KR101666666B1 - Composition for Preventing, Treating or Improving of Obesity comprising Extract from Lespedeza bicolor Turcz. or Mixture of Extract from Lespedeza bicolor Turcz. and Extract from Smilax glabre - Google Patents

Composition for Preventing, Treating or Improving of Obesity comprising Extract from Lespedeza bicolor Turcz. or Mixture of Extract from Lespedeza bicolor Turcz. and Extract from Smilax glabre Download PDF

Info

Publication number
KR101666666B1
KR101666666B1 KR1020130108773A KR20130108773A KR101666666B1 KR 101666666 B1 KR101666666 B1 KR 101666666B1 KR 1020130108773 A KR1020130108773 A KR 1020130108773A KR 20130108773 A KR20130108773 A KR 20130108773A KR 101666666 B1 KR101666666 B1 KR 101666666B1
Authority
KR
South Korea
Prior art keywords
extract
mixture
composition
present
sari
Prior art date
Application number
KR1020130108773A
Other languages
Korean (ko)
Other versions
KR20150029853A (en
Inventor
정윤화
김도희
김미숙
김성수
김우경
노유헌
이동진
이영승
이지원
Original Assignee
이지원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 이지원 filed Critical 이지원
Priority to KR1020130108773A priority Critical patent/KR101666666B1/en
Publication of KR20150029853A publication Critical patent/KR20150029853A/en
Application granted granted Critical
Publication of KR101666666B1 publication Critical patent/KR101666666B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/48Fabaceae or Leguminosae (Pea or Legume family); Caesalpiniaceae; Mimosaceae; Papilionaceae
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/06Fungi, e.g. yeasts
    • A61K36/07Basidiomycota, e.g. Cryptococcus
    • A61K36/076Poria
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00Function of food ingredients
    • A23V2200/30Foods, ingredients or supplements having a functional effect on health
    • A23V2200/3262Foods, ingredients or supplements having a functional effect on health having an effect on blood cholesterol
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00Function of food ingredients
    • A23V2200/30Foods, ingredients or supplements having a functional effect on health
    • A23V2200/332Promoters of weight control and weight loss

Landscapes

  • Health & Medical Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Botany (AREA)
  • Medical Informatics (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Abstract

본 발명은 (a) 싸리(Lespedeza bicolor Turcz.) 추출물; 또는 (b) 싸리 추출물 및 토복령(Smilax glabre) 추출물의 혼합물을 유효성분으로 포함하는 비만의 예방, 치료 또는 개선용 조성물에 관한 것이다. 본 발명에 따르면, 본 발명의 조성물은 지방세포의 분화를 억제하고 세포내 비만관련 지질, 지단백질 및 호르몬에 대하여 항비만 활성을 나타내고, 체지방지수 및 허리둘레를 유의하게 감소시키는 효과를 갖는다.(A) a extract of Lespedeza bicolor Turcz . ; Or (b) a mixture of a sari extract and a Smilax glabre extract as an active ingredient. According to the present invention, the composition of the present invention has an effect of inhibiting the differentiation of adipocytes, exhibiting anti-obesity activity against lipid, lipoprotein and hormone related to intracellular fat, and significantly decreasing body fat index and waist circumference.

Description

싸리 추출물 또는 싸리 추출물 및 토복령 추출물의 혼합물을 포함하는 비만 예방, 치료 또는 개선용 조성물{Composition for Preventing, Treating or Improving of Obesity comprising Extract from Lespedeza bicolor Turcz. or Mixture of Extract from Lespedeza bicolor Turcz. and Extract from Smilax glabre}FIELD OF THE INVENTION The present invention relates to a composition for preventing, treating or improving obesity, which comprises a mixture of a sialidase extract or a sialidase extract and a tobacco extract. or Mixture of Extract from Lespedeza bicolor Turcz. and Extract from Smilax glabre}

본 발명은 싸리 추출물 또는 싸리 추출물 및 토복령 추출물의 혼합물을 포함하는 비만의 예방, 치료 또는 개선용 조성물에 관한 것이다.
The present invention relates to a composition for prevention, treatment or amelioration of obesity comprising a mixture of a sari extract or a sari extract and a tobacco extract.

경제가 고도로 발달함에 따라 식생활은 윤택해지고 활동량은 줄어들며, 식습관은 서구화되면서 섭취 칼로리 과잉, 운동 부족 등으로 섭취 에너지와 소비에너지 간의 불균형으로 인해 비만이 증가하고 있다. 운동 부족과 비만의 관계는 소비에너지 저하도 있지만, 그보다 에너지가 체내에서 저장되기 쉬운 대사상태로 변하는 것이 더 중요하다. 운동 부족은 활동 에너지량을 감소시켜서 잉여 칼로리를 체내에 저장하게 되며 인슐린의 활동이 약해지면서 인슐린의 혈당강하 작용을 감소시켜 지방축적작용이 촉진되는 대사상태가 되게 한다. 또한, 운동부족 상태에서는 기초대사도 감소되므로 저장에너지는 더욱 증가되기 쉽다.Obesity is increasing due to the imbalance between energy intake and energy consumption due to overeating of calories and lack of exercise as eating habits become westernized as eating habits become more widespread as the economy develops highly. Although the relationship between lack of exercise and obesity is a reduction in energy consumption, it is more important that the energy is changed into a metabolic state that is more easily stored in the body. Lack of exercise reduces the amount of energy in the body, stores the excess calories in the body and weakens the activity of insulin, which reduces the blood glucose lowering action of insulin, which promotes the metabolism of fat accumulation is promoted. In addition, in the lack of exercise, the stored energy is more likely to increase because the basic metabolism is reduced.

이러한 비만은 성인병을 유발시키는 촉진제가 되며 대사 장애로서 제2형 당뇨병, 동맥경화증의 발현 위험을 증가시키며, 심장의 혈액공급에 부담을 주게되어 심장병에 걸리게 되며, 남은 지방은 간에 부담을 주어 지방간, 담석증, 간경변에 걸리게 된다. 몸무게가 뼈와 관절에 부담을 주어 골격이상이 생기며 행동이 둔화됨에 따라 활동력이 제한되므로 운동부족이 되어 비만이 더욱 심화되며, 특히 여성 비만은 내분비 이상을 가져와 월경불순, 성욕감퇴, 출산시 합병증, 피부습진 및 다한증을 유발한다.
Such obesity is an accelerator that induces adult diseases and increases the risk of developing type 2 diabetes, atherosclerosis as a metabolic disorder, and it imposes a burden on the blood supply to the heart, resulting in heart disease. Cholelithiasis, and cirrhosis. Obesity is caused by a shortage of exercise due to limitation of activity as a result of weight loss and skeletal abnormality due to a strain on the bones and joints. In particular, obesity in women leads to endocrine abnormalities, resulting in menstrual irregularities, loss of sexual desire, Skin eczema and hyperhidrosis.

본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

본 발명자들은 현대인의 대표적인 질환 중 하나인 비만을 예방, 치료 또는 개선할 수 있는 천연물을 찾고자 노력하였다. 그 결과, 싸리(Lespedeza bicolor Turcz .) 추출물, 토복령(Smilax glabre) 추출물 또는 이의 혼합물이 지방세포의 분화를 억제하고, 세포내 비만 관련 지질, 지단백질 및 호르몬에 대해 항비만 효과를 갖으며, 임상 실험을 통해 상기 추출물 또는 혼합물이 체질랑지수 및 허리둘레를 감소시키는 효과를 확인함으로써, 본 발명을 완성하였다.The present inventors have sought to find natural products that can prevent, treat or ameliorate obesity, which is one of the representative diseases of modern people. As a result, Lespedeza bicolor Turcz . ) Extract, Smilax glabre extract or a mixture thereof inhibits adipocyte differentiation and has an anti-obesity effect on intracellular obesity-related lipid, lipoprotein and hormone. Through clinical experiments, the extract or the mixture decreases the sperm count and waist circumference The present invention has been completed.

