JP6963221B2 - Nucleic acid molecules and their uses - Google Patents

Description

The present invention relates to nucleic acid molecules that bind to TNF-α and their uses.

Cytokines are bioactive substances associated with inflammation and immune response, and are responsible for information transmission between various cells in homeostasis maintenance mechanisms such as nerve, endocrine, and immune system. TNF-α (Tumor Necrosis Factor-α) is known as an inflammatory cytokine, and in recent years, TNF-α has been used as a biomarker for inflammation-related diseases in diagnosis, risk stratification, prognosis prediction, treatment progress determination, etc. Research is underway. (Non-Patent Documents 1 and 2)

As a method for analyzing TNF-α, an analysis method using an antibody using TNF-α as an antigen is known. However, since the antibody is a protein and has a problem in stability, it is difficult to use the antibody in a low-cost and simple test method. In addition, electrophoresis and blotting on a nitrocellulose membrane are required, and the operation is complicated. For this reason, in recent years, a nucleic acid molecule that specifically binds to an antigen has attracted attention instead of an antibody.

Health Studies 28 pp37-45 (2016) Onoe et al. Journal of the Japanese Society of Internal Medicine Vol. 103, No. 2, 345-352 (2014)

Therefore, an object of the present invention is to provide a new nucleic acid molecule that binds to TNF-α.

The nucleic acid molecule of the present invention is a nucleic acid molecule that binds to TNF-α, which comprises any of the following polynucleotides (a) or (b).
(A) A polynucleotide consisting of the base sequence of SEQ ID NO: 1 or 2 or a partial sequence of the base sequence of SEQ ID NO: 1 or 2 (b) A base having 80% or more identity with respect to the base sequence of (a) above. A polynucleotide consisting of a sequence and binding to TNF-α

The TNF-α detection reagent of the present invention is characterized by containing the nucleic acid molecule of the present invention.

In the method for detecting TNF-α of the present invention, the nucleic acid molecule of the present invention or the detection reagent of the present invention is brought into contact with a sample, and TNF-α in the sample and the nucleic acid molecule or the detection reagent are used. And the process of forming a complex of
It is characterized by including a step of detecting the complex.

The nucleic acid molecule of the present invention is capable of binding to TNF-α. Therefore, according to the nucleic acid molecule of the present invention, TNF-α can be detected depending on the presence or absence of binding to TNF-α in the sample. Therefore, the nucleic acid molecule of the present invention can be said to be an extremely useful tool for detecting TNF-α in the field of medicine and the like.

FIG. 1 is an estimated secondary structure of aptamers 1 to 3 in Example 1 of the present invention. FIG. 2 is a graph showing the binding of aptamers 1 to 3 to TNF-α in Example 1 of the present invention. FIG. 3 is a graph showing the binding of aptamers 1 to 3 to TNF-α in Example 1 of the present invention. FIG. 4 is a graph showing the binding of aptamers 1 to 3 to TNF-α in Example 2 of the present invention. FIG. 5 is a graph showing the results of the pull-down assay in Example 3 of the present invention.

(1) Nucleic Acid Molecule As described above, the nucleic acid molecule of the present invention is a nucleic acid molecule that binds to TNF-α, which comprises any of the following polynucleotides (a) and (b).
(A) A polynucleotide consisting of the base sequence of SEQ ID NO: 1 or 2 or a partial sequence of the base sequence of SEQ ID NO: 1 or 2 (b) A base having 80% or more identity with respect to the base sequence of (a) above. A polynucleotide consisting of a sequence and binding to TNF-α

In the present invention, the target is TNF-α. TNF-α (UniProtID: P01375) is produced as a 25 kDa membrane-bound protein and is cleaved to a 17 kDa soluble protein. TNF-α may be, for example, the membrane-bound protein or the soluble protein. Regarding the nucleic acid of the present invention, for example, commercially available TNF-α can be used as TNF-α for confirming the binding ability, and TNF-α (Human, Recombinant, PeproTech, # 300-01A) is exemplified as a specific example. can. TNF-α is, for example, human-derived TNF-α. The TNF-α may be, for example, an undenatured protein that has not been denatured, or a denatured protein that has been denatured by heating or the like.

The nucleic acid molecule of the present invention can bind to TNF-α as described above. In the present invention, "binding to TNF-α" is also referred to as having, for example, binding property to TNF-α or binding activity to TNF-α. The binding between the nucleic acid molecule of the present invention and TNF-α can be determined, for example, by surface plasmon resonance molecule interaction (SPR) analysis or the like. For the analysis, for example, BIACORE 3000 (trade name, GE Healthcare UK Ltd.) can be used. Since the nucleic acid molecule of the present invention binds to TNF-α, it can be used, for example, for detecting TNF-α.

The nucleic acid molecule of the present invention has a dissociation constant indicating a binding force to TNF-α, for example, 20 nM or less, 17 nM or less, 11 nM or less, 10 nM or less.

The nucleic acid molecule of the present invention is also referred to as a DNA molecule or a DNA aptamer. The nucleic acid molecule of the present invention may be, for example, a molecule composed of the polynucleotide of either (a) or (b), or a molecule containing the polynucleotide.

As described above, the polynucleotide (a) is a polynucleotide consisting of the base sequence of either SEQ ID NO: 1 or 2 or a partial sequence of the base sequence of any of SEQ ID NO: 1 or 2. The polynucleotides of SEQ ID NOs: 1 and 2 are shown below.

TNF-KS9R8m1 (SEQ ID NO: 1)
GGAATTGACACCTCGCCGTTTATGAAAC T AGCCCG T AACC TTT CACCA T CAA TT CC T AAGGC T GGC T GGC T AC T A T AC
TNF-KS9rank1 (SEQ ID NO: 2)
GGAATTGACACCTCGCCGTTTATGACAAAC T AAGCCCCC T C T GGAAA TT AACAGCC T AAGGC T GGC T GGC T AC T A T AC

The subsequence is not particularly limited, and examples thereof include the base sequence of SEQ ID NO: 3 as a subsequence of the base sequence of SEQ ID NO: 1.

