JP2015168628A - Keratotic plug formation inhibitor - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a keratotic plug formation inhibitor which hardly causes the skin to become rough and is more effective by being compounded with a crude drug component.SOLUTION: The invention provides a keratotic plug formation inhibitor characterized by containing pomegranate juice or a lactic acid bacterium fermentation product of pomegranate juice by lactic acid bacteria, especially those belonging to Lactobacillus plantarum. The keratotic plug formation inhibitor promotes expression of 17β-hydroxysteroid dehydrogenase type 2 exhibiting male sex hormone activation inhibitory activity, inhibits expression of GATA3 intervening in inner root sheath formation of hair follicle, and thus has activity of inhibiting keratotic plug formation and of ameliorating conspicuity of pores and body hair. The present invention is applicable to such as pharmaceuticals, quasi drugs, cosmetics and food products.

Description

  The present invention relates to a corneal plug formation inhibitor, a GATA3 expression inhibitor, a 17β hydroxysteroid dehydrogenase type 2 expression promoter, and a body hair inhibitor characterized by containing pomegranate juice and / or a lactic acid bacteria fermentation product of pomegranate juice.

  A keratin plug is thought to be a result of the sebum secreted from the surrounding keratin and sebaceous glands coagulating and developing in the pores, and is considered to be one of the causes of conspicuous pores. Therefore, treatments such as physically removing horn plugs have been proposed, and a method of removing the horn plugs by face washing, a method of attaching and removing horn plugs with an adhesive sheet, etc., and a horn plug removal device have been devised (patents) Literature 1-5).

  However, in the method of removing horn plugs with an adhesive sheet or an instrument, the horny skin of the epidermis is also lost, which may cause rough skin. In addition, as an alternative method, a method and a preparation for suppressing horn plug regeneration by adding a surfactant to a high concentration organic acid have been shown. In this method, the horn plug is chemically dissolved. It is based, and it cannot be said that the concern of causing rough skin has been wiped out yet (Patent Documents 6-8). This is due to the fact that there are many unclear points regarding horn plugs, such as the details of the mechanism of horn plug formation being unclear and few studies focusing on the structure of the horn plug itself. Recently, protein analysis of horn plugs reported that keratin 17 is present in horn plugs (Non-patent Document 1), but not all the proteins that make up horn plugs have been clarified, and horn plug formation still remains. The mechanism is unknown. From the above points, in order to remove horn plugs without causing rough skin, development of a new horn plug formation inhibitor based on the horn plug formation mechanism in the living body has been desired.

  Pomegranate contains antioxidant components such as ellagic acid and can be expected to have an anti-aging effect, and it contains female hormone-like components that can be expected to have an effect on beauty and health. Used as a health food and cosmetic ingredient. The main patent documents include cosmetics having an antioxidant action (Patent Document 9), cosmetics having a whitening action (Patent Document 10), skin external preparations having an antiallergic action (hyaluronidase inhibitory action) (Patent Document 11), Examples include cosmetics having a female hormone-like action (Patent Document 12), elastase inhibitors (Patent Document 13), inflammatory cytokine synthesis inhibitors (Patent Document 14), and lipase activity inhibitors (Patent Documents 15 and 16). However, there is no description about the effect which suppresses horn plug formation.

  In addition, the utilization of the fermented product of the pomegranate juice by the lactic acid bacteria is not so much utilized because the pomegranate juice has high acidity and poor fermentability. The patent document (Patent Document 10) relating to a cosmetic agent containing a lactic acid bacteria fermented product of fruit juice as an active ingredient has a description of the cosmetic agent of the lactic acid bacteria fermented product of fruit juice, but there is no description regarding specific effectiveness related to pomegranate fruit juice. Patent Document 11 describes an antioxidant that exhibits degradation characteristics of lactic acid bacteria Lactobacillus plantarum to hydroxyperoxide and linoleic acid hydroxyperoxide. However, there is no description about specific objects used for lactic acid bacteria fermentation and effects other than the antioxidant action. Further, Patent Document 17 describes a skin external preparation for improving wrinkles characterized by containing a hyaluronic acid synthesis accelerator, but it is a prior document on the effect of inhibiting the formation of corneal plugs of pomegranate juice or its lactic acid bacteria fermentation product. There is no information.

JP2007-119394A JP-A-5-97627 JP2007-55933A JP2009-82376 JP 2013-17788 JP-A-10-120532 JP2013-32319A JP 2013-49667 A JP 05-320037 A JP 05-331041 A JP 09-110710 A JP2001-131053 JP-A-2005-53873 JP 2005-89304 A JP2005-8572 JP2005-53891 JP 2013-245170

Hiroko Yamazaki et al., 73rd SCCJ Research Discussion Meeting, p14-15 November 29, 2013

  In view of this situation, the subject of the present invention is a horn plug formation inhibitor containing a crude drug component based on a horn plug formation mechanism, an expression inhibitor of GATA3 involved in horn plug formation, and a 17β hydroxysteroid dehydrogenase type 2 involved in the same manner. An object of the present invention is to provide an expression promoter and a body hair inhibitor.

  The present inventors have clarified from the analysis of proteins in the hair follicle that the inner root root sheath of the hair follicle and its protein are involved in the formation of horn plugs. It was also clarified that the activation of male hormones in the skin is important for the formation of horn plugs. Under these circumstances, the results of extensive research that the suppression of the production of proteins that constitute horn plugs and the suppression of androgen activation can be a means to prevent the formation of horn plugs. As a result, pomegranate juice or lactic acid bacteria fermentation of pomegranate juice Prevents the formation of horn plugs, suppresses the expression of GATA3 involved in the formation of the inner root sheath that is a component of horn plugs, and expresses 17β hydroxysteroid dehydrogenase type 2 that suppresses the activation of male hormones It has been found that it has an action of promoting hair and an action of suppressing body hair, and the present invention has been completed.