따라서, 본 발명의 목적은 비만의 예방, 치료 또는 개선용 조성물을 제공하는 데 있다.
Accordingly, an object of the present invention is to provide a composition for preventing, treating or ameliorating obesity.

본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

본 발명의 일 양태에 따르면, 본 발명은 (a) 싸리(Lespedeza bicolor Turcz.) 추출물; 또는 (b) 싸리 추출물 및 토복령(Smilax glabre) 추출물의 혼합물을 유효성분으로 포함하는 비만의 예방, 치료 또는 개선용 조성물을 제공한다.
According to one aspect of the present invention, the present invention provides a pharmaceutical composition comprising (a) a extract of Lespedeza bicolor Turcz . ; Or (b) a mixture of a sari extract and a Smilax glabre extract as an active ingredient. The present invention also provides a composition for preventing, treating or ameliorating obesity.

본 발명자들은 현대인의 대표적인 질환 중 하나인 비만을 예방, 치료 또는 개선할 수 있는 천연물을 찾고자 노력하였다. 그 결과, 싸리추출물, 토복령(Smilax glabre) 추출물 또는 이의 혼합물이 지방세포의 분화를 억제하고, 세포내 비만 관련 지질, 지단백질 및 호르몬에 대해 항비만 효과를 갖으며, 임상 실험을 통해 상기 추출물 또는 혼합물이 체질랑지수 및 허리둘레를 감소시키는 효과를 확인하였다.
The present inventors have sought to find natural products that can prevent, treat or ameliorate obesity, which is one of the representative diseases of modern people. As a result, the extracts of Smilax , Smilax glabre or a mixture thereof inhibit the differentiation of adipocytes and have an anti-obesity effect on intracellular obesity-related lipids, lipoproteins and hormones. The effect of the mixture on body composition, index and waist circumference was confirmed.

본 발명의 조성물에서 이용되는 싸리 추출물 또는 토복령 추출물은 싸리 또는 토복령에 추출용매를 처리하여 수득하는 경우에는, 다양한 추출용매가 이용될 수 있다. 바람직하게는, 극성 용매 또는 비극성 용매를 이용할 수 있다. 극성 용매로서 적합한 것은, (i) 물, (ii) 알코올(바람직하게는, 메탄올, 에탄올, 프로판올, 부탄올, 노말-프로판올, 이소-프로판올, 노말-부탄올, 1-펜탄올, 2-부톡시에탄올 또는 에틸렌글리콜), (iii) 아세트산, (iv) DMFO(dimethyl-formamide) 및 (v) DMSO(dimethyl sulfoxide)를 포함한다. 비극성 용매로서 적합한 것은, 아세톤, 아세토나이트릴, 에틸 아세테이트, 메틸 아세테이트, 플루오로알칸, 펜탄, 헥산, 2,2,4-트리메틸펜탄, 데칸, 사이클로헥산, 사이클로펜탄, 디이소부틸렌, 1-펜텐, 1-클로로부탄, 1-클로로펜탄, o-자일렌, 디이소프로필 에테르, 2-클로로프로판, 톨루엔, 1-클로로프로판, 클로로벤젠, 벤젠, 디에틸 에테르, 디에틸 설파이드, 클로로포름, 디클로로메탄, 1,2-디클로로에탄, 어닐린, 디에틸아민, 에테르, 사염화탄소 및 THF를 포함한다.When the sari extract or tobacco extract used in the composition of the present invention is obtained by treating the extraction solvent in the sari or soil culture, various extraction solvents may be used. Preferably, a polar solvent or a non-polar solvent can be used. Suitable polar solvents are (i) water, (ii) alcohols (preferably methanol, ethanol, propanol, butanol, n-propanol, iso-propanol, n-butanol, 1-pentanol, Or ethylene glycol), (iii) acetic acid, (iv) dimethyl-formamide (DMFO) and (v) dimethyl sulfoxide (DMSO). Suitable nonpolar solvents are acetone, acetonitrile, ethyl acetate, methyl acetate, fluoroalkane, pentane, hexane, 2,2,4-trimethylpentane, decane, cyclohexane, cyclopentane, diisobutylene, 1- But are not limited to, pentane, 1-chlorobutane, 1-chloropentane, o -xylene, diisopropyl ether, 2- chloropropane, toluene, 1- chloropropane, chlorobenzene, benzene, diethyl ether, diethylsulfide, Methane, 1,2-dichloroethane, aniline, diethylamine, ether, carbon tetrachloride, and THF.

보다 바람직하게는, 본 발명에서 이용되는 추출용매는 (a) 물, (b) 탄소수 1-4의 무수 또는 함수 저급 알코올 (메탄올, 에탄올, 프로판올, 부탄올 등), (c) 상기 저급 알코올과 물과의 혼합용매, (d) 아세톤, (e) 에틸 아세테이트, (f) 클로로포름, (g) 부틸아세테이트, (h) 1,3-부틸렌글리콜, (i) 헥산 및 (j) 디에틸에테르를 포함한다. 가장 바람직하게는, 본 발명의 추출물은 물, 에탄올 또는 이의 조합을 싸리 또는 토복령에 처리하여 수득한 것이다.More preferably, the extraction solvent used in the present invention is (a) water, (b) anhydrous or hydrated lower alcohol having 1 to 4 carbon atoms (methanol, ethanol, propanol, butanol, etc.) (E) ethyl acetate, (f) chloroform, (g) butyl acetate, (h) 1,3-butylene glycol, (i) hexane and (j) diethyl ether. . Most preferably, the extract of the present invention is obtained by treating water, ethanol, or a combination thereof with water or soil.

본 발명의 일 구현예에 따르면, 본 발명의 싸리 추출물 또는 토복령 추출물은 물, 에탄올 또는 이의 조합으로 추출한 싸리 추출물 또는 토복령 추출물이다.According to one embodiment of the present invention, the sari extract or saururus extract of the present invention is a sari extract or soil extract extracted with water, ethanol or a combination thereof.

본 명세서에서 사용되는 용어 ‘추출물’은 상술한 바와 같이 당업계에서 조추출물(crude extract)로 통용되는 의미를 갖지만, 광의적으로는 추출물을 추가적으로 분획(fractionation)한 분획물도 포함한다. 즉, 싸리 추출물 또는 토복령 추출물은 상술한 추출용매를 이용하여 얻은 것뿐만 아니라, 여기에 정제과정을 추가적으로 적용하여 얻은 것도 포함한다. 예컨대, 상기 추출물을 일정한 분자량 컷-오프 값을 갖는 한외 여과막을 통과시켜 얻은 분획, 다양한 크로마토그래피(크기, 전하, 소수성 또는 친화성에 따른 분리를 위해 제작된 것)에 의한 분리 등, 추가적으로 실시된 다양한 정제 방법을 통해 얻어진 분획도 본 발명의 싸리 추출물 또는 토복령 추출물에 포함되는 것이다.As used herein, the term " extract " means that it is used in the art as a crude extract as described above, but broadly includes fractions obtained by further fractionating the extract. In other words, the sari extract or the tobacco extract may be obtained not only by using the above-mentioned extraction solvent but also by additionally applying a purification process thereto. For example, a fraction obtained by passing the above extract through an ultrafiltration membrane having a constant molecular weight cut-off value, and a separation by various chromatography (manufactured for separation according to size, charge, hydrophobicity or affinity) The fraction obtained by the purification method is also included in the sari extract or soil extract of the present invention.

본 발명에서 이용되는 싸리 추출물 또는 토복령 추출물은 감압 증류 및 동결 건조 또는 분무 건조 등과 같은 추가적인 과정에 의해 분말 상태로 제조될 수 있다.The sari extract or tobacco extract used in the present invention may be prepared in powder form by an additional process such as vacuum distillation and freeze drying or spray drying.