TNF-KS9R8m1s61s15 (SEQ ID NO: 3)
ACCTCGCCGTTTATGAAAC T AGCCCG T AACC TTT CACCA T CAA TT CC T AAGG

In the above (b), the "identity" is not particularly limited, and may be, for example, a range in which the polynucleotide of the above (b) binds to TNF-α. The identity is, for example, 80% or more, preferably 85% or more, more preferably 90% or more, still more preferably 95% or more, 96% or more, 97% or more, particularly preferably 98% or more, most preferably 99. % Or more. The identity can be calculated with default parameters using, for example, analysis software such as BLAST or FASTA (the same applies hereinafter).

The polynucleotide in the nucleic acid molecule of the present invention may be, for example, the polynucleotide of (c) or (d) below. In this case, the nucleic acid molecule of the present invention may be, for example, a molecule composed of the polynucleotide of (c) or (d), or a molecule containing the polynucleotide.
(C) A polynucleotide having a base sequence complementary to a polynucleotide that hybridizes under stringent conditions with respect to the polynucleotide having the base sequence of (a) above, and a polynucleotide that binds to TNF-α (d). In the base sequence of (a), a polynucleotide consisting of a base sequence in which one or several bases are deleted, substituted, inserted and / or added and binds to TNF-α.

In (c), the "hybridizing polynucleotide" is not particularly limited, and is, for example, a polynucleotide that is completely or partially complementary to the base sequence of (a). The hybridization can be detected by, for example, various hybridization assays. The hybridization assay is not particularly limited, for example, Zanburuku (Sambrook) et al., Eds., "Molecular Cloning: A Laboratory Manual 2nd Edition (Molecular Cloning:. A Laboratory Manual 2 nd Ed) ," [Cold Spring Harbor Laboratory Press (1989)] and the like can also be adopted.

In (c) above, the "stringent condition" may be, for example, any of a low stringent condition, a medium stringent condition, and a high stringent condition. “Low stringent conditions” are, for example, conditions of 5 × SSC, 5 × Denhardt solution, 0.5% SDS, 50% formamide, 32 ° C. “Medium stringent conditions” are, for example, 5 × SSC, 5 × Denhardt's solution, 0.5% SDS, 50% formamide, 42 ° C. “High stringent conditions” are, for example, conditions of 5 × SSC, 5 × Denhardt solution, 0.5% SDS, 50% formamide, 50 ° C. The degree of stringency can be set by those skilled in the art by appropriately selecting conditions such as temperature, salt concentration, probe concentration and length, ionic strength, and time. "Stringent conditions" are, for example, Zanburuku previously described (Sambrook) et al., Eds., "Molecular Cloning: A Laboratory Manual 2nd Edition (Molecular Cloning:. A Laboratory Manual 2 nd Ed) ," [Cold Spring Harbor Laboratory Press ( 1989)] and the like can also be adopted.

In (d), "1 or several" may be, for example, a range in which the polynucleotide of (d) binds to TNF-α. In the base sequence of (a), the "1 or several" is, for example, 1 to 10, preferably 1 to 7, more preferably 1 to 5, still more preferably 1 to 3, particularly preferably. Is one or two.

The nucleic acid molecule of the present invention may contain, for example, one sequence of any of the polynucleotides (a) to (d), or may contain a plurality of sequences of the polynucleotide. In the latter case, it is preferable that sequences of a plurality of polynucleotides are linked to form a single-stranded polynucleotide. The sequences of the plurality of polynucleotides may be directly linked to each other, or may be indirectly linked to each other via a linker, for example. The sequences of the polynucleotides are preferably directly or indirectly linked at their respective ends. The sequences of the plurality of polynucleotides may be, for example, the same or different, but are preferably the same. When a plurality of sequences of the polynucleotide are contained, the number of the sequences is not particularly limited, and is, for example, 2 or more, preferably 2 to 12, more preferably 2 to 6, and even more preferably 2. be.

The linker may be, for example, a polynucleotide, and its constituent unit may be, for example, a nucleotide residue. Examples of the nucleotide residue include a ribonucleotide residue and a deoxyribonucleotide residue. The length of the linker is not particularly limited, and is, for example, 1 to 24 bases in length, preferably 12 to 24 bases in length, more preferably 16 to 24 bases in length, and further preferably 20 to 24 bases in length. It is long.

In the nucleic acid molecule of the present invention, the polynucleotide is preferably a single-stranded polynucleotide. It is preferable that the single-stranded polynucleotide can form a stem structure and a loop structure by, for example, self-annealing. It is preferable that the polynucleotide can form, for example, a stem loop structure, an internal loop structure and / or a bulge structure.

The nucleic acid molecule of the present invention may be, for example, double-stranded. In the case of double strands, for example, one single-stranded polynucleotide is any of the above-mentioned polynucleotides (a) to (d), and the other single-stranded polynucleotide is not limited. Examples of the other single-stranded polynucleotide include a polynucleotide having a base sequence complementary to any of the polynucleotides (a) to (d). When the nucleic acid molecule of the present invention is double-stranded, for example, it is preferable to dissociate it into a single-stranded polynucleotide by denaturation or the like prior to use. Further, it is preferable that the dissociated single-stranded polynucleotide according to any one of (a) to (d) forms, for example, a stem structure and a loop structure as described above.

In the present invention, "the stem structure and the loop structure can be formed" means, for example, that the stem structure and the loop structure are actually formed, and even if the stem structure and the loop structure are not formed, the stem structure is conditional. And the ability to form loop structures. The term "stem structure and loop structure can be formed" includes, for example, both the case of experimental confirmation and the case of prediction by simulation of a computer or the like.

