reduced pressure and freeze drying or spray drying.

The Tobok-ryeong extract used in the present invention is preferably Tobok-Ryeong stem extract or Tobok-Ryeong leaf extract, and more preferably Tobok-Ryeong stem extract.

As used herein, the term “obesity” refers to excessive accumulation of body fat in the body, and the term “fatty liver” refers to a condition in which excess fat is accumulated in liver cells due to hepatic fat metabolism disorder, which is angina pectoris, myocardial infarction. , Stroke, arteriosclerosis and pancreatitis.

As used herein, the term "hyperlipidemia" refers to a disease caused by a large amount of fat in the blood due to poor metabolism of triglycerides and cholesterol. More specifically, hyperlipidemia includes hypercholesterolemia or hypertriglyceridemia with high incidence with increased lipid components such as triglycerides, LDL cholesterol, phospholipids and free fatty acids in the blood.

As used herein, the term “non-alcoholic fatty liver” refers to similar liver dysfunction and tissue damage seen in alcoholic liver disease in non-alcoholic patients, and more particularly in liver fat accumulation in non-alcoholic patients. This is about 5-10% of the liver weight.

As used herein, the term “metabolic disease” is a conceptualization of a group of cardiovascular disease and type 2 diabetes risk factors clustered together into one disease group, which includes insulin resistance and various complex metabolic disorders and clinical trials. It is a concept that encompasses all aspects. In 1988, Reaven insisted that the common cause of these symptoms was insulin resistance in the body, which is poorly insulin-induced, and called it insulin resistance syndrome. In 1998, the World Health Organization (WHO) explained that insulin resistance accounts for all of these symptoms. The term metabolic syndrome or metabolic disease was introduced.

According to a preferred embodiment of the present invention, the composition of the present invention reduces liver fat or visceral fat.

As used herein, the terms "liver" and "intestine" include cells or tissues, respectively.

According to the present invention, the composition intake group of the present invention significantly reduced the lipid concentration of blood and liver tissues compared to the high fat diet (HFD) control group, the total visceral fat weight was significantly reduced by 38%.

According to a more preferred embodiment of the invention, the fat of the invention comprises triglycerides, cholesterol and free fatty acids.

According to a more preferred embodiment of the present invention, the visceral fat of the present invention comprises one or more fats selected from epididymal fat, peripheral kidney fat, mesenteric fat and celiac fat.

According to a preferred embodiment of the present invention, the composition of the present invention reduces the amount of ALT (alanine aminotransferase) and AST (aspartate aminotransferase) in the blood.

In the present invention, the terms “ALT (alanine aminotransferase)” and “AST (aspartate aminotransferase)” are enzymes that increase levels in the blood, respectively, when the liver is damaged.

As used herein, the term “reduction of (amount of ALT and AST)” means that the amount of ALT and AST has been significantly reduced compared to a subject (control) not receiving the composition of the present invention, preferably 30% It means reduced more than, more preferably 20% or more reduced, even more preferably 10% or more reduced.

According to the present invention, the composition of the present invention significantly lowers the activity of ALT and AST in the blood by 22% and 38%, respectively, than the high-fat diet, thereby significantly alleviating fatty liver, more preferably non-alcoholic fatty liver phenomenon, It was confirmed to have an effect of improving. Therefore, the composition of the present invention has the effect of significantly improving the fatty liver which ultimately appears in high fat diet induced obesity.

According to a preferred embodiment of the present invention, the composition of the present invention increases the amount of adiponectin and the phosphorylation of AMP-activated protein kinase (AMPK) in the blood. Adiponectin is an adipokine secreted from adipocytes. Increased blood levels increase AMPK phosphorylation and decrease the expression of LXRα and SREBP1-C, the major transcription factors that promote fat production, and their target genes, CD36 and aP2. Let's do it.