본 명세서에서 용어 ‘유효성분으로 포함하는’이란 하기의 싸리 추출물 또는 토복령 추출물의 효능 또는 활성을 달성하는 데 충분한 양을 포함하는 것을 의미한다. 본 발명은 천연식물재료인 싸리 또는 토복령으로부터 추출한 조성물로서 과량 투여하여도 인체에 부작용이 없으므로 싸리 추출물 및 토복령 추출물이 본 발명의 조성물에 포함된 양적 상한은 당업자가 적절한 범위 내에서 선택하여 실시할 수 있다.As used herein, the term " comprising as an active ingredient " is meant to include an amount sufficient to achieve the efficacy or activity of the following extract or soil extract. Since the present invention is a composition extracted from a natural plant material, Sari or Tohoku Kogaku, there is no adverse effect on human body even when it is administered in an excessive amount. Therefore, the quantitative upper limit of the composition of the present invention is selected by a person skilled in the art can do.

본 발명에 따르면, 상기 혼합물은 싸리 추출물 및 토복령 추출물을 10:1 내지 1:10의 비율로 혼합한 혼합물이다.According to the present invention, the mixture is a mixture of a sari extract and a tobacco extract at a ratio of 10: 1 to 1:10.

본 발명의 일 구현예에 따르면, 본 발명의 혼합물은 10:1 내지 2:1의 비율로 혼합한 혼합물이고, 본 발명의 다른 구현예에 따르면, 본 발명의 혼합물은 10:1 내지 3:1의 비율로 혼합한 혼합물이며, 본 발명의 특정 구현예에 따르면, 본 발명의 혼합물은 10:1 내지 4:1의 비율로 혼합한 혼합물이다.According to one embodiment of the present invention, the mixture of the present invention is a mixture mixed at a ratio of 10: 1 to 2: 1, and according to another embodiment of the present invention, . According to a specific embodiment of the present invention, the mixture of the present invention is a mixture mixed at a ratio of 10: 1 to 4: 1.

본 발명에 따르면, 상기 (a) 싸리 추출물; 또는 (b) 싸리 추출물 및 토복령 추출물의 혼합물은 지방세포의 분화를 감소시킨다.According to the present invention, there is provided a pharmaceutical composition comprising (a) a sari extract; Or (b) a mixture of sari extracts and soil extracts reduces the differentiation of adipocytes.

본 발명의 특정 구현예에 따르면, 상기 싸리 추출물은 지방세포의 분화를 10% 내지 30% 정도 억제하고, 상기 싸리 추출물 및 토복령 추출물의 혼합물은 35% 내지 80% 정도 억제한다.According to a specific embodiment of the present invention, the sari extract inhibits the differentiation of adipocytes by 10% to 30%, and the mixture of the sari extract and the tobacco extract is inhibited by 35% to 80%.

본 발명에 따르면, 상기 (a) 싸리 추출물; 또는 (b) 싸리 추출물 및 토복령 추출물의 혼합물은 중성지방(triglycerol)의 생성을 감소시킨다.According to the present invention, there is provided a pharmaceutical composition comprising (a) a sari extract; Or (b) a mixture of Sri Lanka extract and Sukyoungryong extract reduces the production of triglycerol.

본 발명의 특정 구현예에 따르면, 상기 싸리 추출물은 중성지방을 10-40%, 15-35% 또는 20-30% 감소시키고, 상기 싸리 추출물 및 토복령 추출물의 혼합물은 45-70%, 50-65% 또는 53-63% 감소시킨다.According to a particular embodiment of the invention, the sari extract reduces 10-40%, 15-35%, or 20-30% of the triglyceride and the mixture of the sari extract and the tobacco extract comprises 45-70%, 50- 65% or 53-63%.

본 발명에 따르면, 상기 싸리 추출물 및 토복령 추출물의 혼합물은 아디포넥틴(adiponectin)의 발현을 증가시킨다.According to the present invention, the mixture of the sari extract and the soil extract increases the expression of adiponectin.

본 발명의 특정 구현예에 따르면, 상기 싸리 추출물 및 토복령 추출물의 혼합물은 아디포넥틴의 발현을 1.0-2.0배, 1.2-1.8배 또는 1.3-1.7배 증가시킨다.According to a particular embodiment of the invention, the mixture of the sari extract and the saury extract increases the expression of adiponectin by 1.0-2.0, 1.2-1.8 or 1.3-1.7 times.

본 발명에 따르면, 상기 (a) 싸리 추출물; 또는 (b) 싸리 추출물 및 토복령 추출물의 혼합물은 렙틴(leptin)의 발현을 감소시킨다.According to the present invention, there is provided a pharmaceutical composition comprising (a) a sari extract; Or (b) a mixture of sari extracts and soil extracts reduces leptin expression.

본 발명의 특정 구현예에 따르면, 상기 싸리 추출물 및 토복령 추출물의 혼합물은 렙틴의 발현을 35-65%, 40-60& 또는 45-55% 감소시킨다.According to a particular embodiment of the present invention, the combination of the sari extract and the extract of Sophorae griseus reduces the expression of leptin by 35-65%, 40-60 ' or 45-55%.

본 발명에 따르면, 상기 싸리 추출물 및 토복령 추출물의 혼합물은 체질량지수를 감소시킨다.According to the present invention, the mixture of the sari extract and the tobacco extract reduces the BMI.

본 발명의 특정 구현예에 따르면, 상기 싸리 추출물 및 토복령 추출물의 혼합물은 체질량지수를 1.2-2.2 ㎏/㎡, 1.5-2.0 ㎏/㎡ 또는 1.6-2.0 ㎏/㎡ 감소시킨다.According to a particular embodiment of the invention, the mixture of the sari extract and the tobacco extract reduces the body mass index from 1.2-2.2 kg / m 2, 1.5-2.0 kg / m 2 or 1.6-2.0 kg / m 2.

본 발명에 따르면, 상기 (a) 싸리 추출물; 또는 (b) 싸리 추출물 및 토복령 추출물의 혼합물은 허리둘레를 감소시킨다.According to the present invention, there is provided a pharmaceutical composition comprising (a) a sari extract; Or (b) a mixture of sari extract and tobacco extract reduces waist circumference.

본 발명의 특정 구현예에 따르면, 상기 싸리 추출물은 허리둘레를 2-7 ㎝, 3-6 ㎝ 또는 4-5 ㎝ 감소시킨다.
According to a particular embodiment of the invention, the sour extract reduces waist circumference by 2-7 cm, 3-6 cm or 4-5 cm.

본 발명의 조성물은 약제학적 조성물로 제조될 수 있다.The compositions of the present invention may be prepared with pharmaceutical compositions.

본 발명의 바람직한 구현예에 따르면, 본 발명의 조성물은 (a) 상술한 본 발명의 (ⅰ) 싸리 추출물; (ⅱ) 싸리 추출물 및 토복령 추출물의 혼합물의 약제학적 유효량; 및 (b) 약제학적으로 허용되는 담체를 포함하는 약제학적 조성물이다. 본 명세서에서 용어 “약제학적 유효량”은 상술한 싸리 추출물, 토복령 추출물 또는 이의 혼합물의 효능 또는 활성을 달성하는 데 충분한 양을 의미한다.According to a preferred embodiment of the present invention, the composition of the present invention comprises (a) the above-mentioned (i) sari extract of the present invention; (Ii) a pharmaceutically effective amount of a mixture of a sari extract and a tobacco extract; And (b) a pharmaceutically acceptable carrier. As used herein, the term " pharmaceutically effective amount " means an amount sufficient to achieve efficacy or activity of the above-mentioned sari extract, tobacco extract or a mixture thereof.

본 발명의 조성물이 약제학적 조성물로 제조되는 경우, 본 발명의 약제학적 조성물은 약제학적으로 허용되는 담체를 포함한다. 본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.When the composition of the present invention is manufactured from a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. The pharmaceutically acceptable carriers to be contained in the pharmaceutical composition of the present invention are those conventionally used in the present invention and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, But are not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrups, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It is not. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).

본 발명의 약제학적 조성물은 경구 또는 비경구 투여할 수 있으며, 바람직하게는 경구 투여 방식으로 적용된다.The pharmaceutical composition of the present invention can be administered orally or parenterally, and is preferably administered orally.