The structural unit of the nucleic acid molecule of the present invention is, for example, a nucleotide residue. The length of the nucleic acid molecule is not particularly limited, and the lower limit thereof is, for example, 15 base bases, preferably 75 bases or 80 bases, and the upper limit thereof is, for example, 1000 bases. Is 200 bases long, 100 bases long or 90 bases long.

Examples of the nucleotide residue include a deoxyribonucleotide residue and a ribonucleotide residue. Examples of the nucleic acid molecule of the present invention include DNA composed of only deoxyribonucleotide residues, and DNA containing one or several ribonucleotide residues. In the latter case, "1 or several" is not particularly limited, and is, for example, 1 to 3 in the polynucleotide. In the present invention, the numerical range of the number of bases, the number of sequences, etc. discloses, for example, all positive integers belonging to the range. That is, for example, the description of "1 to 3 bases" means all disclosures of "1, 2, 3 bases" (hereinafter, the same applies).

The polynucleotide may contain a natural base or a modified base as a base in a nucleotide residue. The natural base (non-artificial base) is not particularly limited, and examples thereof include a purine base having a purine skeleton and a pyrimidine base having a pyrimidine skeleton. The purine base is not particularly limited, and examples thereof include adenine (a) and guanine (g). The pyrimidine base is not particularly limited, and examples thereof include cytosine (c), thymine (t), and uracil (u), and cytosine (c) and thymine (t) are preferable.

When the polynucleotide has the modified base, the site and the number thereof are not particularly limited. When the polynucleotide of (a) or a partial sequence thereof has the modified base, for example, a part or all of the underlined thymine in the polynucleotide of SEQ ID NO: 1-3 is the modified base. The modified base is preferably modified thymine in which a thymine base is modified.

The modified base is, for example, a base modified with a modifying group. The base modified by the modifying group (modified base) is, for example, the natural base. Examples of the natural base include purine bases and pyrimidine bases. The modified base is not particularly limited, and examples thereof include modified adenine, modified guanine, modified cytosine, modified thymine, and modified uracil.

As for the modified base, for example, the modified base may be directly modified with the modifying group, or the modified base may be indirectly modified with the modifying group. In the latter case, for example, the modified base may be modified with the modifying group via a linker. The linker is not particularly limited.

The site of the modified base modified by the modifying group is not particularly limited. When the base is a purine base, the modification site of the purine base includes, for example, the 7-position and the 8-position of the purine skeleton, and the 7-position is preferable. When the base is a pyrimidine base, the modification site of the pyrimidine base includes, for example, the 5th and 6th positions of the pyrimidine skeleton, and the 5th position is preferable. When the 5-position of the pyrimidine base is modified, thymine has a methyl group on the carbon at the 5-position, so that the modifying group may be directly or indirectly bonded to the carbon at the 5-position, for example. However, the modifying group may be directly or indirectly bonded to the carbon of the methyl group bonded to the carbon at the 5-position. In the pyrimidine skeleton, when "= O" is bonded to the carbon at the 4-position and _{a group other than "-CH 3} " or "-H" is bonded to the carbon at the 5-position, it means modified uracil or modified thymine. Can be done.

When the modifying base is modified thymine, the modifying group is preferably an adenine residue. That is, in the modified base, for example, the base is modified with the adenine residue. The site where the adenine residue modifies the modified base is not particularly limited, and examples thereof include an amino group bonded to the carbon at position 6 of the adenine residue. The modified base modified with the adenine residue is not particularly limited, but for example, thymine is preferable, and the carbon of the methyl group bonded to the carbon at the 5-position of thymine is modified with the adenine residue. Is preferable.

Specific examples of the thymidine nucleotide residue modified with the adenine residue in the polynucleotide include a residue represented by the following chemical formula (1) (hereinafter, also referred to as “KS9”). The present invention is not limited to this.

In the polynucleotide of SEQ ID NO: 1-3, for example, the underlined thymine is preferably the nucleotide residue of KS9.

When the nucleic acid molecule of the present invention has, for example, the thymidine nucleotide residue, for the synthesis of the polynucleotide, for example, the nucleotide triphosphate represented by the following chemical formula (2) (hereinafter, also referred to as “KS9 monomer”) is used. , Can be used as a monomer molecule. In the synthesis of the polynucleotide, for example, the monomer molecule binds to another nucleotide triphosphate by a phosphodiester bond.

Examples of the modifying group include a methyl group, a fluoro group, an amino group, a thio group, a benzylaminocarbonyl group, a tryptaminocarbonyl group, an isobutylaminocarbonyl group and the like. Be done.

Specific examples of the modified thymine include, for example, 7'-deazaadenin, specific examples of the modified guanine include, for example, 7'-deazaguanine, and specific examples of the modified cytosine include, for example. , 5'-Methylcytosine and the like, and specific examples of the modified thymine include, for example, 5'-benzylaminocarbonylthymine, 5'-tryptaminocarbonyltimine, 5'-isobutylaminocarbonyltimine and the like. Specific examples of the modified uracil include 5'-benzylaminocarbonyl uracil (BndU), 5'-tryptaminocarbonyl uracil (TrpdU) and 5'-isobutylaminocarbonyl uracil. The above-exemplified modified uracil can also be said to be a modified base of thymine.

The polynucleotide may contain, for example, only one of the modified bases, or may contain two or more of the modified bases.

The number of the modified bases is not particularly limited. In the polynucleotide, the number of the modified bases is, for example, one or more. The modified base is, for example, 1 to 80, preferably 1 to 70, more preferably 1 to 50, still more preferably 1 to 40, particularly preferably 1 to 30, and most preferably 1 to 30 in the polynucleotide. Is 1 to 20, and all the bases may be the modified bases. The number of the modified bases may be, for example, the number of any one type of the modified bases, or the total number of the two or more types of the modified bases. Further, the modified base in the total length of the nucleic acid molecule containing the polynucleotide is also not particularly limited, and is, for example, 1 to 80, 1 to 50, and 1 to 20, preferably the same as the above range. Is.

