JP2018171035A - Nucleic acid molecule and use thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide novel nucleic acids that bind to egg-derived ovomucoid.SOLUTION: A nucleic acid molecule capable of binding to egg-derived ovomucoid is a nucleic acid molecule comprising a polynucleotide (a) or (b): (a) a polynucleotide comprising a specific base sequence or a partial sequence thereof; (b) a polynucleotide that comprises a base sequence having 80% or more identity with the base sequence of (a), and binds to egg-derived ovomucoid.SELECTED DRAWING: Figure 2

Description

  The present invention relates to nucleic acid molecules that bind to egg-derived ovomucoid and uses thereof.

  Eggs are a food that is frequently consumed on a daily basis, but in recent years, the number of patients with egg allergy has increased and is regarded as a problem. Since many processed foods use eggs, it is extremely important to analyze whether or not eggs are mixed as raw materials in processed foods and their production lines.

  Allergic allergens are generally proteins and their degradation products (peptides), and analysis methods using antibodies using these as antigens are the mainstream. Regarding eggs, for example, ovomucoid, an egg white protein, is known as an allergen.

  However, since an antibody is a protein and has a problem in stability, it is difficult to use the antibody for a low-cost and simple test method. Further, electrophoresis, blotting on a nitrocellulose membrane, and the like are necessary, and the operation is complicated. For this reason, in recent years, attention has been focused on nucleic acid molecules that specifically bind to antigens instead of antibodies.

  Therefore, an object of the present invention is to provide a new nucleic acid molecule that binds to egg-derived ovomucoid.

The nucleic acid molecule of the present invention is a nucleic acid molecule that binds to ovomucoid, characterized by comprising any one of the following polynucleotides (a) and (b).
(A) a polynucleotide comprising any one of the nucleotide sequences of SEQ ID NOs: 1 to 3 or a partial sequence of any of the nucleotide sequences of SEQ ID NOs: 1 to 3 (b) 80% or more with respect to the nucleotide sequence of (a) A polynucleotide that binds to egg-derived ovomucoid

  The egg-derived ovomucoid detection reagent of the present invention comprises the nucleic acid molecule of the present invention.

The method for detecting an egg-derived ovomucoid of the present invention comprises contacting the nucleic acid molecule of the present invention or the detection reagent of the present invention with a sample, the egg-derived ovomucoid in the sample, the nucleic acid molecule or the detection reagent, and Forming a complex of:
A step of detecting the complex.

  The nucleic acid molecule of the present invention can bind to egg-derived ovomucoid. Therefore, according to the nucleic acid molecule of the present invention, the egg-derived ovomucoid can be detected based on the presence or absence of binding to the allergen in the sample. Therefore, the nucleic acid molecule of the present invention can be said to be a very useful tool for detecting, for example, allergens derived from eggs in fields such as food production, food management, and food distribution.

FIG. 1 is a presumed secondary structure of aptamers 1 to 3 in Example 1 of the present invention. FIG. 2 is a graph showing the binding of aptamers 1 to 3 to egg-derived ovomucoid in Example 1 of the present invention. FIG. 3 is a presumed secondary structure of aptamers 4 to 6 in Example 2 of the present invention. FIG. 4 is a graph showing the binding properties of aptamers 4 to 6 to egg-derived ovomucoid in Example 2 of the present invention. FIG. 5 is a graph showing the cross-reaction of aptamers 1 to 3 in Example 3 of the present invention. FIG. 6 is a graph showing the cross-reaction of aptamers 4 to 6 in Example 4 of the present invention.

(1) Nucleic acid molecule The nucleic acid molecule of the present invention is a nucleic acid molecule that binds to an egg-derived ovomucoid, characterized in that it comprises any one of the following polynucleotides (a) or (b) as described above. .
(A) a polynucleotide comprising any one of the nucleotide sequences of SEQ ID NOs: 1 to 3 or a partial sequence of any of the nucleotide sequences of SEQ ID NOs: 1 to 3 (b) 80% or more with respect to the nucleotide sequence of (a) A polynucleotide that binds to egg-derived ovomucoid

  In the present invention, the target is an egg-derived ovomucoid. The eggs are, for example, chicken eggs and quail eggs. The egg-derived ovomucoid is, for example, a chicken egg-derived ovomucoid, and specifically, for example, a chicken egg-white ovomucoid. For the nucleic acid of the present invention, for example, a commercially available ovomucoid can be used as an ovomucoid for confirming the binding ability, and specific examples include ovumcoid derived from egg white of chicken eggs (trypsin inhibitor chicken egg white derived T2011, manufactured by Sigma). . The ovomucoid may be, for example, a non-denatured allergen that is not denatured or a denatured allergen that is denatured by heating or the like. In the present invention, the egg-derived ovomucoid is hereinafter also simply referred to as ovomucoid.

  Egg-derived ovomucoid has, for example, trypsin inhibitor activity.

  As described above, the nucleic acid molecule of the present invention can bind to ovomucoid. In the present invention, “to bind to ovomucoid” means, for example, having binding ability to ovomucoid or having binding activity to ovomucoid. The binding between the nucleic acid molecule of the present invention and the ovomucoid can be determined by, for example, surface plasmon resonance molecular interaction (SPR) analysis. For the analysis, for example, BIACORE 3000 (trade name, GE Healthcare UK Ltd.) can be used. Since the nucleic acid molecule of the present invention binds to ovomucoid, it can be used, for example, for detection of ovomucoid.

  The nucleic acid molecule of the present invention is also called a DNA molecule or a DNA aptamer. The nucleic acid molecule of the present invention may be, for example, a molecule composed of any one of the polynucleotides (a) or (b) or a molecule containing the polynucleotide.

  As described above, the polynucleotide (a) is a polynucleotide comprising any one of the nucleotide sequences of SEQ ID NOs: 1 to 3 or a partial sequence of any of the nucleotide sequences of SEQ ID NOs: 1 to 3. The polynucleotides of SEQ ID NOs: 1 to 3 are shown below.