As used herein, the term "increase (in the amount of adiponectin) in blood" means that the amount of adiponectin in the blood is measurably increased compared to a subject (control) not receiving the composition of the present invention, preferably 40% It means more than that, more preferably 10% or more.

As used herein, the term “increasing (AMPK phosphorylation)” means that the phosphorylation of AMPK is significantly increased in a measurable relative to a subject (control) not receiving the composition of the present invention, and preferably increased by 40% or more. It means more preferably 10% or more.

According to a preferred embodiment of the present invention, the composition of the present invention is characterized by the expression of Liver X receptor α (LXRα), Terre response element binding protein (SREBP1-C), Fatty acid translocase (CD36) or fatty acid binding protein (aP2) Decrease. The composition of the present invention has been shown to reduce the expression of LXRα and SREBP1-C and ultimately reduce the expression of its target genes CD36 and aP2, thereby improving the apoptosis of liver tissue.

When the composition of the present invention is manufactured from a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers included in the pharmaceutical compositions of the present invention are those commonly used in the preparation, such as lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like It doesn't happen. In addition to the above components, the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19 th ed., 1995).

The pharmaceutical composition of the present invention may be administered orally or parenterally, and preferably applied by oral administration.

The appropriate dosage of the pharmaceutical composition of the present invention may vary depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate, . Preferred dosages of the pharmaceutical compositions of the invention are in the range of 0.001-100 mg / kg on an adult basis.

The pharmaceutical compositions of the present invention may be prepared in unit dose form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container. The formulation may be in the form of solutions, suspensions, syrups or emulsions in oils or aqueous media, or may be in the form of extracts, powders, powders, granules, tablets or capsules, and may further comprise dispersants or stabilizers.

According to another aspect of the present invention, the present invention provides a food composition for improving or alleviating metabolic diseases selected from the group consisting of obesity, hyperlipidemia and fatty liver comprising the extract of Tobokyeong as an active ingredient.

When the composition of the present invention is prepared as a food composition, as an active ingredient, as well as the Tobokyeong extract, as well as ingredients commonly added during food production, for example, proteins, carbohydrates, fats, nutrients, seasonings and Contains flavors. Examples of the above-mentioned carbohydrates are monosaccharides such as glucose, fructose, and the like; Dissaccharides such as maltose, sucrose, oligosaccharides and the like; And sugars such as conventional sugars such as polysaccharides such as dextrin, cyclodextrin and the like and xylitol, sorbitol, erythritol. As the flavoring agent, natural flavoring agents [tauumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used.

For example, when the food composition of the present invention is prepared with a drink, the citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, tofu extract, jujube extract or licorice extract in addition to the Tobokyeong extract, which is the active ingredient of the present invention It can be included as.

The features and advantages of the present invention are summarized as follows:

(Iii) The present invention provides a pharmaceutical composition for the prevention or treatment of metabolic diseases selected from the group consisting of obesity, hyperlipidemia and fatty liver comprising the extract of Tobokyeong as an active ingredient.

(Ii) The composition of the present invention is a decrease in the amount of expression of LXRα and SREBP1-C, and the target genes, CD36 and aP2 genes, which are nuclear transcription factors that play an important role in the reduction of body fat, visceral fat, and adipose tissue production. Resulting in a prophylactic or therapeutic effect of obesity.

(Iii) The composition of the present invention exhibits the effect of improving lipid accumulation in liver tissue by reducing lipid content present in liver tissue, thereby preventing the progression of fat liver, inhibiting progression or improving the disease state.

(Iii) The present invention also provides a food composition for improving or alleviating metabolic diseases selected from the group consisting of obesity, hyperlipidemia and fatty liver comprising the extract of Tobok-ryeong as an active ingredient.