In the polynucleotide, the proportion of the modified base is not particularly limited. The ratio of the modified base is, for example, 1/100 or more, preferably 1/40 or more, more preferably 1/20 or more, still more preferably 1/10 or more, particularly preferably 1/10 or more, of the total number of bases of the polynucleotide. It is 1/4 or more, most preferably 1/3 or more. Further, the ratio of the modified base to the total length of the nucleic acid molecule containing the polynucleotide is also not particularly limited and is the same as the above range. Here, the total number of bases is, for example, the sum of the number of natural bases and the number of modified bases in the polynucleotide. The ratio of the modified bases is shown as a fraction, and the total number of bases and the number of modified bases satisfying the ratio are positive integers, respectively.

When the modified base in the polynucleotide is the modified thymine, the number of the modified thymine is not particularly limited. In the polynucleotide, for example, natural thymine can be replaced with the modified thymine. In the polynucleotide, the number of the modified thymines is, for example, one or more. In the polynucleotide, the modified thymine is, for example, 1 to 80, preferably 1 to 70, more preferably 1 to 50, still more preferably 1 to 40, particularly preferably 1 to 30, most preferably. Is 1 to 21, and all thymines may be the modified thymines.

The proportion of the modified thymine in the polynucleotide is not particularly limited. The ratio of the modified thymine is, for example, 1/100 or more, preferably 1/40 or more, more preferably 1/20 or more, still more preferably 1 of the total of the number of the natural thymine and the number of the modified thymine. It is / 10 or more, particularly preferably 1/4 or more, and most preferably 1/3 or more.

The nucleic acid molecule of the present invention may contain modified nucleotides. The modified nucleotide may be a nucleotide having the above-mentioned modified base, a nucleotide having a modified sugar in which a sugar residue is modified, or a nucleotide having the modified base and the modified sugar.

The sugar residue is not particularly limited, and examples thereof include a deoxyribose residue and a ribose residue. The modification site in the sugar residue is not particularly limited, and examples thereof include the 2'-position and the 4'-position of the sugar residue, and both of them may be modified. Examples of the modifying group of the modified sugar include a methyl group, a fluoro group, an amino group, a thio group and the like.

When the base is a pyrimidine base in the modified nucleotide residue, for example, it is preferable that the 2'position and / or the 4'position of the sugar residue are modified. Specific examples of the modified nucleotide residue include, for example, a deoxyribose residue or a 2'-methylated-uracil nucleotide residue in which the 2'position of the ribose residue is modified, and a 2'-methylated-cytosine nucleotide residue. , 2'-fluoroylated-uracil nucleotide residue, 2'-fluorolated-citosine nucleotide residue, 2'-aminoated-uracil nucleotide residue, 2'-aminoated-citosine nucleotide residue, 2'-thiolation -Uracil nucleotide residues, 2'-thiolation-cytosine nucleotide residues and the like.

The number of the modified nucleotides is not particularly limited, and for example, in the polynucleotide, for example, 1 to 80, preferably 1 to 70, more preferably 1 to 50, still more preferably 1 to 40, in particular. The number is preferably 1 to 30, most preferably 1 to 21. Further, the modified nucleotide in the total length of the nucleic acid molecule including the polynucleotide is also not particularly limited, and is, for example, 1 to 80, 1 to 50, and 1 to 20, preferably the same as the above range. Is.

The nucleic acid molecule of the present invention may contain, for example, one or several artificial nucleic acid monomer residues. The "1 or several" is not particularly limited, and for example, in the polynucleotide, for example, 1 to 80 pieces, preferably 1 to 70 pieces, more preferably 1 to 50 pieces, still more preferably 1 to 40 pieces. , Particularly preferably 1 to 30, and most preferably 1 to 21. Examples of the artificial nucleic acid monomer residue include PNA (peptide nucleic acid), LNA (Locked Nucleic Acid), ENA (2'-O, 4'-C-Ethylene Bridged Nucleic Acids) and the like. The nucleic acid at the monomer residue is, for example, the same as described above. Further, the artificial nucleic acid monomer residue in the total length of the nucleic acid molecule containing the polynucleotide is also not particularly limited, and is, for example, 1 to 80, 1 to 50, and 1 to 20, preferably the above-mentioned. Similar to range.

The nucleic acid molecule of the present invention is preferably, for example, nuclease resistant. The nucleic acid molecule of the present invention preferably has, for example, the modified nucleotide residue and / or the artificial nucleic acid monomer residue because of nuclease resistance. Since the nucleic acid molecule of the present invention is nuclease resistant, for example, PEG (polyethylene glycol) of several tens of kDa, deoxythymidine, or the like may be bound to the 5'end or 3'end.

The nucleic acid molecule of the present invention may, for example, further have an additional sequence. The additional sequence is preferably attached to at least one of the 5'end and the 3'end of the nucleic acid molecule, more preferably the 3'end. The additional sequence is not particularly limited. The length of the additional sequence is not particularly limited, and is, for example, 1 to 200 bases long, preferably 1 to 50 bases long, more preferably 1 to 25 bases long, and even more preferably 18 to 24 bases long. Is. The structural unit of the additional sequence is, for example, a nucleotide residue, and examples thereof include a deoxyribonucleotide residue and a ribonucleotide residue. The additional sequence is not particularly limited, and examples thereof include polynucleotides such as DNA consisting of deoxyribonucleotide residues and DNA containing ribonucleotide residues. Specific examples of the additional sequence include poly dT, poly dA and the like.

The nucleic acid molecule of the present invention can be used, for example, by immobilizing it on a carrier. The nucleic acid molecule of the present invention can, for example, immobilize either the 5'end or the 3'end. When the nucleic acid molecule of the present invention is immobilized, for example, the nucleic acid molecule may be immobilized directly on the carrier or indirectly. In the latter case, the nucleic acid molecule of the present invention is immobilized on the carrier, for example, via the addition sequence. Examples of the carrier include beads, plates, filters, columns, substrates, containers and the like.