Ovo95C_757TR9m1 (SEQ ID NO: 1)
GGATAGCAGCAGGGACCTCTTATACTGGGTTGGCTGTGGTTGGAATGCCGATGTGAAAAGGGGGTCGAATGATTTGCCCGCTACGATATG
Ovo95C_757TR9m2 (SEQ ID NO: 2)
GGATAGCAGCAGGGACCTCTTATACGGGGTCGACATGCGTGGGGTTGTAAGCATACTTTCTAAGCGAATGATTTGCCCGCTACGATATG
Ovo95C_757TR9m3 (SEQ ID NO: 3)
GGATAGCAGCAGGGACCTCTTATACGCGCTGTGGCTGGATGTTATGTTACCTTTTGCCTAACTCGCGAATGATTTGCCCGCTACGATATG

  The partial sequence is not particularly limited, and examples of the partial sequences of the nucleotide sequences of SEQ ID NOs: 1 to 3 include the nucleotide sequences of SEQ ID NOs: 4 to 6.

Ovo95C_757TR9m1s66 (SEQ ID NO: 4)
GGATAGCAGCAGGGACCTCTTATACTGGGTTGGCTGTGGTTGGAATGCCGATGTGAAAAGGGGGTC
Ovo95C_757TR9m2s76 (SEQ ID NO: 5)
GGATAGCAGCAGGGACCTCTTATACGGGGTCGACATGCGTGGGGTTGTAAGCATACTTTCTAAGCGAATGATTTGC
Ovo95C_757TR9m3s67 (SEQ ID NO: 6)
GGATAGCAGCAGGGACCTCTTATACGCGCTGTGGCTGGATGTTATGTTACCTTTTGCCTAACTCGCG

  In (b), “identity” is not particularly limited, and may be any range as long as the polynucleotide (b) binds to ovomucoid. The identity is, for example, 80% or more, preferably 85% or more, more preferably 90% or more, further preferably 95% or more, 96% or more, 97% or more, particularly preferably 98% or more, and most preferably 99%. % Or more. The identity can be calculated with default parameters using analysis software such as BLAST and FASTA (hereinafter the same).

The polynucleotide in the nucleic acid molecule of the present invention may be, for example, the following polynucleotide (c) or (d). In this case, the nucleic acid molecule of the present invention may be, for example, a molecule composed of the polynucleotide (c) or (d) or a molecule containing the polynucleotide.
(C) a polynucleotide comprising a base sequence complementary to a polynucleotide that hybridizes under stringent conditions to the polynucleotide comprising the base sequence of (a), and binding to an egg-derived ovomucoid (d) A polynucleotide comprising a nucleotide sequence in which one or several bases are deleted, substituted, inserted and / or added in the nucleotide sequence of (a), and binding to an egg-derived ovomucoid

In (c), the “hybridizing polynucleotide” is not particularly limited, and is, for example, a polynucleotide that is completely or partially complementary to the base sequence of (a). The hybridization can be detected by, for example, various hybridization assays. The hybridization assay is not particularly limited, for example, Zanburuku (Sambrook) et al., Eds., "Molecular Cloning: A Laboratory Manual 2nd Edition (Molecular Cloning:. A Laboratory Manual 2 nd Ed) ," [Cold Spring Harbor Laboratory Press (1989)] and the like can also be employed.

In the above (c), the “stringent conditions” may be, for example, any of low stringent conditions, medium stringent conditions, and high stringent conditions. “Low stringent conditions” are, for example, conditions of 5 × SSC, 5 × Denhardt's solution, 0.5% SDS, 50% formamide, and 32 ° C. “Medium stringent conditions” are, for example, 5 × SSC, 5 × Denhardt's solution, 0.5% SDS, 50% formamide, 42 ° C. “High stringent conditions” are, for example, conditions of 5 × SSC, 5 × Denhardt's solution, 0.5% SDS, 50% formamide, 50 ° C. The degree of stringency can be set by those skilled in the art by appropriately selecting conditions such as temperature, salt concentration, probe concentration and length, ionic strength, time, and the like. "Stringent conditions" are, for example, Zanburuku previously described (Sambrook) et al., Eds., "Molecular Cloning: A Laboratory Manual 2nd Edition (Molecular Cloning:. A Laboratory Manual 2 nd Ed) ," [Cold Spring Harbor Laboratory Press ( 1989)]] and the like.

  In the above (d), “one or several” may be, for example, within a range in which the polynucleotide (d) binds to an egg-derived ovomucoid. The “one or several” in the base sequence of (a) is, for example, 1 to 10, preferably 1 to 7, more preferably 1 to 5, further preferably 1 to 3, particularly preferably. Is one or two.

  The nucleic acid molecule of the present invention may include, for example, one of the polynucleotide sequences (a) to (d) or a plurality of the polynucleotide sequences. In the latter case, it is preferable that a plurality of polynucleotide sequences are linked to form a single-stranded polynucleotide. For example, the sequences of the plurality of polynucleotides may be directly linked to each other or indirectly linked via a linker. The polynucleotide sequences are preferably linked directly or indirectly at the respective ends. The sequences of the plurality of polynucleotides may be the same or different, for example, but are preferably the same. When the polynucleotide includes a plurality of sequences, the number of the sequences is not particularly limited, and is, for example, 2 or more, preferably 2 to 12, more preferably 2 to 6, and further preferably 2. is there.

  Examples of the linker include polynucleotides, and examples of the structural unit include nucleotide residues. Examples of the nucleotide residue include a ribonucleotide residue and a deoxyribonucleotide residue. The length of the linker is not particularly limited, and is, for example, 1 to 24 bases, preferably 12 to 24 bases, more preferably 16 to 24 bases, and further preferably 20 to 24 bases. It is long.

  In the nucleic acid molecule of the present invention, the polynucleotide is preferably a single-stranded polynucleotide. The single-stranded polynucleotide is preferably capable of forming a stem structure and a loop structure by, for example, self-annealing. The polynucleotide is preferably capable of forming a stem loop structure, an internal loop structure, and / or a bulge structure, for example.