본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 본 발명의 약제학적 조성물의 일반적인 투여량은 성인 기준으로 0.001-100 ㎎/kg 범위 내이다.The appropriate dosage of the pharmaceutical composition of the present invention may vary depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate, . Typical dosages of the pharmaceutical compositions of this invention are in the range of 0.001-100 mg / kg on an adult basis.

본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액, 시럽제 또는 유화액 형태이거나 엑스제, 산제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
The pharmaceutical composition of the present invention may be formulated into a unit dose form by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by a person having ordinary skill in the art to which the present invention belongs. Or by intrusion into a multi-dose container. The formulations may be in the form of solutions, suspensions, syrups or emulsions in oils or aqueous media, or in the form of excipients, powders, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.

본 발명의 조성물은 식품 조성물로 제공될 수 있다. 본 발명의 (a) 싸리 추출물; 또는 (b) 싸리 추출물 및 토복령 추출물의 혼합물을 유효성분 포함하는 비만의 예방, 개선 또는 치료용 조성물이 식품 조성물로 제조되는 경우, 유효성분으로서 싸리 추출물 및/또는 토복령 추출물 뿐 만 아니라, 식품 제조 시에 통상적으로 첨가되는 성분을 포함하며, 예를 들어, 단백질, 탄수화물, 지방, 영양소, 조미제 및 향미제를 포함한다. 상술한 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스, 올리고당 등; 및 폴리사카라이드, 예를 들어 덱스트린, 사이클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 향미제로서 천연 향미제 [타우마틴, 스테비아 추출물 (예를 들어 레바우디오시드 A, 글리시르히진 등]) 및 합성 향미제(사카린, 아스파르탐 등)를 사용할 수 있다. 예컨대, 본 발명의 식품 조성물이 드링크제로 제조되는 경우에는 본 발명의 싸리 추출물 및/또는 토복령 추출물 이외에 구연산, 액상과당, 설탕, 포도당, 초산, 사과산, 과즙, 두충 추출액, 대추 추출액, 감초 추출액 등을 추가로 포함시킬 수 있다.
The composition of the present invention can be provided as a food composition. (A) a sari extract of the present invention; Or (b) a composition for preventing, improving or treating obesity comprising an active ingredient of a mixture of a sari extract and a tobacco root extract, is prepared as a food composition, the sari extract and / or the soil extract as an active ingredient, Includes components that are typically added at the time of manufacture, including, for example, proteins, carbohydrates, fats, nutrients, flavoring agents, and flavoring agents. Examples of the above-mentioned carbohydrates are monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose, oligosaccharides and the like; And polysaccharides such as dextrin, cyclodextrin and the like, and sugar alcohols such as xylitol, sorbitol and erythritol. Natural flavorings such as tau martin and stevia extract (e.g., rebaudioside A and glycyrrhizin) and synthetic flavorings (saccharine, aspartame, etc.) can be used as flavorings. For example, in the case where the food composition of the present invention is prepared as a drink, citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, juice, mulberry extract, jujube extract, licorice extract, etc. may be used in addition to the sari extract and / Can be further included.

본 발명의 (a) 싸리 추출물; 또는 (b) 싸리 추출물 및 토복령 추출물의 혼합물을 유효성분으로 포함하는 비만의 예방, 개선 또는 치료용 조성물은 기능성 식품 조성물로 제조될 수 있다. 본 발명의 조성물이 기능성 식품 조성물로 제조되는 경우, 식품 제조 시 통상적으로 첨가되는 성분을 포함하며, 예를 들어, 단백질, 탄수화물, 지방, 영양소 및 조미제를 포함한다. 예컨대, 드링크제로 제조되는 경우에는 유효성분으로서 싸리 추출물 및/또는 토복령 추출물 이외에 향미제 또는 천연 탄수화물을 추가 성분으로 포함시킬 수 있다. 예를 들어, 천연 탄수화물은 모노사카라이드(예컨대, 글루코오스, 프럭토오스 등); 디사카라이드(예컨대, 말토스, 수크로오스 등); 올리고당; 폴리사카라이드(예컨대, 덱스트린, 시클로덱스트린 등); 및 당알코올(예컨대, 자일리톨, 소르비톨, 에리쓰리톨 등)을 포함한다. 향미제로서 천연 향미제(예컨대, 타우마린, 스테비아 추출물 등) 및 합성 향미제(예컨대, 사카린, 아스파르탐 등)을 이용할 수 있다.
(A) a sari extract of the present invention; Or (b) a composition for preventing, ameliorating or treating obesity, which comprises a mixture of a sari extract and a tobacco root extract as an active ingredient, may be prepared from a functional food composition. When the composition of the present invention is prepared with a functional food composition, it includes components that are conventionally added in food production, and includes, for example, proteins, carbohydrates, fats, nutrients, and seasonings. For example, in the case of being made with a drink, a flavoring agent or a natural carbohydrate may be added as an additional ingredient in addition to the sari extract and / or the tobacco extract as an active ingredient. For example, natural carbohydrates include monosaccharides (e.g., glucose, fructose, etc.); Disaccharides (e.g., maltose, sucrose, etc.); oligosaccharide; Polysaccharides (e.g., dextrin, cyclodextrin and the like); And sugar alcohols (e.g., xylitol, sorbitol, erythritol, etc.). Natural flavoring agents (e.g., tau marin, stevia extract, etc.) and synthetic flavoring agents (e.g., saccharin, aspartame, etc.) may be used as flavorings.

본 발명의 특징 및 이점을 요약하면 다음과 같다:The features and advantages of the present invention are summarized as follows:

(a) 본 발명은 비만의 예방, 치료 또는 개선용 조성물을 제공한다.(a) The present invention provides a composition for preventing, treating or improving obesity.

(b) 본 발명의 조성물은 지방세포의 분화를 억제하고 세포내 비만관련 지질, 지단백질 및 호르몬에 대하여 항비만 활성을 나타낸다.(b) The composition of the present invention inhibits the differentiation of adipocytes and exhibits anti-obesity activity against intracellular obesity-related lipids, lipoproteins and hormones.

(c) 본 발명의 조성물은 체지방지수 및 허리둘레를 유의하게 감소시키는 효과를 갖는다.
(c) The composition of the present invention has an effect of significantly reducing the body fat index and the waist circumference.

도 1은 지방세포 세포 증식에 대한 싸리(Lespedeza bicolor Turcz .) 추출물, 토복령 추출물(Smilax glabre) 및 이의 혼합물의 영향을 나타내는 결과를 보여준다.
도 2는 중성지방 생성에 대한 싸리 추출물, 토복령 추출물 및 이의 혼합물의 영향을 나타내는 결과를 보여준다.
도 3은 아디포넥틴(adiponectin) 발현에 대한 싸리 추출물, 토복령 추출물 및 이의 혼합물의 영향을 나타내는 결과를 보여준다.
도 4는 렙틴(leptin) 발현에 대한 싸리 추출물, 토복령 추출물 및 이의 혼합물의 영향을 나타내는 결과를 보여준다.
도 5는 싸리 추출물, 토복령 추출물 또는 이의 혼합물의 섭취 전/후의 허리 둘레를 나타내는 결과를 보여준다.
Figure 1 is a graphical representation of the results of Lespedeza < RTI ID = 0.0 > bicolor Turcz . ) Extract, soil extract ( Smilax glabre ) and mixtures thereof.
Fig. 2 shows the results showing the effect of sari extract, tobacco extract and mixtures thereof on the production of triglycerides.
Fig. 3 shows the results showing the effects of sari extract, tobacco extract and mixtures thereof on adiponectin expression.
Fig. 4 shows the results showing the effect of sari extract, tobacco extract and mixtures thereof on leptin expression.
Fig. 5 shows the results showing the waist circumference before / after ingestion of the sari extract, tobacco extract or mixture thereof.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

실시예 1: 싸리 추출물 및 토복령 추출물의 제조 및 이의 혼합물의 제조Example 1: Preparation of sari extract and tobacco extract and preparation of a mixture thereof

싸리(Lespedeza bicolor Turcz.) 추출물의 제조Preparation of extract of Lespedeza bicolor Turcz.