The nucleic acid molecule of the present invention may further have, for example, a labeling substance, and specifically, the labeling substance may be bound to the nucleic acid molecule. The nucleic acid molecule to which the labeling substance is bound can also be referred to as, for example, the nucleic acid sensor of the present invention. The labeling substance may be attached to at least one of the 5'end and the 3'end of the nucleic acid molecule, for example. Labeling with the labeling substance may be, for example, binding or chemical modification. The labeling substance is not particularly limited, and examples thereof include enzymes, fluorescent substances, dyes, isotopes, drugs, toxins, and antibiotics. Examples of the enzyme include luciferase and SA-Lucia luciferase. Examples of the fluorescent substance include fluorescent groups such as pyrene, TAMRA, fluorescein, Cy3 dye, Cy5 dye, FAM dye, rhodamine dye, Texas red dye, JOE, MAX, HEX, and TYE. Examples thereof include Alexa dyes such as Alexa 488 and Alexa 647. The labeling substance may be directly linked to the nucleic acid molecule, for example, or may be indirectly linked via a linker. The linker is not particularly limited, and is, for example, a polynucleotide linker and the like.

The method for producing a nucleic acid molecule of the present invention is not particularly limited, and for example, it can be synthesized by a known method such as a nucleic acid synthesis method using chemical synthesis or a genetic engineering method.

As described above, the nucleic acid molecule of the present invention exhibits binding property to TNF-α. Therefore, the use of the nucleic acid molecule of the present invention is not particularly limited as long as it is used for utilizing the binding property to TNF-α. The nucleic acid molecule of the present invention can be used in various methods, for example, in place of an antibody against TNF-α.

According to the nucleic acid molecule of the present invention, TNF-α can be detected. The method for detecting TNF-α is not particularly limited, and can be performed by detecting the binding between TNF-α and the nucleic acid molecule.

(2) Detection Reagent and Kit As described above, the detection reagent of the present invention is a TNF-α detection reagent and is characterized by containing the nucleic acid molecule of the present invention. The detection reagent of the present invention may contain the nucleic acid molecule of the present invention, and other configurations are not limited at all. By using the detection reagent of the present invention, for example, TNF-α can be detected as described above. The detection reagent of the present invention can be said to be, for example, a binder to TNF-α.

The detection reagent of the present invention may further have, for example, a labeling substance, and the labeling substance may be bound to the nucleic acid molecule. As the labeling substance, for example, the description in the nucleic acid molecule of the present invention can be incorporated. Further, the detection reagent of the present invention may have, for example, a carrier, and the nucleic acid molecule may be immobilized on the carrier. For the carrier, for example, the description in the nucleic acid molecule of the present invention can be incorporated.

The detection kit of the present invention contains the nucleic acid molecule of the present invention or the detection reagent of the present invention. The detection kit of the present invention may further include, for example, other components. Examples of the component include a buffer solution for preparing the sample, an instruction manual, and the like. Further, in the case of the method using the nucleic acid sensor in which the labeling substance luciferase is bound to the nucleic acid molecule and the labeling carrier shown in the detection method of the present invention described later, the detection kit of the present invention is, for example, the nucleic acid. It can be a kit that includes a sensor and a TNF-α labeled carrier.

The detection reagent and detection kit of the present invention can, for example, refer to the description of the nucleic acid molecule of the present invention, and can also refer to the nucleic acid molecule of the present invention and the detection method of the present invention described later for the method of use thereof. ..

(3) Detection Method In the method for detecting TNF-α of the present invention, as described above, the nucleic acid molecule of the present invention or the detection reagent of the present invention is brought into contact with the sample, and TNF-α in the sample is brought into contact with the sample. It is characterized by including a step of forming a complex with the nucleic acid molecule or the detection reagent, and a step of detecting the complex. The detection method of the present invention is characterized by using the nucleic acid molecule of the present invention or the detection reagent, and other steps and conditions are not particularly limited. Hereinafter, the use of the nucleic acid molecule of the present invention will be described as an example, but the nucleic acid molecule of the present invention can be read as the detection reagent of the present invention.

According to the present invention, since the nucleic acid molecule of the present invention specifically binds to TNF-α, for example, by detecting the binding of TNF-α to the nucleic acid molecule or the detection reagent, a sample The TNF-α in it can be specifically detected. Specifically, for example, since the amount of TNF-α in a sample can be analyzed, it can be said that qualitative analysis or quantitative analysis is also possible.

In the present invention, the sample is not particularly limited. Examples of the sample include fluid, urine, blood and the like.

The sample may be, for example, a liquid sample or a solid sample. The sample is preferably a liquid sample because, for example, it is easy to come into contact with the nucleic acid molecule and is easy to handle. In the case of the solid sample, for example, a mixture, an extract, a solution, or the like may be prepared using a solvent and used. The solvent is not particularly limited, and examples thereof include water, physiological saline, and a buffer solution.

The detection method of the present invention will be described by taking as an example a method of detecting TNF-α using the nucleic acid sensor of the present invention labeled with a labeling substance as the nucleic acid molecule of the present invention. The present invention is not limited to these examples.

The detection step further includes, for example, analyzing the presence or absence or amount of TNF-α in the sample based on the detection result of the complex.

In the complex forming step, the contact method between the sample and the nucleic acid molecule is not particularly limited. The contact between the sample and the nucleic acid molecule is preferably carried out, for example, in a liquid. The liquid is not particularly limited, and examples thereof include water, physiological saline, and a buffer solution.

In the complex forming step, the contact conditions between the sample and the nucleic acid molecule are not particularly limited. The contact temperature is, for example, 4 to 37 ° C., preferably 18 to 25 ° C., and the contact time is, for example, 10 to 120 minutes, preferably 30 to 60 minutes.