  The nucleic acid molecule of the present invention may be, for example, double stranded. In the case of a double strand, for example, one single-stranded polynucleotide is any one of the polynucleotides (a) to (d), and the other single-stranded polynucleotide is not limited. Examples of the other single-stranded polynucleotide include a polynucleotide having a base sequence complementary to any one of the polynucleotides (a) to (d). When the nucleic acid molecule of the present invention is double-stranded, it is preferably dissociated into a single-stranded polynucleotide by denaturation or the like prior to use. The dissociated single-stranded polynucleotide of any one of (a) to (d) preferably has, for example, a stem structure and a loop structure as described above.

  In the present invention, “the stem structure and the loop structure can be formed” means, for example, that the stem structure and the loop structure are actually formed, and even if the stem structure and the loop structure are not formed, the stem structure depending on the conditions. And the ability to form a loop structure. “A stem structure and a loop structure can be formed” includes, for example, both experimental confirmation and prediction by a computer simulation.

  The structural unit of the nucleic acid molecule of the present invention is, for example, a nucleotide residue. The length of the nucleic acid molecule is not particularly limited, and the lower limit thereof is, for example, 15 base length, preferably 75 base length or 80 base length, and the upper limit thereof is, for example, 1000 base length, preferably Is 200 bases, 100 bases or 90 bases long.

  Examples of the nucleotide residue include deoxyribonucleotide residue and ribonucleotide residue. Examples of the nucleic acid molecule of the present invention include DNA composed only of deoxyribonucleotide residues, DNA containing one or several ribonucleotide residues, and the like. In the latter case, “1 or several” is not particularly limited, and is, for example, 1 to 3 in the polynucleotide. In the present invention, the numerical range of numbers such as the number of bases and the number of sequences, for example, discloses all positive integers belonging to the range. That is, for example, the description “1 to 3 bases” means all disclosures of “1, 2, 3 bases” (hereinafter the same).

The polynucleotide includes, for example, at least one modified base. The modified base is not particularly limited, and examples thereof include a base modified with a natural base (non-artificial base), and preferably has the same function as the natural base. The natural base is not particularly limited, and examples thereof include a purine base having a purine skeleton and a pyrimidine base having a pyrimidine skeleton. The purine base is not particularly limited, and examples thereof include adenine (a) and guanine (g). The pyrimidine base is not particularly limited, and examples thereof include cytosine (c), thymine (t), uracil (u) and the like. The base modification site is not particularly limited. When the base is a purine base, examples of the purine base modification site include the 7th and 8th positions of the purine skeleton. When the base is a pyrimidine base, examples of the modification site of the pyrimidine base include the 5th and 6th positions of the pyrimidine skeleton. In the pyrimidine skeleton, when “═O” is bonded to the carbon at the 4-position and a group other than “—CH ₃ ” or “—H” is bonded to the carbon at the 5-position, this is called modified uracil or modified thymine. Can do.

The modifying group of the modifying base is not particularly limited, and examples thereof include a methyl group, a fluoro group, an amino group, a thio group, a benzylaminocarbonyl group represented by the following formula (1), and a tryptaminocarbonyl represented by the following formula (2). Group (tryptaminocarbonyl), isobutylaminocarbonyl group (isobutylaminocarbonyl) and the like.

  The modified base is not particularly limited. For example, modified adenine modified with adenine, modified thymine modified with thymine, modified guanine modified with guanine, modified cytosine modified with cytosine and modified modified with uracil Examples include uracil and the like, and the modified thymine, the modified uracil and the modified cytosine are preferable.

  Specific examples of the modified adenine include 7'-deazaadenine.

  Specific examples of the modified guanine include 7'-deazaguanine and the like.

  Specific examples of the modified cytosine include 5'-methylcytosine.

  Specific examples of the modified thymine include 5'-benzylaminocarbonylthymine, 5'-tryptaminocarbonylthymine, 5'-isobutylaminocarbonylthymine and the like.

  Specific examples of the modified uracil include 5'-benzylaminocarbonyluracil (BndU), 5'-tryptaminocarbonyluracil (TrpdU), 5'-isobutylaminocarbonyluracil and the like.

  The polynucleotide is not particularly limited, and may include, for example, only one of the modified bases or two or more of the modified bases.

  The number of the modified base is not particularly limited. In the polynucleotide, the number of the modified base is, for example, one or more. In the polynucleotide, the modified base is, for example, 1 to 80, preferably 1 to 70, more preferably 1 to 50, still more preferably 1 to 40, particularly preferably 1 to 30, and most preferably. 1 to 20 and all the bases may be the modified bases. The number of the modified bases may be, for example, the number of any one of the modified bases or the total number of the two or more modified bases. Further, the modified base in the full length of the nucleic acid molecule containing the polynucleotide is not particularly limited, and is, for example, 1 to 80, 1 to 50, or 1 to 20, preferably the same as the above-mentioned range. It is.

  In the polynucleotide, the ratio of the modified base is not particularly limited. The ratio of the modified base is, for example, 1/100 or more, preferably 1/40 or more, more preferably 1/20 or more, still more preferably 1/10 or more, particularly preferably, of the total number of bases of the polynucleotide. 1/4 or more, most preferably 1/3 or more. Further, the ratio of the modified base in the entire length of the nucleic acid molecule containing the polynucleotide is not particularly limited, and is the same as the above range. Here, the total number of bases is, for example, the total number of natural bases and modified bases in the polynucleotide. The ratio of the modified base is expressed as a fraction, and the total number of bases and the number of modified bases that satisfy this are positive integers.

  When the modified base in the polynucleotide is the modified thymine, the number of the modified thymine is not particularly limited. In the polynucleotide, for example, natural thymine can be substituted for the modified thymine. In the polynucleotide, the number of the modified thymine is, for example, one or more. In the polynucleotide, the modified thymine is, for example, 1 to 80, preferably 1 to 70, more preferably 1 to 50, still more preferably 1 to 40, particularly preferably 1 to 30, and most preferably. 1 to 21 and all the thymines may be the modified thymines.

  In the polynucleotide, the ratio of the modified thymine is not particularly limited. The ratio of the modified thymine is, for example, 1/100 or more, preferably 1/40 or more, more preferably 1/20 or more, further preferably 1 out of the total number of the natural thymine and the modified thymine. / 10 or more, particularly preferably 1/4 or more, and most preferably 1/3 or more.