1 is a graph showing the change in weight gain (g), the total cumulative weight gain (g / 56 days) and the daily dietary intake (g / day) for 8 weeks according to the breeding period of the mice fed the experimental diet.
Figure 2 is a diagram showing the weight of the visceral fat (g) for each part of the mouse ingested experimental diet.
Figure 3 is a diagram showing the lipid and glucose concentration of the mouse blood intake of the experimental diet.
4 is a diagram showing the measurement results of non-alcoholic fatty liver-related indicators in mice fed the experimental diet.
5 is a graph showing changes in the expression of genes and proteins related to adiponectin concentration and fat production in liver tissue of mouse blood.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Example 1 Preparation of Tobok Ryong Extract

1 kg of stalks of Similac china Linne were made into powder in a grinder, and 6 L of alcohol (90% ethanol) was added and extracted three times in a reflux extractor. The Tobokyeong stem extract was filtered through filter paper, and then concentrated at low temperature in a reduced pressure concentrator, and then used for freezing and drying to obtain 80.8 g (yield 8.08%) of the extract. 100 g of Tobok-ryeong leaves were made into powder in a grinder, and 6 L of spirits (90% ethanol) was added and extracted three times in a reflux extractor. The Tobokyeong leaf extract was filtered through filter paper, and then concentrated at low temperature in a vacuum concentrator, and then used to freeze-dryer to obtain X 18.3 g (yield 18.3%) was used in the experiment.

Example  2: Tobok Spirit  Body weight and visceral fat reduction effect of extract

Experimental diet preparation and breeding of laboratory animals

The obesity induction diet used in this experiment was a high fat diet (HFD: 40% fat calorie, 17 g Laad + 3% corn oil / 100 g diet) and supplemented with the bokbanyeong stem extract ( Similac). China L. stalk extract-supplemented diet (T1D) had the same composition as HFD but contained 0.4% of Tobokyeong stem extract. The diet supplemented with leaf extracts of the Bokryokyeong ( Similac china L. leaf extract-supplemented diet (T2D)) had the same composition as the HFD but contained 0.4% of the Bokryokyeong leaf extract. The Chow fed a commercial rodent feed (Table 1).

Five-week-old male C57BL / 6J mice (Orient, Korea) were adapted to the laboratory environment for one week with solid feed, and then randomly placed into the high fat diet control group and the experimental group according to the egg mass method, and reared for a total of eight weeks. The diet was fed daily with water between 10 and 11 am, the dietary intake was measured daily and the body weight was measured weekly. Body weight was measured 2 hours after removing the feed container to prevent sudden weight change due to feed intake. After fasting the test animals for 12 hours or more, blood, liver, and visceral fat tissue (diplasia, perirenal fat, mesenteric fat, and abdominal fat) were collected under anesthesia with diethyl ether and 0.1 M phosphate buffer solution (pH 7.4), and then weighed. Blood collected from the abdominal aorta was centrifuged at 1000 xg for 15 minutes to separate plasma.

Experimental composition table ingredient High fat control diet
(HFD) (g / kg diet) Tobok-Ryung Stem Extract Supplement (T1D)
(g / kg diet) Tobokyeong Leaf Extract Supplement (T2D)
(g / kg diet) Casein 200 200 200 DL-methionine 3 3 3 Corn starch 111 107 107 Sucrose 370 370 370 cellulose 50 50 50 Corn oil 30 30 30 Laad 170 170 170 Vitamin complex 12 12 12 Mineral complex 42 42 42 Choline Bitartrate 2 2 2 cholesterol 10 10 10 Tert-butyhydroquinone 0.04 0.04 0.04 Tobokyeong Stem Extract - 4 - Tobokyeong Leaf Extract - - 4 Total (g) 1,000 1,000 1,000 Fat (% calories) 39.0 39.0 39.0 Total calories, kJ / kg diet 19,315 19,315 19,315