In the complex formation step, the nucleic acid molecule may be, for example, an immobilized nucleic acid molecule (solid phase carrier) immobilized on a carrier or an unfixed free nucleic acid molecule. In the latter case, for example, in a container, the sample is brought into contact with the sample. In the former case, the carrier is not particularly limited, and examples thereof include plates, filters, columns, substrates, beads, containers, and the like, and examples of the containers include microplates, tubes, and the like. Immobilization of the nucleic acid molecule is, for example, as described above.

As described above, the detection step is a step of detecting the binding between TNF-α and the nucleic acid molecule in the sample. By detecting the presence or absence of binding between the two, for example, the presence or absence of TNF-α in the sample can be analyzed (qualitative), and by detecting the degree of binding between the two (the amount of binding), for example. The amount of TNF-α in the sample can be analyzed (quantitative).

The method for detecting the binding between TNF-α and the nucleic acid molecule is not particularly limited. As the method, for example, a conventionally known method for detecting a bond between substances can be adopted, and specific examples thereof include the above-mentioned SPR and the like.

Then, when the binding between TNF-α and the nucleic acid molecule cannot be detected, it can be determined that TNF-α does not exist in the sample, and when the binding is detected, TNF-α is detected in the sample. Can be determined to exist. It is also possible to determine the correlation between the concentration of TNF-α and the binding amount in advance, and analyze the concentration of TNF-α in the sample from the binding amount based on the correlation.

Regarding the detection of the binding between TNF-α and the nucleic acid molecule, as an example, a method using a nucleic acid sensor in which the nucleic acid molecule is bound to luciferase, which is a labeling substance, and a TNF-α-labeled carrier is shown below.

First, the nucleic acid sensor and the sample are mixed. As a result, when TNF-α is present in the sample, the nucleic acid molecule in the nucleic acid sensor binds to the target TNF-α. On the other hand, when TNF-α is not present in the sample, the nucleic acid molecule in the nucleic acid sensor is in an unbound state with the target.

Next, the mixture is brought into contact with the TNF-α labeled carrier and then the TNF-α labeled carrier is removed. Examples of the carrier include beads. In the mixture, when the nucleic acid sensor is bound to TNF-α, the nucleic acid molecule in the nucleic acid sensor cannot bind to TNF-α in the TNF-α labeled carrier. Therefore, when a substrate of luciferase is added to the fraction from which the TNF-α-labeled carrier has been removed and a luminescence reaction is carried out, luminescence is generated by the catalytic reaction of luciferase in the nucleic acid sensor. On the other hand, in the mixture, when the nucleic acid sensor is not bound to TNF-α, the nucleic acid molecule in the nucleic acid sensor binds to TNF-α in the TNF-α labeled carrier. Therefore, by removing the TNF-α-labeled carrier, the nucleic acid sensor is also removed in a state of being bound to the TNF-α-labeled carrier. Therefore, when a luciferase substrate is added to the fraction from which the TNF-α-labeled carrier has been removed and a luminescence reaction is carried out, the nucleic acid sensor does not exist, and therefore luminescence due to the catalytic reaction of luciferase. Does not occur. Therefore, the presence or absence of TNF-α in the sample can be analyzed (qualitative analysis) depending on the presence or absence of light emission. Further, since the amount of TNF-α in the sample and the amount of the nucleic acid sensor remaining in the fraction after removing the TNF-α-labeled carrier have a correlation, the sample depends on the intensity of luminescence. The amount of TNF-α in it can also be analyzed (quantitative analysis).

Next, examples of the present invention will be described. However, the present invention is not limited by the following examples. Commercially available reagents were used based on those protocols unless otherwise indicated.

[Example 1]
The binding property of the aptamer of the present invention to TNF-α was confirmed by SPR analysis.

(1) Aptamers The aptamers 1 to 3 of the following polynucleotides were synthesized as the aptamers of the examples. The aptamer 3 is a miniaturized aptamer of the aptamer 1. In the underlined portion of the polynucleotide below, all "T" s were KS9 instead of natural thymine (T).

Aptamer 1: TNF-KS9R8m1 (SEQ ID NO: 1)
GGAATTGACACCTCGCCGTTTATGAAAC T AGCCCG T AACC TTT CACCA T CAA TT CC T AAGGC T GGC T GGC T AC T A T AC
Aptamer 2: TNF-KS9rank1 (SEQ ID NO: 2)
GGAATTGACACCTCGCCGTTTATGACAAAC T AAGCCCCC T C T GGAAA TT AACAGCC T AAGGC T GGC T GGC T AC T A T AC
Aptamer 3: TNF-KS9R8m1s61s15 (SEQ ID NO: 3)
ACCTCGCCGTTTATGAAAC T AGCCCG T AACC TTT CACCA T CAA TT CC T AAGG

The estimated secondary structures of aptamers 1 to 3 are shown in FIGS. 1 (A) to 1 (C), respectively. However, it is not limited to this.

The 20-base-long polydeoxyadenine (poly dA) was added to the 3'end of the aptamer, and the aptamer was used as a poly dA-added aptamer for SPR described later. The poly dA-added aptamer used was heat-denatured at 95 ° C. for 5 minutes.

(2) Sample TNF-α (Human, Recombinant, PeproTech, # 300-01A) was suspended in SB1T buffer, dissolved overnight, and then centrifuged (12,000 rpm, 15 minutes, room temperature) and separated. The separated supernatant was obtained as an extract containing TNF-α. This was used as a TNF-α sample. The composition of the SB1T buffer was 40 mmol / L HEPES, 125 mmol / L NaCl, 5 mmol / L KCl, 1 mmol / L MgCl _2, and 0.01% Tween® 20, and the pH was 7.5.