싸리(Lespedeza bicolor Turcz.)를 선별하여 분쇄한 뒤, 분쇄물 중량의 약 1 내지 25 배의 부피량(w/v%), 바람직하게는 5 내지 15배의 부피량의 정제수를 포함한 물, 메탄올, 에탄올, 부탄올 등의 탄소수 1 내지 4의 저급알코올 또는 이들의 혼합용매로부터 선택된 용매, 바람직하게는 물, 에탄올 또는 이들의 혼합용매로, 0 내지 120℃, 바람직하게는 50 내지 100℃ 추출온도에서 약 1시간 내지 10일, 바람직하게는 약 2시간 내지 6시간 냉침추출, 열수추출, 초음파 추출, 환류냉각 추출, 또는 가열추출법 등의 추출방법으로, 바람직하게는 열수추출 또는 환류냉각 추출법으로 약 1 내지 10회, 바람직하게는 2 내지 7회 반복 추출한다. 본 추출물을 바로 여과하여 진공농축한 후 배합비율에 의해 덱스트린을 혼합하여 분무건조하거나 동결 건조하여 싸리 추출물을 얻는다.
After crushing the crushed Lespedeza bicolor Turcz. , Water containing purified water of a volume (w / v%) of about 1 to 25 times, preferably 5 to 15 times the weight of the crushed, Ethanol, or butanol, or a mixed solvent thereof, preferably water, ethanol or a mixed solvent thereof at a temperature of from 0 to 120 ° C, preferably from 50 to 100 ° C, Preferably about 1 hour to 10 days, preferably about 2 hours to 6 hours, by an extraction method such as cold extraction, hot water extraction, ultrasonic extraction, reflux cooling extraction, or heat extraction, To 10 times, preferably 2 to 7 times. The extract is immediately filtered and concentrated in vacuo, and then mixed with dextrin by a mixing ratio and spray dried or lyophilized to obtain a sari extract.

토복령(Smilax glabre) 추출물의 제조Preparation of Smilax glabre extract

토복령(Smilax glabre)을 선별하여 분쇄한 뒤, 분쇄물 중량의 약 1 내지 30배의 부피량(w/v%), 바람직하게는 10 내지 20 배의 부피량의 정제수를 포함한 물, 메탄올, 에탄올, 부탄올 등의 탄소수 1 내지 4의 저급알코올 또는 이들의 혼합용매로부터 선택된 용매, 바람직하게는 물, 에탄올 또는 이들의 혼합용매로, 0 내지 120℃, 바람직하게는 50 내지 100℃ 추출온도에서 약 1시간 내지 10일, 바람직하게는 약 1시간 내지 6시간 냉침추출, 열수추출, 초음파 추출, 환류냉각 추출, 또는 가열추출법 등의 추출방법으로, 바람직하게는 열수추출 또는 환류냉각 추출법으로 약 1 내지 10회, 바람직하게는 2 내지 7회 반복추출한다. 추출물을 여과포로 여과하고, 여액을 진공 농축하여 배합비율에 따라 덱스트린을 혼합하여 분무건조하거나 동결건조하여 분말 추출물을 획득한다.
Smilax glabre is pulverized, and then water, methanol, water containing purified water of a volume (w / v%) of about 1 to 30 times the weight of the pulverized material, preferably 10 to 20 times the weight of the pulverized material, Ethanol, or a mixed solvent thereof, preferably at a temperature of from 0 to 120 ° C, preferably from 50 to 100 ° C, at an extraction temperature of from about 1 to about 4, preferably from about 1 to about 4, 1 to 10 days, preferably about 1 to 6 hours, by extraction method such as cold extraction, hot water extraction, ultrasonic extraction, reflux cooling extraction or heat extraction method, preferably by hot water extraction or reflux cooling extraction, 10 times, preferably 2 to 7 times. The extract is filtered with a filter cloth, and the filtrate is concentrated in vacuo, and dextrin is mixed according to the compounding ratio and spray dried or lyophilized to obtain a powdery extract.

싸리 추출물과 토복령 추출물의 혼합물 제조Manufacture of a mixture of sari extracts and soil extracts

상기 실시예에서 얻은 각각의 싸리 추출물 및 토복령 추출물을 10:1 내지 1:10, 바람직하게는 약 10:1 내지 6:4, 가장 바람직하게는 10:1 내지 8:2의 비율로 혼합하여 싸리 추출물과 토복령 추출물의 혼합물을 제조한다.
Each of the sari extract and soil extract obtained in the above example was mixed at a ratio of 10: 1 to 1:10, preferably about 10: 1 to 6: 4, and most preferably 10: 1 to 8: 2 A mixture of sari extract and soil extract is prepared.

실시예Example 2: 추출물의  2: Extract of 항비만Anti-obesity 효과 effect

본 발명의 조성물의 지방세포 분화 억제 및 세포내 비만관련 지질, 지단백질 및 호르몬의 측정을 통한 항비만 효과를 확인하였다.
The anti-obesity effect of the composition of the present invention was confirmed by inhibiting adipocyte differentiation and measuring lipid, lipoprotein and hormone related to intracellular obesity.

전지방세포 3T3-L1 세포의 분화 억제 효과Inhibitory effect of 3T3-L1 cells on adipocytes

전지방세포(preadipocyte)인 3T3-L1 세포는 지방세포의 대사과정을 연구하는데 널리 이용되고 있으며, 본 발명에서도 세포 배양과정에서 조성물을 처리한 후, 세포의 분화가 적을수록 항비만 효과가 큰 것으로 나타냈다.3T3-L1 cells, which are preadipocytes, are widely used for studying the metabolic processes of adipocytes. In the present invention, after treatment with a composition in a cell culture process, the smaller the differentiation of cells, the greater the anti-obesity effect .

3T3-L1 세포를 배양액을 이용하여 5%로 이산화탄소가 공급되는 배양기에서 37℃로 배양하였다. 세포 배양액은 10% FBS(fetal bovine serum) 및 항생제(antibiotics)를 포함하는 DMEM(Dulbecco’s Modified Eagle’s Media)을 사용하였다. 2-3일이 간격으로 배양된 세포 표면을 인산완충염용액(phosphate buffered saline, PBS)으로 세척한 후 0.5% 트립신(trypsin)을 처리하여 세포를 탈착시켜 계대 배양하였다. 세포를 시험을 사용할 때는 분화유도물질인 인슐린(5 ㎍/㎖), DEX(dexamethasone, 0.25 μM) 및 MIX(1-methyl-3-methylxanthine, 0.5 mM)이 함유된 분화유도 배양액으로 교환하여 1-3일간 배양하여 지방세포로 분화를 유도하였다. 배양 3일 후 인슐린만 함유하는 배지로 2-3일동안 배양한 후 인슐린을 제거한 배양액으로 바꾼다. 중성지방으로 유입되는 포도당 측정 실험이나 포도당 산화 실험시에는 10-12일 째에 저농도(5 mM) 포도당을 함유한 배양액으로 배양하고 조성물 처리는 분화유도 후에 싸리 추출물 및 토복령 추출물은 각각 0.1 ㎎/㎖의 농도로 처리하였으며 싸리 추출물 및 토복령 추출물의 혼합물을 처리하는 경우도 각 추출물을 동일한 농도로 처리하였다.3T3-L1 cells were cultured at 37 ° C in an incubator in which carbon dioxide was supplied at 5% using a culture medium. Cell culture media were DMEM (Dulbecco's Modified Eagle's Media) containing 10% fetal bovine serum (FBS) and antibiotics. The cell surface was incubated at 2-3 days intervals, washed with phosphate buffered saline (PBS), and treated with 0.5% trypsin to desorb the cells and subculture them. Cells were exchanged for differentiation induction medium containing differentiation inducing substances, insulin (5 μg / ml), DEX (dexamethasone, 0.25 μM) and MIX (1-methyl-3-methylxanthine, 0.5 mM) And cultured for 3 days to induce differentiation into adipocytes. After 3 days of culture, the cells are cultured in a medium containing only insulin for 2-3 days, and then replaced with a medium in which insulin is removed. (5 mM) glucose at 10-12 days in glucose measurement experiment or glucose oxidation test to neutral fat. The composition treatment was 0.1 ㎎ / ㎖, respectively, and the extracts were treated at the same concentration in the case of the treatment of the mixture of the sari extract and the soil extract.