  When the modified base in the polynucleotide is the modified uracil, the number of the modified uracil is not particularly limited. In the polynucleotide, for example, natural thymine can be substituted for the modified uracil. In the polynucleotide, the number of the modified uracil is, for example, one or more. In the polynucleotide, the modified uracil is, for example, 1 to 80, preferably 1 to 70, more preferably 1 to 50, still more preferably 1 to 40, particularly preferably 1 to 30, and most preferably. 1 to 21 and all the uracils may be the modified uracils.

  In the polynucleotide, the ratio of the modified uracil is not particularly limited. The ratio of the modified uracil is, for example, 1/100 or more, preferably 1/40 or more, more preferably 1/20 or more, and further preferably 1 out of the total number of the natural thymines and the number of the modified uracils. / 10 or more, particularly preferably 1/4 or more, and most preferably 1/3 or more.

  An example of the number of the modified thymine and the modified uracil may be, for example, the total number of both.

  When the modified base in the polynucleotide is the modified cytosine, the number of the modified cytosines is not particularly limited. In the polynucleotide, for example, natural cytosine can be substituted for the modified cytosine. In the polynucleotide, the number of the modified cytosines is, for example, one or more. In the polynucleotide, the modified cytosine is, for example, 1 to 80, preferably 1 to 70, more preferably 1 to 50, still more preferably 1 to 40, particularly preferably 1 to 30, and most preferably. 1 to 21 and all cytosines may be the modified cytosines.

  In the polynucleotide, the ratio of the modified cytosine is not particularly limited. The ratio of the modified cytosine is, for example, 1/100 or more, preferably 1/40 or more, more preferably 1/20 or more, further preferably 1 out of the total number of the natural cytosine and the modified cytosine. / 10 or more, particularly preferably 1/4 or more, and most preferably 1/3 or more.

  When the modified base is the modified adenine or the modified guanine, in the description of the number and ratio of the modified cytosine, “cytosine” and “modified cytosine” are referred to as “adenine” and “modified adenine” or “guanine” and It can be read as “modified guanine”. In the polynucleotide, for example, natural adenine can be substituted with the modified adenine, and for example, natural guanine can be substituted with the modified guanine.

  The nucleic acid molecules of the present invention may contain modified nucleotides. The modified nucleotide may be a nucleotide having the modified base described above, a nucleotide having a modified sugar in which a sugar residue is modified, or a nucleotide having the modified base and the modified sugar.

  The sugar residue is not particularly limited, and examples thereof include deoxyribose residue or ribose residue. The modification site in the sugar residue is not particularly limited, and examples thereof include the 2'-position and the 4'-position of the sugar residue, and both of them may be modified. Examples of the modifying group of the modified sugar include a methyl group, a fluoro group, an amino group, and a thio group.

  In the modified nucleotide residue, when the base is a pyrimidine base, for example, the 2'-position and / or the 4'-position of the sugar residue is preferably modified. Specific examples of the modified nucleotide residue include, for example, a 2′-methylated-uracil nucleotide residue and a 2′-methylated-cytosine nucleotide residue in which the deoxyribose residue or the 2 ′ position of the ribose residue is modified. 2'-fluorinated-uracil nucleotide residues, 2'-fluorinated-cytosine nucleotide residues, 2'-aminated-uracil nucleotide residues, 2'-aminated-cytosine nucleotide residues, 2'-thiolated -Uracyl nucleotide residue, 2'-thiolated-cytosine nucleotide residue and the like.

  The number of the modified nucleotides is not particularly limited. For example, in the polynucleotide, for example, 1 to 80, preferably 1 to 70, more preferably 1 to 50, still more preferably 1 to 40, particularly The number is preferably 1-30, and most preferably 1-21. Further, the modified nucleotides in the entire length of the nucleic acid molecule including the polynucleotide are not particularly limited, and are, for example, 1 to 80, 1 to 50, 1 to 20, and preferably the same as the above-mentioned range. It is.

  The nucleic acid molecule of the present invention may contain, for example, one or several artificial nucleic acid monomer residues. The “one or several” is not particularly limited, and for example, in the polynucleotide, for example, 1 to 80, preferably 1 to 70, more preferably 1 to 50, and further preferably 1 to 40. Particularly preferably 1-30, most preferably 1-21. Examples of the artificial nucleic acid monomer residue include PNA (peptide nucleic acid), LNA (Locked Nucleic Acid), and ENA (2'-O, 4'-C-Ethylenebridged Nucleic Acids). The nucleic acid in the monomer residue is the same as described above, for example. Further, the artificial nucleic acid monomer residue in the entire length of the nucleic acid molecule containing the polynucleotide is not particularly limited, and is, for example, 1 to 80, 1 to 50, or 1 to 20, preferably the above-mentioned Similar to range.

  The nucleic acid molecule of the present invention is preferably resistant to nucleases, for example. The nucleic acid molecule of the present invention preferably has, for example, the modified nucleotide residue and / or the artificial nucleic acid monomer residue for nuclease resistance. Since the nucleic acid molecule of the present invention is nuclease resistant, for example, tens of kDa PEG (polyethylene glycol) or deoxythymidine may be bound to the 5 'end or 3' end.

  The nucleic acid molecule of the present invention may further have an additional sequence, for example. The additional sequence is preferably bound to, for example, at least one of the 5 'end and the 3' end of the nucleic acid molecule, and more preferably the 3 'end. The additional sequence is not particularly limited. The length of the additional sequence is not particularly limited, and is, for example, 1 to 200 bases, preferably 1 to 50 bases, more preferably 1 to 25 bases, and further preferably 18 to 24 bases. It is. The structural unit of the additional sequence is, for example, a nucleotide residue, and examples thereof include a deoxyribonucleotide residue and a ribonucleotide residue. The additional sequence is not particularly limited, and examples thereof include polynucleotides such as DNA consisting of deoxyribonucleotide residues and DNA containing ribonucleotide residues. Specific examples of the additional sequence include poly dT and poly dA.