Further, in order to confirm the cross-reactivity of the aptamer, an α-amylase sample and an s-IgA sample were prepared from the following materials in the same manner as the TNF-α sample.
α-Amylase (Lee Biosolutions, # 120-10)
s-IgA (IgA (Secretory), Human, MP Biomedicals, LLC-Cappel Products, # 55905)

(3) Analysis of binding property ProteON XPR36 (BioRad) was used for the analysis of binding property according to the instruction manual.

First, as the sensor chip dedicated to ProteON, a chip on which streptavidin was immobilized (trade name: ProteOn NLC Sensor Chip, BioRad) was set in the ProteON XPR36. 5 μmol / L biotinylated poly dT was injected into the flow cell of the sensor chip using ultrapure water (DDW) and bound until the signal intensity (RU: Resonance Unit) was saturated. The biotinylated poly dT was prepared by biotinlating the 5'end of 20 base length deoxythymidine. Then, the poly dA-added aptamer at 200 nmol / L was injected into the flow cell of the chip at a flow rate of 25 μL / min for 80 seconds using an SB1T buffer, and bound until the signal intensity was saturated. Subsequently, each of the samples having a predetermined protein concentration (400 nmol / L) was injected using the SB1T buffer at a flow rate of 50 μL / min for 120 seconds, and subsequently, under the same conditions, the SB1T buffer was allowed to flow for 300 seconds for washing. Was done. After the injection of the sample, the signal intensity was measured, and the average value (RU115-125) of the signal intensity (RU) at 115 to 125 seconds was determined with the injection start of the sample as 0 second. Then, the ratio of the RU value (RUimmov) to RU115-125 (RU115-125 / RUimmov) when the poly dA-added aptamer was bound to the biotinylated poly dT was calculated.

These results are shown in FIGS. 2 and 3. FIG. 2 is a graph showing the binding of aptamers 1 to 3 to 400 nmol / L TNF-α, the horizontal axis represents each sample in aptamers 1 to 3, and the vertical axis represents the signal intensity (RU). show. On the horizontal axis, the TNF-α sample, the α-amylase sample, and the s-IgA sample are shown in order from the left. As shown in FIG. 2, aptamers 1 to 3 showed binding property to TNF-α. In addition, aptamer 3, which is a miniaturized aptamer of aptamer 1, showed higher binding property to TNF-α as compared with aptamer 1. On the other hand, aptamers 1 to 3 had a signal intensity of about 0 or less and did not show binding property to the α-amylase sample and the s-IgA sample. From this result, it was found that aptamers 1 to 3 bind to TNF-α with excellent specificity.

FIG. 3 is a graph showing the binding of aptamers 1 to 3 to 400 nmol / L TNF-α, where (A) is the result of aptamer 1, (B) is the result of aptamer 2, and (C) is the result of aptamer 3. Is shown. The horizontal axis represents the elapsed time (seconds) after the start of injection of the sample, and the vertical axis represents the signal intensity (RU). As shown in FIG. 3, aptamers 1 to 3 showed binding property to TNF-α. On the other hand, for the α-amylase sample and the s-IgA sample, the signal intensity was about 0 or less, and no binding property was exhibited. From this result, it was found that aptamers 1 to 3 bind to TNF-α with excellent specificity.

From the above results, it was found that the aptamer of the present invention binds to TNF-α and can be detected by measurement.

[Example 2]
For the aptamer of the present invention, the dissociation constant for TNF-α was determined.

The aptamers 1 to 3 were used as the aptamers, and the binding property was analyzed in the same manner as in Example 1 except that the concentrations of TNF-α in the sample were 25, 50, 100, 200, and 400 nmol / L. Was done.

The result is shown in FIG. FIG. 4 is a graph showing the binding of aptamers 1 to 3 to TNF-α, where (A) shows the results of aptamer 1, (B) shows the results of aptamer 2, and (C) shows the results of aptamer 3. The horizontal axis represents the elapsed time (seconds) after the start of injection of the sample, and the vertical axis represents the signal intensity (RU). As shown in FIG. 4, the signal intensities of aptamers 1 to 3 increased as the concentration of TNF-α increased.

Further, the dynamic parameters were calculated from the results of the SPR analysis shown in FIG. As a result, the aptamer 1 has a dissociation constant (KD) with respect to TNF-α of 10.4 × ^10-9 mol / L, and the aptamer 2 has a dissociation constant (KD) with respect to TNF-α of 16.7 ×. It was ^10-9 mol / L, and the dissociation constant (KD) of Aptamar 3 with respect to TNF-α was 10.0 × ^10-9 mol / L, which was found to be excellent binding.

[Example 3]
A pull-down assay was performed on the aptamer of the present invention to confirm its binding property to TNF-α.

By attaching a 5'-biotinylated forward primer having a 5'end biotinylated to the complementary strand of the aptamer 1 and extending it in a buffer containing the modified base, the complementary strand and the 5'end are biotinylated. A double strand with the above-mentioned aptamer 1 was prepared. Aptamer-bound beads were prepared by binding the duplex to streptavidin beads and then treating with 20 mmol / L NaOH to remove the complementary strand. Further, control beads were produced in the same manner except that the primer was bound to the streptavidin beads instead of the aptamer.

Next, 30 pmol of the aptamer-bound beads was mixed with SB1T buffer containing 2 μg of TNF-α. Then, the mixed solution was incubated at room temperature for 1 hour while shaking at 1000 rpm to bind TNF-α to the aptamer-bound beads. The beads were washed 3 times with SB1T buffer, mixed with SB1T buffer containing 2% SDS, and the mixed solution was shaken at room temperature for 10 minutes to elute the protein bound to the beads. The eluted protein is mixed with SDS buffer (62.5 mM Tris, 2% SDS, 5% sucrose, 0.002% Bromophenol blue, 1% 2-Melcaptoethanol) and heat-treated at 95 ° C. for 10 minutes. bottom. Then, it was ice-cooled and subjected to electrophoresis by a polyacrylamide gel (PAGEL C520L, manufactured by ATTO). The migration buffer was 25 mM Tris, 192 mM Glycine, and 0.1% SDS. After electrophoresis, the gel was stained with a staining solution (Gel Code, manufactured by Thermo SCIENTIFIC, # 24594) at room temperature for 30 minutes, and then photographed with ChemiDoc (manufactured by Bio Rad). Further, the experiment was carried out in the same manner except that the SB1T buffer (drain / SB1T buffer) containing 90% of the solution was used instead of the SB1T buffer.