처리된 세포는 24 시간, 48 시간 및 72 시간 후에 96 웰에 부착되어 있는 세포를 MTT(Dimethyl thiazolyl diphenyl tetrazolium salt) 분석방법을 이용하여 세포 수를 측정하였다. 그리고 처리 후 10일 동안 분화시킨 3T3-L1 세포에서 중성지방(triacylglycerol), 아디포넥틴(adiponectin) 및 렙틴(leptin)의 양을 각각 측정하였다. 세포내 중성지방의 정량은 중성지방 determination kit(Asan Pharm Co.,Ltd.,Korea)를 사용하여 효소법을 이용하여 측정하였다. 세포를 생리식염수로 3회 반복 세척한 후 4℃에서 30초간 초음파 처리한 후 원심분리(10,000 rpm, 20분, 4℃)하여 상층액을 분리하였다. 상층액 20 ㎕에 3 ㎖의 효소를 첨가하여 37℃에서 10분 동안 반응시킨 후 550 ㎚에서 흡광도를 측정하였다. 단백질 함량은 BSA를 표준시약으로 사용하여 브래드포드 방법에 따라 측정하였다. 아디포넥틴과 렙틴의 경우는 발현량을 mRNA 수준에서 확인하여 정량화하였다. 분화된 3T3-L1에서 RNA는 TRIzol 시약(Invitrogen)을 이용하여 추출하였다. 즉, 1 ㎖ TRIzol 시약를 넣어 세포를 균질화 시킨 후 200 ㎕ 클로로포름을 첨가하고 혼합한 후 4℃ 12,000g에서 15분동안 원심분리를 실시하여 수층을 분리하였다. 이 상층액을 취하여 동량의 이소프로판올을 첨가하고 원심분리를 실시하여 RNA을 수득하여 75% 에탄올로 RNA를 세척한 후 RNase 프리 워터에 녹여 사용하였으며 1 ㎍ RNA는 SuperscriptTM Ⅲ 키트(Invitrogen)를 이용하여 cDNA로 합성하였고 사이토카인 발현에 관여하여 유전자를 찾기 위해 각 유전자에 특이적 프라이머(아디포넥틴, 정방향: GACGTTACTACAACTGAAGAGC, 역방향: CATTCTTTTCCTGATACTGGTC; 렙틴, 정방향: CCAAAACCCTCATCAAGACC, 역방향: CTCAAAGCCACCACCTCTGT, β-actin, 정방향: GTGGGGCGCCCCAGGCACCA, 역방향: CTCCTTAATGTCACGCACGA)를 이용하여 유전자 산물을 PCR 방법을 사용하여 증폭하여 증폭된 DNA를 1.5% 아가로즈 젤에 분리되어 전기영동된 결과를 EtBr(Ethidium Bromide)로 염색하여 정량화하였다.Cells treated with 96 wells at 24 hours, 48 hours, and 72 hours were counted using MTT (dimethyl thiazolyl diphenyl tetrazolium salt) assay. The amounts of triacylglycerol, adiponectin, and leptin were measured in 3T3-L1 cells differentiated for 10 days after treatment. Quantification of intracellular triglyceride was determined by enzymatic method using neutral fat determination kit (Asan Pharm Co., Ltd., Korea). Cells were washed three times with physiological saline, sonicated at 4 ° C for 30 seconds, and centrifuged (10,000 rpm, 20 minutes, 4 ° C) to separate the supernatant. Three microliters of enzyme was added to 20 μl of the supernatant, and the reaction was carried out at 37 ° C for 10 minutes, and the absorbance at 550 nm was measured. Protein content was determined according to the Bradford method using BSA as a standard reagent. In the case of adiponectin and leptin, expression levels were quantified at the mRNA level. RNA from differentiated 3T3-L1 was extracted using TRIzol reagent (Invitrogen). That is, 1 ml of TRIzol reagent was added to the cells to homogenize, 200 μl of chloroform was added, and the mixture was centrifuged at 12,000 g at 4 ° C for 15 minutes to isolate the aqueous layer. The supernatant was taken and the same amount of isopropanol was added and centrifugation was performed to obtain RNA. The RNA was washed with 75% ethanol and dissolved in RNase free water. One μg of RNA was used for cDNA by using Superscript ™ III kit (Invitrogen) (Adiponectin, forward: GACGTTACTACAACTGAAGAGC, reverse direction: CATTCTTTTCCTGATACTGGTC; leptin, forward direction: CCAAAACCCTCATCAAGACC, reverse direction: CTCAAAGCCACCACCTCTGT, β-actin, forward direction: GTGGGCGCCCCAGGCACCA, reverse direction: CTCCTTAATGTCACGCACGA). The amplified DNA was separated on 1.5% agarose gel and electrophoresed with EtBr (Ethidium Bromide) for quantification.

결과는 평균과 표준편차로 나타내었으며 유의성 검증을 위해 통계처리는 스튜던트 t-테스트를 이용하였으며, p<0.05 시에 유의한 것으로 간주하여 표시하였다. 그 결과는 도 1 내지 도 4에 나타내었다.The results were expressed as mean and standard deviation. For statistical significance, Student t - test was used and statistically significant at p <0.05. The results are shown in FIG. 1 to FIG.

측정 결과, 도 1에서서 확인할 수 있듯이 싸리 추출물을 단독으로 처리한 경우, 24 시간, 48 시간 및 72 시간에서 대조군에 비해 각각 약 14%, 21% 및 29% 세포수가 감소하였고, 토복령 추출물을 단독으로 처리한 경우 24 시간, 48 시간 및 72 시간에서 대조군에 비해 각각 약 7%, 11% 및 12%의 통계적으로 유의하지 않은 세포 수 감소가 관찰되었다. 그리고 싸리 추출물 및 토복령 추출물의 혼합물을 처리한 경우, 세포생존율에서 대조군에 비해 24 시간, 48 시간 및 72 시간에 각각 39%, 57% 및 79%의 감소가 확인되었다.As can be seen from FIG. 1, when the sari extract was treated alone, the number of cells decreased about 14%, 21% and 29%, respectively, compared with the control group at 24 hours, 48 hours and 72 hours, A statistically insignificant decrease in cell number was observed at about 24 hours, 48 hours, and 72 hours, respectively, when compared to the control group, by about 7%, 11%, and 12%, respectively. When treated with a mixture of sari extracts and soil extracts, the cell viability was reduced by 39%, 57% and 79% at 24 hours, 48 hours and 72 hours, respectively, as compared with the control.

본 추출물 처리로 인한 중성지방의 변화를 도 2에 나타내었다. 싸리 추출물을 단독으로 처리한 경우 대조군 대비 지방세포내 중성지방의 양이 약 26% 가량 의미있는 감소하였으며 토복령 추출물을 처리한 경우 약 9%의 통계적으로 유의하지 않은 감소를 확인할 수 있었다. 그리고 싸리 추출물 및 토복령 추출물의 혼합물을 세포에 처리한 경우 대조군 대비 약 58%의 시너지(synergic)한 중성지방 감소를 나타내었다.The change in triglyceride due to the treatment of this extract is shown in Fig. Compared with the control group, the amount of triglyceride in the adipocyte was decreased by about 26% in the case of the sari extract alone. When the cells were treated with a mixture of sari extracts and soil extracts, they showed a synergic reduction of about 58% compared to the control.