  The nucleic acid molecule of the present invention can be used, for example, immobilized on a carrier. In the nucleic acid molecule of the present invention, for example, either the 5 'end or the 3' end can be immobilized. When immobilizing the nucleic acid molecule of the present invention, for example, the nucleic acid molecule may be immobilized directly or indirectly on the carrier. In the latter case, the nucleic acid molecule of the present invention is immobilized on the carrier, for example, via the additional sequence. Examples of the carrier include beads, plates, filters, columns, substrates, containers and the like.

  For example, the nucleic acid molecule of the present invention may further have a labeling substance. Specifically, the labeling substance may be bound to the nucleic acid molecule. The nucleic acid molecule to which the labeling substance is bound can also be referred to as a nucleic acid sensor of the present invention, for example. The labeling substance may be bound to, for example, at least one of the 5 'end and the 3' end of the nucleic acid molecule. The labeling with the labeling substance may be, for example, binding or chemical modification. The labeling substance is not particularly limited, and examples thereof include enzymes, fluorescent substances, dyes, isotopes, drugs, toxins, and antibiotics. Examples of the enzyme include luciferase and SA-Lucia luciferase. Examples of the fluorescent substance include pyrene, TAMRA, fluorescein, Cy3 dye, Cy5 dye, FAM dye, rhodamine dye, Texas red dye, JOE, MAX, HEX, TYE and the like, and the dye includes, for example, And Alexa dyes such as Alexa 488 and Alexa 647. The labeling substance may be linked directly to the nucleic acid molecule or indirectly via a linker, for example. The linker is not particularly limited and is, for example, a polynucleotide linker.

  The method for producing the nucleic acid molecule of the present invention is not particularly limited, and can be synthesized, for example, by a known method such as a nucleic acid synthesis method using chemical synthesis or a genetic engineering technique.

  As described above, the nucleic acid molecule of the present invention exhibits binding to ovomucoid. For this reason, the use of the nucleic acid molecule of the present invention is not particularly limited as long as it uses binding to ovomucoid. The nucleic acid molecule of the present invention can be used in various methods in place of, for example, an antibody against ovomucoid.

  According to the nucleic acid molecule of the present invention, ovomucoid can be detected. The method for detecting ovomucoid is not particularly limited, and can be performed by detecting the binding between ovomucoid and the nucleic acid molecule.

(2) Detection reagent and kit As described above, the detection reagent of the present invention is a detection reagent for egg-derived ovomucoid, and includes the nucleic acid molecule of the present invention. The detection reagent of this invention should just contain the nucleic acid molecule of the said this invention, and another structure is not restrict | limited at all. If the detection reagent of the present invention is used, for example, egg-derived ovomucoid can be detected as described above. The detection reagent of the present invention can be said to be a binder to egg-derived ovomucoid, for example.

  The detection reagent of the present invention may further have a labeling substance, for example, and the labeling substance may be bound to the nucleic acid molecule. For the labeling substance, for example, the description in the nucleic acid molecule of the present invention can be used. The detection reagent of the present invention may have, for example, a carrier, and the nucleic acid molecule may be immobilized on the carrier. For the carrier, for example, the description in the nucleic acid molecule of the present invention can be incorporated.

  The detection kit of the present invention comprises the nucleic acid molecule of the present invention or the detection reagent of the present invention. The detection kit of the present invention may further include other components, for example. Examples of the constituent element include a buffer solution for preparing the sample, an instruction manual, and the like. In addition, in the case of a method using a nucleic acid sensor in which a luciferase that is a labeling substance is bound to the nucleic acid molecule and an allergen-labeled carrier shown in the detection method of the present invention described later, the detection kit of the present invention is, for example, A kit containing a nucleic acid sensor and an allergen-labeled carrier (ovomucoid-labeled carrier) can be obtained.

  For the detection reagent and detection kit of the present invention, for example, the description of the nucleic acid molecule of the present invention can be used, and the nucleic acid molecule of the present invention and the detection method of the present invention described later can also be used for the method of use. .

(3) Detection method As described above, the method for detecting an egg-derived ovomucoid of the present invention comprises bringing the nucleic acid molecule of the present invention or the detection reagent of the present invention into contact with a sample, and the egg-derived ovomucoid in the sample. And a step of forming a complex with the nucleic acid molecule or the detection reagent, and a step of detecting the complex. The detection method of the present invention is characterized by using the nucleic acid molecule of the present invention or the detection reagent, and the other steps and conditions are not particularly limited. Hereinafter, the use of the nucleic acid molecule of the present invention will be described as an example, but the nucleic acid molecule of the present invention can be read as the detection reagent of the present invention.

  According to the present invention, since the nucleic acid molecule of the present invention specifically binds to the ovomucoid, for example, by detecting the binding of the ovomucoid and the nucleic acid molecule or the detection reagent, the ovomucoid in the sample is detected. It can be detected specifically. Specifically, for example, since the amount of ovomucoid in a sample can be analyzed, it can be said that qualitative analysis or quantitative analysis is also possible.

  In the present invention, the sample is not particularly limited. Examples of the sample include foods, food materials, food additives, and the like. Examples of the sample include a deposit in a food processing shop or a cooking place, a cleaning liquid after cleaning, and the like.

  The sample may be, for example, a liquid sample or a solid sample. For example, the sample is preferably a liquid sample because it is easy to contact with the nucleic acid molecule and is easy to handle. In the case of the solid sample, for example, a mixed solution, an extract, a dissolved solution, and the like may be prepared using a solvent and used. The solvent is not particularly limited, and examples thereof include water, physiological saline, and buffer solution.

  The detection method of the present invention will be described with reference to an example of a method for detecting ovomucoid using the nucleic acid sensor of the present invention labeled with a labeling substance as the nucleic acid molecule of the present invention. In addition, this invention is not restrict | limited to these illustrations.

  The detection step further includes, for example, a step of analyzing the presence or amount of ovomucoid in the sample based on the detection result of the complex.

  In the complex formation step, the method for contacting the sample and the nucleic acid molecule is not particularly limited. The contact between the sample and the nucleic acid molecule is preferably performed in a liquid, for example. The liquid is not particularly limited, and examples thereof include water, physiological saline, and buffer solution.

  In the complex formation step, the contact condition between the sample and the nucleic acid molecule is not particularly limited. The contact temperature is, for example, 4 to 37 ° C., preferably 18 to 25 ° C., and the contact time is, for example, 10 to 120 minutes, preferably 30 to 60 minutes.