Body weight and visceral fat weight change

The final weight and cumulative weight gain (g / 8 weeks) after ingestion of the experimental diet for 8 weeks were 22% of the final body weight in the T1D group supplemented with the bokbunyeong stem extract compared to the high-fat diet control group (HFD). , And cumulative weight gain significantly decreased by 40%, and cumulative weight gain was significantly reduced by 25% in the group supplemented with Tobokyeong leaf extract (T2D). Ingestion of Rhobok-ryeong stem extract and Rhobok-ryeong leaf extract did not result in a change in dietary intake, and the food efficiency ratio obtained by dividing the total weight gain during the feeding period by the experimental dietary intake was T1D and T2D groups. Significantly decreased compared to the HFD group (Fig. 1). Therefore, Tobokyeong stem and leaf extract has a weight loss effect, in particular, it can be seen that the weight loss effect of Tobokyeong stem extract is more excellent than the leaf extract. In addition, it can be seen that the weight loss effect of the Tobok-ryong extract is not due to appetite suppression.

After ingesting the experimental diet for 8 weeks, the weights of the epididymal fat, the surrounding kidney fat, the mesenteric fat, and the celiac fat, which constitute visceral fat, were measured. The total visceral fat weight of these four sites was significantly reduced by 32% in the Tobok-Ryeong stem extract group (T1D) compared to the high fat diet control group (HFD) and 16 in the Tobok-Ryung leaf extract group (T2D). % Significantly decreased ( P <0.001) (FIG. 2). Therefore, Tobokyeong stem extract was found to have a very excellent weight and visceral fat reduction effect.

Example  3: Tobok Spirit  Hyperlipidemia of the extract and Non-Alcoholic Fatty Liver  Improving efficacy

Blood and Liver tissue  Biochemical Analysis Method

Plasma total cholesterol, triglycerides, glucose concentration, and lipid components of liver tissues were measured in experimental animals reared for 8 weeks. Plasma total cholesterol, triglycerides, free fatty acids and glucose concentrations were measured twice each using a commercial clinical kit. The amount of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) used as a liver function index was measured using a commercial assay kit (Bio Clinical System, Korea).

Lipid component of liver tissue was analyzed by Folch et al. (Folch J et al., J Biol Chem . 226: 497-509 (1957)). 1 mL of distilled water was added to 0.25 g of liver tissue, followed by homogenization using a polytron homogenizer. 5 mL of chloroform: methanol solution (2: 1, v / v) was added to the homogeneous solution, mixed well, and the lower layer was separated by centrifugation at 1000 xg for 10 minutes, and the chloroform: methanol solution (2: 1, v / v) 2 mL was added, and the same procedure was repeated to completely separate the liver lipid components. 3 mL of chloroform: methanol: 0.05% CaCl ₂ (3:48:47, v / v / v) solution was added to the lower layer solution, mixed for 1 minute, and centrifuged at 1000 xg for 10 minutes. After completely drying with nitrogen gas, the dried lipid was dissolved in 1 mL of methanol and used for lipid component analysis. Triglyceride, cholesterol and free fatty acid concentrations of hepatic lipid extracts were measured using the same commercial lipid analysis kit (Bio Clinical System, Korea) used for the analysis of plasma.

Changes in Blood Biochemical Indicators

Plasma lipid concentrations of mice fed the experimental diet for 8 weeks showed 36% total cholesterol, 41% triglyceride, and glass in the Tobok-Ryung stem extract group (T1D) compared to the high-fat diet control group (HFD). Fatty acid concentrations were significantly reduced by 45% (Fig. 3). In addition, supplementation of Tobok-Ryeong stem extract to mice fed high-fat diet significantly reduced fasting blood glucose by 40% compared to HFD group. Therefore, Tobokyeong extract can be found to significantly reduce the hyperlipidemia in high fat diet-induced obesity, and lower the fasting blood sugar.