또한 본 발명의 추출물을 처리후 아디포넥틴의 mRNA 발현 양을 비교한 결과에서는 도 3에서 확인할 수 있듯이, 아디포넥틴의 mRNA 양에 있어서 싸리, 토복령 복합추출물을 처리한 경우 대조군 대비 약 1.48배 정도의 mRNA 발현양 증가를 확인하였다. 그러나 싸리 추출물 또는 토복령 추출물을 처리한 경우에서는 대조군 대비 다소 증가된 양을 확인할 수는 있었으나 통계적 유의성을 찾아볼 수 없었다.As shown in FIG. 3, the mRNA expression level of adiponectin mRNA was about 1.48 times higher than that of the control group in the case of treatment with the complex extract of Adiponectin mRNA of the extract of the present invention Respectively. However, there was no statistical significance in the treatment of sari extract or tobaek extract when compared with the control group.

본 발명의 추출물을 처리한 후 렙틴의 mRNA 발현양을 비교한 결과는 도 4에서 확인할 수 있듯이, 렙틴 mRNA의 양에 있어서 싸리 추출물 또는 토복령 추출물을 처리한 경우 대조군 대비 각각 약 0.84배 및 0.93배의 감소를 확인할 수 있었다. 그러나 통계적으로 싸리 추출물 및 토복령 추출물의 혼합물을 처리한 실험군의 경우만 의미있는 감소를 확인 할 수 있었다. 그리고 싸리 추출물 및 토복령 추출물의 혼합물을 처리한 경우 대조군 대비 약 0.50배의 시너지적인 감소 효과를 확인할 수 있었다.
As shown in FIG. 4, leptin mRNA levels of the extracts of the present invention were about 0.84 and 0.93 times higher than that of the control, respectively Of the total population. However, statistically significant reductions were observed only in the experimental group treated with the mixture of the sari extract and the soil extract. When a mixture of sari extracts and soil extracts were treated, the synergistic reduction effect was about 0.50 times as compared with the control.

시험예Test Example 1:  One: 인체시험을Human test 통한 체중 조절 및 비만 개선 효능 Weight Control and Obesity

남성에게 본 발명의 추출물을 섭취하게 하여 섭취 전후 체중 변화 및 체지방 측정을 통해서 체중 조절 및 비만 개선 효과를 확인하였다.
The effect of improving body weight and improving obesity was confirmed through weight change and body fat measurement before and after ingestion of the extract of the present invention.

연구 대상 및 기간Subject and Period

본 검사에 동의한 만 19세 이상 60세 미만의 남녀 50명을 위약(덱스트린)을 섭취한 대조군(placebo)과 본 추출물의 싸리 추출물 및 토복령 추출물의 혼합물(8:2 혼합비)을 섭취한 실험군으로 각 25명(남성 13명, 여성 12명)씩 임의로 분류하여 4주 동안 위약 또는 실험약을 일일 400 ㎎씩 섭취하도록 하였다. 피험자는 체질량지수(Body-Mass Index; BMI)가 23 이상인 사람 또는 복부둘레 남자 90 ㎝, 여자 80 ㎝ 이상인 사람을 선정하였다. 섭취 전과 후에 신장, 체중, 체질량지수, 허리둘레, 혈압, 맥박, 신체조성(체지방율 및 제지방량-임피던스법) 및 혈액검사를 통해 HDL-콜레스테롤, 중성지방 및 총 콜레스테롤 등을 측정하여 본 조성물의 섭취로 인한 체중 조절 및 비만 개선 평가를 실시하였다.
Fifty men and women aged between 19 and 60 years who agreed to this test were divided into two groups: a placebo (placebo) ingested with placebo (dextrin) and an experimental group (Male: 13, female: 12) were randomly assigned to receive 400 ㎎ of placebo or experimental drug for 4 weeks. Body mass index (BMI) of the subjects was 23 or more, or men with circumferential circumference of 90 ㎝ and women of 80 ㎝ or more were selected. The HDL-cholesterol, triglyceride, and total cholesterol were measured by measuring the height, weight, body mass index, waist circumference, blood pressure, pulse, body composition (body fat percentage and fat mass-impedance method) and blood test before and after the ingestion, Weight control and obesity improvement.

체질량Body mass 지수( Indices( BodyBody -- MassMass IndexIndex ))

본 발명의 싸리 혼합물 및 토복령 추출물의 혼합물 섭취군과 위약군의 체질량지수의 결과를 표 3에 나타내었으고, 결과값은 평균과 표준편차로 기입하였으며, 통계처리는 스튜던트 t-테스트를 이용하였고, p<0.05 시에 유의한 것으로 간주하여 표시하였다. Table 3 shows the results of the BMI and the placebo group of the combination of the Sri Lanka extract of the present invention and the Bokbunja extract, and the results were expressed as mean and standard deviation. The statistical treatment was carried out using the Student t -test, p <0.05 was considered to be significant.

시험 결과, 대조군의 체질량지수가 섭취 전후 크게 차이가 없는 반면, 본 발명의 싸리, 토복령 복합추출물 섭취군은 섭취 전에 비해 체질량지수가 약 1.8 kg/m2로 유의한 감소를 보였다. 이로써 본 발명의 조성물이 비만 또는 과체중을 조절 또는 개선시킬 수 있음을 체질량지수의 감소를 통해서 확인하였다.As a result of the test, the body mass index of the control group did not significantly differ before and after the ingestion, whereas the intake of the complex extract of the present invention showed a significant decrease in the body mass index of about 1.8 kg / m 2 before ingestion. This confirms that the composition of the present invention can regulate or ameliorate obesity or overweight by reducing the body mass index.

체질량지수(kg/m2)BMI (kg / m 2 ) 섭취 전Before ingestion 섭취 후After ingestion P P value 실험군
(혼합물)
Experimental group
(mixture)
28.40 ± 0.4828.40 +/- 0.48 26.64 ± 0.5526.64 + - 0.55 0.000 * 0.000 *
대조군Control group 27.8 ± 0.5627.8 ± 0.56 27.45 ± 0.5827.45 ± 0.58 0.970.97

허리둘레Waist circumference

본 발명의 싸리, 토복령 복합추출물 섭취군과 대조군의 허리둘레 측정 결과를 도 5에 나타내었으며, 결과값은 평균과 표준편차로 기입하였고, 통계처리는 스튜던트 t-테스트를 이용하였으며, p<0.05 시에 유의한 것으로 간주하여 표시하였다.FIG. 5 shows the result of measuring the waist circumference of the complex and extract group of the present invention and the control group. The results were expressed as means and standard deviation. The statistical treatment was performed using Student t -test, p <0.05 Were considered to be significant.

시험 결과, 대조군의 체질량지수가 섭취 전후 크게 차이가 없는 반면, 싸리 추출물을 섭취한 실험군의 경우는 섭취전에 비해서 허리둘레가 약 1.94 ㎝ 감소하였으며 혼합물 섭취군은 섭취 전에 비해 허리둘레가 약 4.44 ㎝ 가량 유의한 감소가 관찰되었다. 이로써 본 발명의 조성물이 비만 또는 과체중을 조절 또는 개선시킬 수 있음을 허리둘레 감소를 통해서 확인하였다.
In the test group, the body mass index of the control group was not significantly different before and after ingestion, whereas the waist circumference was decreased by 1.94 ㎝ in the experimental group consuming the sari extract compared to the pre - ingestion group, and the waist circumference was about 4.44 ㎝ A significant decrease was observed. This confirms that the composition of the present invention can regulate or ameliorate obesity or overweight, through reduction in waist circumference.