  In the complex forming step, the nucleic acid molecule may be, for example, an immobilized nucleic acid molecule (solid phase carrier) immobilized on a carrier or an unfixed free nucleic acid molecule. In the latter case, for example, the sample is contacted in a container. In the former case, the carrier is not particularly limited, and examples thereof include a plate, a filter, a column, a substrate, a bead, and a container. Examples of the container include a microplate and a tube. The nucleic acid molecule is immobilized as described above, for example.

  As described above, the detection step is a step of detecting the binding between the ovomucoid in the sample and the nucleic acid molecule. By detecting the presence or absence of binding between the two, for example, the presence or absence of ovomucoid in the sample can be analyzed (qualitative), and by detecting the degree of binding (binding amount) between the two, for example, the sample Analyzes (quantifies) the amount of ovomucoid in it.

  The method for detecting the binding between ovomucoid and the nucleic acid molecule is not particularly limited. As the method, for example, a conventionally known method for detecting binding between substances can be adopted, and specific examples thereof include the SPR described above.

  When the binding between the ovomucoid and the nucleic acid molecule cannot be detected, it can be determined that there is no ovomucoid in the sample, and when the binding is detected, it can be determined that the ovomucoid is present in the sample. It is also possible to obtain a correlation between the concentration of ovomucoid and the binding amount in advance, and to analyze the concentration of ovomucoid in the sample from the binding amount based on the correlation.

  As an example of the detection of the binding between the ovomucoid and the nucleic acid molecule, a method using a nucleic acid sensor in which a luciferase as a labeling substance is bound to the nucleic acid molecule and an egg-derived ovomucoid labeled carrier is shown below.

  First, the nucleic acid sensor and the sample are mixed. Thereby, when the egg-derived ovomucoid is present in the sample, the nucleic acid molecule in the nucleic acid sensor binds to the target egg-derived ovomucoid. On the other hand, when the egg-derived ovomucoid is not present in the sample, the nucleic acid molecule in the nucleic acid sensor is in an unbound state with the target.

  Next, after the mixture is brought into contact with the egg-derived ovomucoid labeled carrier, the ovomucoid labeled carrier is removed. Examples of the carrier include beads. In the mixture, when the nucleic acid sensor is bound to the egg-derived ovomucoid, the nucleic acid molecule in the nucleic acid sensor cannot bind to the egg-derived ovomucoid in the ovomucoid-labeled carrier. For this reason, when a luciferase substrate is added to the fraction from which the ovomucoid-labeled carrier has been removed to perform a luminescence reaction, luminescence is generated by the luciferase catalytic reaction in the nucleic acid sensor. On the other hand, when the nucleic acid sensor is not bound to the egg-derived ovomucoid in the mixture, the nucleic acid molecule in the nucleic acid sensor binds to the egg-derived ovomucoid in the ovomucoid labeled carrier. For this reason, by removing the ovomucoid labeled carrier, the nucleic acid sensor is also removed while bound to the ovomucoid labeled carrier. For this reason, when the luciferase substrate is added to the fraction from which the ovomucoid-labeled carrier has been removed and the luminescence reaction is performed, the luciferase catalyzed luminescence occurs due to the absence of the nucleic acid sensor. Absent. For this reason, the presence or absence of egg-derived ovomucoid in the sample can be analyzed (qualitative analysis) based on the presence or absence of luminescence. In addition, since the amount of egg-derived ovomucoid in the sample and the amount of the nucleic acid sensor remaining in the fraction after removing the ovomucoid labeled carrier have a correlation, depending on the intensity of luminescence, The amount of egg-derived ovomucoid can also be analyzed (quantitative analysis).

  According to the present invention, as described above, an egg-derived ovomucoid that is an allergen can be detected. In addition, according to the present invention, the presence or absence of an egg or egg white can also be detected indirectly, for example, by detecting the egg-derived ovomucoid which is the allergen.

  Next, examples of the present invention will be described. However, the present invention is not limited by the following examples. Commercial reagents were used based on those protocols unless otherwise indicated.

[Example 1]
About the aptamer of this invention, the binding property with respect to the egg white origin ovomucoid of a chicken egg was confirmed by SPR analysis.

(1) Aptamer Aptamers 1 to 3 of the following polynucleotides were synthesized as aptamers of Examples. In the underlined portion of the following polynucleotide, “T” is a deoxyribonucleotide residue having 5′-tryptaminocarbonyluracil (TrpdU) in which 5-position of thymine is substituted in place of natural thymine (T), “C” was all deoxyribonucleotide residues having 5′-methylcytosine substituted at the 5-position of cytosine in place of natural cytosine (C).

Aptamer 1: Ovo95C_757TR9m1 (SEQ ID NO: 1)
GGATAGCAGCAGGGACCTCTTATAC TGGGTTGGCTGTGGTTGGAATGCCGATGTGAAAAGGGGGTCGAATGATTTGCCCGCTACGATATG
Aptamer 2: Ovo95C_757TR9m2 (SEQ ID NO: 2)
GGATAGCAGCAGGGACCTCTTATAC GGGGTCGACATGCGTGGGGTTGTAAGCATACTTTCTAAGCGAATGATTTGCCCGCTACGATATG
Aptamer 3: Ovo95C_757TR9m3 (SEQ ID NO: 3)
GGATAGCAGCAGGGACCTCTTATAC GCGCTGTGGCTGGATGTTATGTTACCTTTTGCCTAACTCGCGAATGATTTGCCCGCTACGATATG

  The estimated secondary structures of aptamers 1 to 3 are shown in FIGS. 1 (A) to (C), respectively. However, it is not limited to this.

  The aptamer was added with polydeoxyadenine (poly dA) having a length of 20 bases at the 3 'end and used as a poly dA addition aptamer in SPR described later. The poly dA-added aptamer used was heat-denatured at 95 ° C. for 5 minutes.