The result is shown in FIG. FIG. 5 is an electrophoretic photograph showing the results of the pull-down assay. Lane 1 is a pull-down in the SB1T buffer of the aptamer-bound beads, lane C1 is the pull-down in the SB1T buffer of the control beads, and lane 2 is the aptamer-bound beads. Liquid / SB1T buffer pull-down, lane C2 shows the results of control bead electrophoresis / SB1T buffer pull-down. In the figure, lane M is a marker for electrophoresis, and lane TNF-α is a positive control of TNF-α. Further, in the figure, the arrow on the gel near 15 kDa indicates the band of TNF-α.

As shown by the arrows in lanes 1 and 2 of FIG. 5, a band of TNF-α was detected in the SB1T buffer and in the pull-down in the fluid / SB1T buffer when the aptamer 1 bound beads were used. That is, aptamer 1 bound to TNF-α. On the other hand, as shown in lanes C1 and C2 of FIG. 5, when the control beads were used, the band of TNF-α was not detected in the pull-down in the SB1T buffer and the fluid / SB1T buffer.

From the above results, it was found that the aptamer of the present invention binds to TNF-α in buffer and solution.

Although the present invention has been described above with reference to the embodiments and examples, the present invention is not limited to the above embodiments and examples. Various changes that can be understood by those skilled in the art can be made within the scope of the present invention in terms of the structure and details of the present invention.

Some or all of the above embodiments may also be described, but not limited to:

(Appendix 1)
A nucleic acid molecule that binds to TNF-α, which comprises any of the following polynucleotides (a) or (b).
(A) A polynucleotide consisting of the base sequence of SEQ ID NO: 1 or 2 or a partial sequence of the base sequence of SEQ ID NO: 1 or 2 (b) A base having 80% or more identity with respect to the base sequence of (a) above. A polynucleotide consisting of a sequence and binding to TNF-α (Appendix 2)
A reagent for detecting TNF-α, which comprises the nucleic acid molecule described in Appendix 1.
(Appendix 3)
In addition, it has a labeling substance and
The detection reagent according to Appendix 2, wherein the labeling substance is bound to the nucleic acid molecule.
(Appendix 4)
The detection reagent according to Appendix 3, wherein the labeling substance is an enzyme.
(Appendix 5)
The detection reagent according to Appendix 4, wherein the enzyme is luciferase.
(Appendix 6)
The nucleic acid molecule described in Appendix 1 or the detection reagent according to any one of Supplements 2 to 5 is brought into contact with the sample to form a complex of TNF-α in the sample and the nucleic acid molecule or the detection reagent. Process to make and
A method for detecting TNF-α, which comprises a step of detecting the complex.
(Appendix 7)
The detection method according to Appendix 6, wherein the detection is qualitative analysis or quantitative analysis.

The nucleic acid molecule of the present invention is capable of binding to TNF-α. Therefore, according to the nucleic acid molecule of the present invention, TNF-α can be detected depending on the presence or absence of binding to TNF-α in the sample. Therefore, the nucleic acid molecule of the present invention can be said to be an extremely useful tool for detecting TNF-α, for example, in the field of medicine and the like.

Claims (9)

A nucleic acid molecule that binds to TNF-α, which comprises any of the following polynucleotides (a) or (b).
(A) relative to SEQ ID NO: 1, 2 or 3 nucleotide sequence or Ranaru polynucleotide (b) the nucleotide sequence of SEQ ID NO: 1, the base sequence having 80% or more identity, and of SEQ ID NO: 3 Polynucleotide TNF-KS9R8m1 containing a base sequence and binding to TNF-α (SEQ ID NO: 1)
GGAATTGACACCTCGCCGTTTATGAAAC T AGCCCG T AACC TTT CACCA T CAA TT CC T AAGGC T GGC T GGC T AC T A T AC
TNF-KS9rank1 (SEQ ID NO: 2)
GGAATTGACACCTCGCCGTTTATGACAAAC T AAGCCCCC T C T GGAAA TT AACAGCC T AAGGC T GGC T GGC T AC T A T AC
TNF-KS9R8m1s61s15 (SEQ ID NO: 3)
ACCTCGCCGTTTATGAAAC T AGCCCG T AACC TTT CACCA T CAA TT CC T AAGG In the polynucleotides, at least one thymine, a modified base, according to claim 1 Symbol placement of the nucleic acid molecule. Wherein the polynucleotide of the total number of bases thymine, 1 or more 20 minutes, a modified base, a nucleic acid molecule of claim 1 or 2 wherein. Wherein the polynucleotide thymine represented by the underlined portion in each of the base sequence is a modified base, a nucleic acid molecule according to any one of claims 1 to 3. The nucleic acid molecule according to claim 3 or 4 , wherein the modifying group in the modified thymine is an adenine residue. The nucleic acid molecule according to any one of claims 1 to 5 , wherein the polynucleotide is DNA. A reagent for detecting TNF-α, which comprises the nucleic acid molecule according to any one of claims 1 to 6. In addition, it has a labeling substance and
The detection reagent according to claim 7 , wherein the labeling substance is bound to the nucleic acid molecule. The nucleic acid molecule according to any one of claims 1 to 6 or the detection reagent according to claim 7 or 8 is brought into contact with the sample, and TNF-α in the sample and the nucleic acid molecule or the detection thereof are brought into contact with each other. The process of forming a complex with the reagent, and
A method for detecting TNF-α, which comprises a step of detecting the complex.

Images