Non-Alcoholic Fatty Liver  Change in relevant indicators

Liver weights measured after 8 weeks of ingestion in mice were compared to 22% in the Tobok-Ryung Stem extract group (T1D) and 20% in the Tobok-Ryung leaf extract group (T2D) compared to the high-fat diet control group (HFD). Each decreased significantly. The lipid concentration of liver tissue was significantly decreased in T1D group compared to HFD group in 47% of neutral fat, 71% of cholesterol and 69% of free fatty acid (Fig. 4). Plasma alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities, which are indicators of liver function, were significantly decreased by 22% and 38% in the T1D group compared to the HFD group, respectively (Figure 4). . Therefore, Tobokyeong stem extract can be seen that the long-term high fat diet significantly reduces the fatty liver phenomenon induced by ingestion.

Example  4: Tobok Spirit  Mouse by Stem Extract Liver tissue  Inhibitory Effect on Lipid Biosynthesis-related Genes and Proteins

Blood Adiponectin  Concentration measurement

Blood adiponectin concentrations were measured using a commercial kit (Millipore, Mass., USA). 1X assay buffer and plasma samples were placed in 96 wells, and treated with a detection antibody and reacted at room temperature for 2 hours. After removing the solution in each well, it was washed five times using the wash buffer. Enzyme solution was added to each well and reacted at room temperature for 30 minutes, and then washed five times using a washing buffer. After adding the substrate solution and reacting at room temperature for 20 minutes, the reaction solution was added to stop the reaction. The final reaction product was measured using a spectrometer (450 nm).

RNA  Disconnect and check

Tissue was ground by adding 1 mL of trizol solution per 0.1 g of epididymal adipose tissue, and then centrifuged at 12,000 × g for 10 minutes at 4 ° C. The supernatant was transferred to a new tube and 200 μl of chloroform was added and vortexed. This procedure was repeated twice, after which the supernatant was transferred to a new tube and isopropanol and supernatant were added at a 1: 1 ratio. After shaking vigorously 10 times and left for 10 minutes at room temperature, centrifuged at 12,000 × g and 4 ° C for 10 minutes, the supernatant was removed, and 1 mL of 70% ethanol was added to the remaining precipitate at 7,500 × g, 4 ° C. Centrifuge for 5 minutes. After removing the ethanol, the tube containing the RNA precipitate was dried at room temperature for 5 minutes, and the RNA pellet was dissolved using water without nucleic acid hydrolase. The concentration of RNA samples extracted at 260 nm and 280 nm wavelengths was measured using a UV / VIS spectrometer (Beckman coulter, DU730), and agarose gel electrophoresis was performed to confirm the purity of the RNA samples.

RT - PCR ( reverse transcription - 중합체 chain reaction ) result

CDNA was synthesized by reverse transcription using oligo dT primer and reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA) on RNA samples extracted from epididymal adipose tissue. PCR was performed using the cDNA obtained through reverse transcription as a template and the 5 'and 3' flanking sequences of the gene cDNA to be amplified as a primer, and the primer sequences used are shown in Table 2. 1 μl of the amplified PCR product was electrophoresed on 1% agarose gel to confirm DNA bands.

Primer Sequences Used for RT-PCT gene primer Sequence (5 '→ 3') Annealing Temperature (℃) PCR product (bp) Fatty acid binding protein (aP2) F AGCATCATAACCCTAGATGG 55 128 R GAAGTCACGCCTTTCATAAC Sterol Response Element Binding Protein (SREBP1-c) F ATCGCAAACAAGCTGACCTG 55 115 R AGATCCAGGTTTGAGGTGGG Fatty Acid Transport Protein (CD36) F ATGACGTGGCAAAGAACAGC 55 160 R GAAGGCTCAAAGATGCCTCC Liver X Receptor α (LXRα) F TCCTACACGAGGATCAAGCG 55 119 R AGTCGCAATGCAAAGACCTG Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) F AGAACATCATCCCTGCATCC 55 321 R TCCACCACCCTGTTGCTGTA

Western Blot  Analysis method

In the mortar, a certain amount of liver tissue was homogenized with liquid nitrogen and cell lysis buffer, and then the tissue solution was transferred to a new tube and vortexed. After centrifugation at 13,000 rpm and 4 ° C for 20 minutes, the middle layer was taken and protein was quantified by the Bradford method. 50 μg of protein was electrophoresed on SDS polyacrylamide gel and immunoblotted onto PVDF hyper film. Reaction was carried out using a corresponding antibody to the protein [AMPK (AMP-activated protein kinase) and phospho AMPK (Thr172), Cell Signaling Technology, MA, USA], and detected by ECL to evaluate the specific protein amount.