(2) Sample Ovomucoid derived from egg white of chicken eggs (T2011, manufactured by Sigma) was suspended in SB1T buffer, dissolved overnight, and then centrifuged (12,000 rpm, 15 minutes, room temperature) for separation. The separated supernatant was obtained as an extract containing native ovomucoid. This was used as an ovomucoid sample. The composition of the SB1T buffer was 40 mmol / L HEPES, 125 mmol / L NaCl, 5 mmol / L KCl, 1 mmol / L MgCl ₂ and 0.01% Tween (registered trademark) 20, and the pH was 7.5. Further, the ovomucoid sample was heat-treated at 95 ° C. for 10 minutes to obtain a heated ovomucoid sample.

(3) Analysis of binding by SPR For analysis of binding, ProteON XPR36 (BioRad) was used according to the instruction manual.

  First, as a ProteON dedicated sensor chip, a chip (trade name: ProteOn NLC Sensor Chip, BioRad) on which streptavidin was immobilized was set in the ProteON XPR36. 10 μmol / L of biotinylated poly dT was injected into the flow cell of the sensor chip using ultrapure water (DDW) and allowed to bind until the signal intensity (RU: Resonance Unit) was saturated. The biotinylated poly dT was prepared by biotinylating the 5 'end of 20 base long deoxythymidine. Then, using the SB1T buffer containing 0.1 mM Sodium Dextran sulfate 5000 (196-13401, Wako) in the flow cell of the chip, 200 nmol / L of the poly dA-added aptamer is flown at a flow rate of 25 μL / min. Injected for 2 seconds and allowed to bind until the signal intensity was saturated. Subsequently, each of the samples having a predetermined protein concentration (100 ppm) was injected for 120 seconds at a flow rate of 25 μL / min using SB1T buffer containing 1 mM Sodium Dextran sulfate 5000, and subsequently, under the same conditions, 1 mM Sodium. Washing was performed by flowing SB1T buffer containing Dextran sulfate 5000.

  These results are shown in FIG. FIG. 2 is a graph showing the binding properties of aptamers 1 to 3 to 100 ppm egg-derived ovomucoid. (A) shows aptamer 1, (B) shows aptamer 2, and (C) shows the result of aptamer 3. . The horizontal axis represents the elapsed time (seconds) after the start of injection of the sample, and the vertical axis represents the signal intensity (RU).

  As shown in FIG. 2, all of the aptamers 1 to 3 showed binding properties to the heated and non-heated egg-derived ovomucoid samples.

[Example 2]
About the miniaturized aptamer of this invention, the binding property with respect to an egg origin ovomucoid was confirmed by SPR analysis.

  As the aptamer, the following miniaturized aptamers 4 to 6 were used, and the binding analysis by SPR was performed in the same manner as in Example 1.

  Aptamers 4 to 6 of the following polynucleotides were synthesized as miniaturized aptamers of Examples. The aptamers 4 to 6 are aptamers obtained by miniaturizing the aptamers 1 to 3 (SEQ ID NOs: 1 to 3) of Example 1. In the underlined portion of the following polynucleotide, “T” is all deoxyribonucleotide residues having 5′-benzylaminocarbonyluracil (BndU) substituted at the 5-position of thymine instead of natural thymine (T), “C” was all deoxyribonucleotide residues having 5′-methylcytosine substituted at the 5-position of cytosine in place of natural cytosine (C).

Aptamer 4: Ovo95C_757TR9m1s66 (SEQ ID NO: 4)
GGATAGCAGCAGGGACCTCTTATAC TGGGTTGGCTGTGGTTGGAATGCCGATGTGAAAAGGGGGTC
Aptamer 5: Ovo95C_757TR9m2s76 (SEQ ID NO: 5)
GGATAGCAGCAGGGACCTCTTATAC GGGGTCGACATGCGTGGGGTTGTAAGCATACTTTCTAAGCGAATGATTTGC
Aptamer 6: Ovo95C_757TR9m3s67 (SEQ ID NO: 6)
GGATAGCAGCAGGGACCTCTTATAC GCGCTGTGGCTGGATGTTATGTTACCTTTTGCCTAACTCGCG

  The putative secondary structures of aptamers 4 to 6 are shown in FIG. However, it is not limited to this.

  The result is shown in FIG. FIG. 4 is a graph showing the binding properties of aptamers 4 to 6 to a 100 ppm ovomucoid sample. (A) is a miniaturized aptamer 4, (B) is a miniaturized aptamer 5, and (C) is a miniaturized aptamer. The result of 6 is shown. The horizontal axis represents the elapsed time (seconds) after the start of injection of the sample, and the vertical axis represents the signal intensity (RU). As shown in FIG. 4, all of the miniaturized aptamers 4 to 6 in which the aptamers 1 to 3 were miniaturized showed binding properties to the heated and non-heated egg-derived ovomucoid samples.

  From the above results, it was found that the aptamer of the present invention binds to egg-derived ovomucoid and can be detected by measurement.

[Example 3]
For the aptamer of the present invention, cross-reactivity was confirmed by SPR analysis.

In the following binding test, each sample was prepared from the materials shown below for confirmation of the cross-reaction of the aptamer. The egg sample was prepared by crushing whole eggs in a food processor, suspending in SB1T buffer, dissolving overnight, centrifuging (10,000 g, 30 minutes, room temperature), separating, and separating the eggs. Sei was filtered through a 0.8 mm filter, and the resulting extract was used as an egg sample. Further, the egg sample was heat-treated at 95 ° C. for 10 minutes, centrifuged (12,000 rpm, 10 minutes) and separated, and the separated supernatant was used as a heated egg sample. The gluten sample was prepared in the same manner as the ovomucoid sample. Milk samples and peanut samples were prepared in the same manner as the egg samples.
Wheat-derived gluten (073-00575, manufactured by Wako Pure Chemical Industries, Ltd.)
Milk (made by Ashigara Dairy Co., Ltd.)
Peanuts (made by Indian tea curry shop RT)

  Example 1 except that the aptamers 2 and 3 were used as aptamers and the non-heated egg sample, the heated egg sample, the gluten sample, the milk sample, and the peanut sample were used as samples. Then, the binding analysis by SPR was performed. The concentration in each sample (100 ppm) indicates the concentration of protein for the gluten sample, and the concentration of total protein contained in each sample for the egg sample, milk sample, and peanut sample.