이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

Claims (10)

싸리(Lespedeza bicolor Turcz.) 추출물 및 토복령(Smilax glabre) 추출물의 10:1 내지 1:10 질량비로 구성된 혼합물을 유효성분으로 포함하는 비만의 예방, 치료 또는 개선용 약제학적 조성물.
A pharmaceutical composition for the prevention, treatment or amelioration of obesity comprising, as an active ingredient, a mixture comprising a 10: 1 to 1: 10 mass ratio of an extract of Lespedeza bicolor Turcz. And an extract of Smilax glabre .
삭제delete 제 1 항에 있어서, 상기 혼합물은 지방세포의 분화를 감소시키는 것을 특징으로 하는 조성물.
2. The composition of claim 1, wherein the mixture reduces the differentiation of adipocytes.
제 1 항에 있어서, 상기 혼합물은 중성지방(triglycerol)의 생성을 감소시키는 것을 특징으로 하는 조성물.
2. The composition of claim 1, wherein the mixture reduces the production of triglycerol.
제 1 항에 있어서, 상기 혼합물은 아디포넥틴(adiponectin)의 발현을 증가시키는 것을 특징으로 하는 조성물.
2. The composition of claim 1, wherein the mixture increases expression of adiponectin.
제 1 항에 있어서, 상기 혼합물은 렙틴(leptin)의 발현을 감소시키는 것을 특징으로 하는 조성물.
2. The composition of claim 1, wherein the mixture reduces the expression of leptin.
제 1 항에 있어서, 상기 혼합물은 체질량지수를 감소시키는 것을 특징으로 하는 조성물.
2. The composition of claim 1, wherein the mixture reduces the body mass index.
제 1 항에 있어서, 상기 혼합물은 허리둘레를 감소시키는 것을 특징으로 하는 조성물.
2. The composition of claim 1, wherein the mixture reduces waist circumference.
싸리(Lespedeza bicolor Turcz.) 추출물 및 토복령(Smilax glabre) 추출물이 10:1 내지 1:10 질량비로 구성된 혼합물을 유효성분으로 포함하는 비만의 예방 또는 개선용 식품 조성물.
A composition for preventing or ameliorating obesity comprising a mixture of Lespedeza bicolor Turcz. Extract and Smilax glabre extract in an amount of 10: 1 to 1:10 by mass as an active ingredient.
싸리(Lespedeza bicolor Turcz.) 추출물 및 토복령(Smilax glabre) 추출물이 10:1 내지 1:10 질량비로 구성된 혼합물을 유효성분으로 포함하는 비만의 예방 또는 개선용 기능성 식품 조성물.A functional food composition for preventing or ameliorating obesity comprising a mixture of Lespedeza bicolor Turcz. Extract and Smilax glabre extract in an amount of 10: 1 to 1:10 by mass as an active ingredient.
KR1020130108773A 2013-09-10 2013-09-10 Composition for Preventing, Treating or Improving of Obesity comprising Extract from Lespedeza bicolor Turcz. or Mixture of Extract from Lespedeza bicolor Turcz. and Extract from Smilax glabre KR101666666B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020130108773A KR101666666B1 (en) 2013-09-10 2013-09-10 Composition for Preventing, Treating or Improving of Obesity comprising Extract from Lespedeza bicolor Turcz. or Mixture of Extract from Lespedeza bicolor Turcz. and Extract from Smilax glabre

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020130108773A KR101666666B1 (en) 2013-09-10 2013-09-10 Composition for Preventing, Treating or Improving of Obesity comprising Extract from Lespedeza bicolor Turcz. or Mixture of Extract from Lespedeza bicolor Turcz. and Extract from Smilax glabre

Publications (2)

Publication Number Publication Date
KR20150029853A KR20150029853A (en) 2015-03-19
KR101666666B1 true KR101666666B1 (en) 2016-10-17

Family

ID=53024088

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020130108773A KR101666666B1 (en) 2013-09-10 2013-09-10 Composition for Preventing, Treating or Improving of Obesity comprising Extract from Lespedeza bicolor Turcz. or Mixture of Extract from Lespedeza bicolor Turcz. and Extract from Smilax glabre

Country Status (1)

Country Link
KR (1) KR101666666B1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101872458B1 (en) 2016-09-02 2018-06-28 주식회사 프롬바이오 Food composition with the extract of Dichrostachys glomerata fruit and the extract of Irvingia gabonensis seed for improvement of obesity and hyperlipidemia
KR102386118B1 (en) * 2020-07-30 2022-04-13 바이오스펙트럼 주식회사 Composition comprising Lespedeza plant extracts for skin volume augmentation

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101225486B1 (en) * 2012-03-30 2013-01-23 연세대학교 산학협력단 Pharmaceutical compositions comprising extract from smilax china linne for preventing or treating obesity hyperlipidemia or fatty liver

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101225486B1 (en) * 2012-03-30 2013-01-23 연세대학교 산학협력단 Pharmaceutical compositions comprising extract from smilax china linne for preventing or treating obesity hyperlipidemia or fatty liver

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
논문(2012)*

Also Published As

Publication number Publication date
KR20150029853A (en) 2015-03-19

Similar Documents

Publication Publication Date Title
KR101620077B1 (en) Composition for Improving, Preventing or Treating Metabolic Diseases comprising Extracts from Borage officinalis
KR101561600B1 (en) Composition for Improving, Preventing or Treating Obesity Comprising Allium sativum L. Extracts and Momordica charanti Extract
KR101495117B1 (en) A Composition comprising the extract of Cudrania tricuspidata trunk as an active ingredient for preventing and treating atopic diseases
KR20180003073A (en) Composition for treating or preventing obesity containing young barley leaves extract
KR102411434B1 (en) Composition for improvementing, preventing or treating obesity and metabolic diseases comprising fractions or extract of radish leave
KR20120002131A (en) Composition for treating or preventing obesity containing curcuma longa extract
KR102416786B1 (en) Composition for improvementing, preventing or treating obesity and metabolic diseases comprising fractions or extract of pepper leave
KR101666666B1 (en) Composition for Preventing, Treating or Improving of Obesity comprising Extract from Lespedeza bicolor Turcz. or Mixture of Extract from Lespedeza bicolor Turcz. and Extract from Smilax glabre
Kamal et al. Antihyperlipidemic effect of Pistacia khinjuk
US11096981B2 (en) Composition for preventing or treating muscle atrophy comprising lycii radicis cortex
JP7303582B2 (en) A composition for prevention, amelioration and treatment of metabolic syndrome associated with obesity and/or diabetes, containing a compound of an Indian gooseberry extract and a young barley leaf extract (IB compound) as an active ingredient
KR101821712B1 (en) Composition for Preventing, Improving or Treating of Th2-Mediated Immune Disease Comprising Extracts from Panax notoginseug, Saponaria officinalis L. , Glycine max L., Phaseolus radiatus L., Phaseolus vulgaris L.
KR20140114801A (en) Composition for improving obesity and fatty liver using an extract of leaves of Sasa quelpaertensis or p-coumaric acid
US11291704B2 (en) Composition for preventing or treating obesity containing ethanolic extract of Ramulus mori
KR20130044286A (en) Pharmaceutical composition for sedation or sleeping induction comprising aster glehni extract as an active ingredient
KR101436213B1 (en) Compositions for prevention and/or treatment of obesity comprising extracts of Boehmeria sieboldiana
KR101754149B1 (en) Anti-Obesity Food Composition Containing Solidago Virgaurea Extract and Method for Preparing the Same
KR102140508B1 (en) A composition for preventing or treating huntington&#39;s disease
KR20200125154A (en) Composition for improvementing, preventing or treating obesity and metabolic diseases comprising fractions or extract of molokhia leave
KR20140041632A (en) Composition for improving obesity and fatty liver using an extract of leaves of sasa quelpaertensis or p-coumaric acid
KR20140145666A (en) Composition comprising natural complex of fucoxanthin, salix babylonica and low molecular weight alginate for preventing or treating of obesity
KR20150113434A (en) A composition comprising the extract of ginseng seed for protecting brain cells and preventing, improving and treating depression
US20220226407A1 (en) Pharmaceutical composition comprising the extract of cannabis sativa as an effective ingredient for preventing or treating of obesity
KR101203111B1 (en) Compositions Comprising Extract from Codonopsis lanceolata for Improving Obesity, Hyperlipidemia or Fatty Liver, and Functional Food Containing The Same
KR101954890B1 (en) A composition for treating or improving non-alcoholic fatty liver disease comprising Seahorse extract

Legal Events

Date Code Title Description
A201 Request for examination
N231 Notification of change of applicant
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20191008

Year of fee payment: 4