Blood Adiponectin  Concentration change

Plasma adiponectin was performed in the plasma of mice fed diet (T1D) supplemented with normal diet (Chow), high-fat diet (HFD), and high-fat diet with 0.4% Tobok-Ryung stem extract for 8 weeks. The concentration of was significantly decreased in the HFD group compared to the normal diet group, while in the T1D group was significantly increased compared to the HFD group (Fig. 5).

Liver tissue  Gene production-related gene expression and AMPK  Phosphorylation change

Adiponectin in the blood is adiponkin secreted from adipocytes, and the increase in blood adiponectin concentration increases the phosphorylation of AMPK (AMP-activated protein kinase) by binding to adiponectin receptors in liver tissue. Activated AMPK inhibits phosphorylation of S6 kinase 1 (S6K1) via a mammalian target of rapamycin (mTOR), resulting in major transcription factors LXRα and SREBP1-C and their target genes, CD36 and It is known to improve the fat production of liver tissue by reducing the mRNA expression of aP2.

In the present invention, under the hypothesis that stem extract of Tobok-ryeong is involved in adiponectin receptor-AMPK signaling in a mechanism of improving fatty liver in mice fed high fat diet, the degree of protein phosphorylation of molecules involved in adiponectin receptor-AMPK signaling and Gene expression levels were measured. As a result of Western blot in liver tissue, phosphorylation of AMPK was significantly decreased in the HFD group compared to the normal diet group, whereas it was significantly increased in the T1D group compared to the HFD group (FIG. 5). The mRNA expression levels of LXRα and SREBP1-C and their target genes (CD36 and aP2), which are sub-signalers of AMPK and which promote fat production, were significantly increased in the HFD group compared to the normal diet group. , T1D group was significantly reduced again compared to the HFD group (Fig. 5). Therefore, Tobokyeong stem extract was found to inhibit fat production through adiponectin receptor-AMPK-mediated signaling system in the mouse liver tissue fed high-fat diet.

Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that such a specific technology is only a preferred embodiment, and the scope of the present invention is not limited thereto. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Claims (11)

Tobokyeong ( Smilax china Linne ) pharmaceutical composition for the prevention or treatment of obesity containing as an active ingredient.
The composition of claim 1, wherein the Tobok-Ryung extract is a Tobok-Ryong stem extract or Tobok-Ryong leaf extract.
The composition of claim 1, wherein the composition reduces liver fat or visceral fat.
4. The method of claim 3, wherein the fat comprises triglycerides, cholesterol or free fatty acids.
A composition comprising:
4. The composition of claim 3, wherein the visceral fat comprises one or more fats selected from epididymal fat, perirenal fat, mesenteric fat, and celiac fat.
delete The composition of claim 1, wherein the composition reduces the amount of alanine aminotransferase (ALT) or aspartate aminotransferase (AST) in the blood.
The composition of claim 1, wherein the composition increases the amount of adiponectin in the blood.
The composition of claim 1, wherein the composition increases phosphorylation of AMPK (AMP-activated protein kinase).
According to claim 1, wherein the composition is characterized in that the expression of LXRα (Liver X receptor α), SREBP1-C (Sterol response element binding protein), CD36 (Fatty acid translocase) or aP2 (fatty acid binding protein) reduced expression Composition.
Food composition for the improvement or alleviation of obesity, including the Tobokyeong extract as an active ingredient.

Images