  These results are shown in FIG. FIG. 5 is a graph showing the cross-reaction of aptamers 2 and 3, wherein the horizontal axis shows the elapsed time (seconds) after the start of injection of the sample, and the vertical axis shows the signal intensity (RU).

  As shown in FIG. 5 (A), the aptamer 2 showed binding properties to the heated egg sample. On the other hand, for the gluten sample and the milk sample, the signal intensity was 100 or less, and the binding property was weak. Moreover, as shown in FIG. 5 (B), the aptamer 3 showed binding property to the non-heated egg sample. On the other hand, for the gluten sample, the milk sample, and the peanut sample, the signal intensity was about 100 or less, and the binding property was weak. From these results, it was found that aptamers 2 and 3 bind to egg samples with excellent specificity. Since aptamers 2 and 3 selectively bind to egg-derived ovomucoid, it can be said that the ability to bind to an egg sample showed binding to an egg-derived ovomucoid contained in the egg sample.

[Example 4]
The cross-reactivity of the miniaturized aptamer of the present invention was confirmed by SPR analysis.

  The binding analysis by SPR was performed in the same manner as in Example 3 except that the miniaturized aptamers 4 to 6 were used as aptamers.

  The result is shown in FIG. FIG. 6 is a graph showing the cross-reaction of the miniaturized aptamers 4 to 6, (A) is the miniaturized aptamer 4, (B) is the miniaturized aptamer 5, and (C) is the result of the miniaturized aptamer 6. Indicates. The horizontal axis represents the elapsed time (seconds) after the start of injection of the sample, and the vertical axis represents the signal intensity (RU).

  As shown in FIG. 6 (A), the miniaturized aptamer 4 obtained by miniaturizing the aptamer 1 showed high binding properties to the heated and non-heated egg samples. On the other hand, for the gluten sample and the milk sample, the signal intensity was 10 or less, and the binding property was weak. Moreover, as shown in FIG. 6 (B), the miniaturized aptamer 5 obtained by miniaturizing the aptamer 2 showed high binding properties to the heated egg sample. On the other hand, for the gluten sample, the milk sample, and the peanut sample, the signal intensity was 40 or less, and the binding property was weak. Furthermore, as shown in FIG. 6 (C), the miniaturized aptamer 6 in which the aptamer 3 was miniaturized showed high binding properties to the unheated egg sample. On the other hand, for the gluten sample, the milk sample, and the peanut sample, the signal intensity was 60 or less and the binding property was weak. From these results, it was found that the miniaturized aptamers 4 to 6 bind with excellent specificity to the egg-derived ovomucoid. Since the miniaturized aptamers 4 to 6 selectively bind to the egg-derived ovomucoid, it can be said that the binding to the egg sample showed the binding to the egg-derived ovomucoid contained in the egg sample. .

  From the above results, it was found that the aptamer of the present invention specifically binds to egg-derived ovomucoid and can be detected by measurement.

  Although the present invention has been described with reference to the exemplary embodiments and examples, the present invention is not limited to the above exemplary embodiments and examples. Various changes that can be understood by those skilled in the art can be made to the configuration and details of the present invention within the scope of the present invention.

  The nucleic acid molecule of the present invention can bind to egg-derived ovomucoid. Therefore, according to the nucleic acid molecule of the present invention, the egg-derived ovomucoid can be detected based on the presence or absence of binding to the allergen in the sample. For this reason, the nucleic acid molecule of the present invention can be said to be an extremely useful tool for detecting, for example, allergens derived from eggs in fields such as food production, food management, and food distribution.

Claims (15)

A nucleic acid molecule that binds to an egg-derived ovomucoid, comprising the polynucleotide of any one of (a) and (b) below:
(A) a polynucleotide comprising any one of the nucleotide sequences of SEQ ID NOs: 1 to 3 or a partial sequence of any of the nucleotide sequences of SEQ ID NOs: 1 to 3 (b) 80% or more with respect to the nucleotide sequence of (a) A polynucleotide that binds to egg-derived ovomucoid The nucleic acid molecule according to claim 1, wherein the partial sequences of the nucleotide sequences of SEQ ID NOs: 1 to 3 are the nucleotide sequences of SEQ ID NOs: 4 to 6, respectively. The nucleic acid molecule according to claim 1 or 2, wherein in the polynucleotide, at least one thymine is a modified base, and the modified base of the thymine is at least one of a modified thymine and a modified uracil. 4. The polynucleotide according to claim 1, wherein, in the polynucleotide, at least one-twentieth of the total number of bases of thymine is a modified base, and the modified base of thymine is at least one of modified thymine and modified uracil. The nucleic acid molecule according to claim 1. The nucleic acid molecule according to any one of claims 1 to 4, wherein, in the polynucleotide, all thymines are modified bases, and the modified base of the thymine is at least one of modified thymine and modified uracil. The nucleic acid molecule according to any one of claims 1 to 5, wherein in the polynucleotide, at least one cytosine is a modified base. The nucleic acid molecule according to any one of claims 1 to 6, wherein in the polynucleotide, at least one-twentieth of the total number of bases of cytosine is a modified base. The nucleic acid molecule according to any one of claims 1 to 7, wherein in the polynucleotide, all cytosines are modified bases. The nucleic acid molecule according to any one of claims 1 to 8, wherein the polynucleotide is DNA. An egg-derived ovomucoid detection reagent comprising the nucleic acid molecule according to any one of claims 1 to 9. Furthermore, it has a labeling substance,
The detection reagent according to claim 10, wherein the labeling substance is bound to the nucleic acid molecule. The detection reagent according to claim 11, wherein the labeling substance is an enzyme. The detection reagent according to claim 12, wherein the enzyme is luciferase. The nucleic acid molecule according to any one of claims 1 to 9 or the detection reagent according to any one of claims 10 to 13 and a sample are contacted, and the egg-derived ovomucoid in the sample, Forming a complex with a nucleic acid molecule or the detection reagent, and
A method for detecting an egg-derived ovomucoid comprising the step of detecting the complex. The detection method according to claim 14, wherein the detection is qualitative analysis or quantitative analysis.