  The pomegranate juice used in the present invention is pomegranate (Punica granatum) juice. The fruit juice may include pulp, pericarp and seeds, and may include pomace. As for the fruit juice, unadjusted or concentrated fruit juice may be used as it is, or it may be diluted. Moreover, you may adjust and adjust pH to 3-8 with alkalis, such as sodium hydroxide. For the purpose of promoting the growth of lactobacilli, organic substances such as yeast extract and soybean peptide, and minerals such as magnesium sulfate may be added. The fruit juice of the present invention includes a pomegranate solvent extract extracted with a solvent such as water or ethanol.

  Examples of the lactic acid bacteria used in the present invention include lactic acid bacteria belonging to the genus Lactobacillus, the genus Lactococcus, the leuconostoc, and the genus Pediococcus. Particularly preferably, it is a lactic acid bacterium belonging to Lactobacillus plantarum in terms of improving the effectiveness by fermentation, and even if it is a strain isolated from plants or pickles that are fermented foods thereof, the strain is preserved. It may be registered with an institution. Moreover, what can ferment pomegranate juice efficiently in the range of pH 3-5 is especially preferable.

  Culture conditions can be set as appropriate. For example, the culture temperature is not particularly limited, but it is 15 to 45 ° C., preferably 25 to 40 ° C. as a guide.

  The pomegranate juice or the lactic acid bacteria fermented product thereof may be used as it is, and may be used after being subjected to treatment such as extraction, concentration, dilution, filtration, and decolorization or deodorization treatment with activated carbon or the like. The solvent for extraction may be water, ethanol, 1,3 butylene glycol, or a mixture thereof, and the extraction temperature may be heated at room temperature.

  The above-mentioned extract may be used as it is for blending into the external preparation or internal preparation of the present invention, and is used for cosmetics, quasi-drugs, pharmaceuticals, foods, etc., as long as the effect of the extract is not impaired. Component fats and oils, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickening Components such as agents, pigments, antioxidants, whitening agents, chelating agents, excipients, film agents, sweeteners, and sour agents can also be blended.

  Examples of the dosage form of the present invention include lotions, creams, massage creams, emulsions, gels, aerosols, packs, cleaning agents, bath preparations, foundations, powders, lipsticks, ointments, poultices, pastes, plasters. Essences, powders, pills, tablets, injections, suppositories, emulsions, capsules, granules, liquids (including tinctures, fluid extracts, spirits, suspensions, limonades, etc.), tablets, A drink etc. are mentioned.

  The content of pomegranate juice used in the present invention, or a fermented lactic acid bacterium thereof in the form of a solution is not particularly limited, but includes a horn plug formation inhibitor, a GATA3 expression inhibitor, and a 17β hydroxysteroid dehydrogenase type 2 expression. It is 0.001% by weight or more, preferably 0.001 to 5% by weight, in terms of solid matter, with respect to the accelerator and body hair inhibitor. If it is less than 0.0001% by weight, the effect of the present invention may not be sufficiently exerted. The addition method may be added in advance or may be added during production, and may be appropriately selected in consideration of workability.

  The pomegranate fruit juice of the present invention or its fermented lactic acid bacterium is a natural and highly safe material, and has an excellent GATA3 expression inhibitory effect. In addition, the fermented lactic acid bacteria further promotes the GATA3 expression inhibitory effect than the pomegranate juice before fermentation, and in addition, the 17β hydroxysteroid dehydrogenase type 2 suppresses the activation of male hormone that was not observed before fermentation. Since the expression promoting effect is remarkably exhibited, it can be expected to improve the conspicuous improvement of pores and suppress the body hair, and it can be combined with pomegranate juice and applied to pharmaceuticals, quasi drugs, cosmetics, foods and the like.

  The GATA3 gene in the present invention is a gene encoding a transcription factor present in the nucleus of a cell, and is involved in cell differentiation of T cells that are immune cells, vascular endothelial cells, inner root sheath cells of hair follicles, etc. This gene deficiency and gene product dysfunction impairs the ability to differentiate into the cells.

  The 17β-hydroxysteroid dehydrogenase in the present invention is an enzyme that regulates the activity of steroid hormones by interconverting 17β-hydroxysteroid and 17β-ketosteroid. Among these enzymes, 17β-hydroxysteroid dehydrogenase type 2 is less active than sex hormones such as testosterone, dihydrotestosterone (DHT), and 17β-estradiol, and substrate hormones such as androstenedione, androstenedione, and estrone, respectively. It catalyzes a reaction that converts it into a thing. Major in vivo male hormones include DHT, testosterone, androstenedione, dehydroepiandrosterone (DHEA), and the male hormone activity decreases in this order. That is, if the action of 17β-hydroxysteroid dehydrogenase type 2 is increased, DHT and testosterone having strong androgenic activity decrease, and androstenedione and DHEA having weak androgenic activity increase. This enzyme is expressed in peripheral tissues that are affected by the aforementioned sex hormones and the like. In cells, it is localized in the endoplasmic reticulum membrane and exists in the form of a membrane protein. The 17β hydroxysteroid dehydrogenase type 2 gene is a gene encoding this enzyme, and the enzyme protein is produced in cells by the expression of this gene.

  The pomegranate juice of the present invention, or a lactic acid bacterium fermentation product thereof, has an excellent inhibitory effect on the formation of horn plugs, an inhibitory action on GATA3 expression, an expression promoting action on 17β-hydroxysteroid dehydrogenase type 2, and an inhibitory action on body hair. It can be used in the fields of external products, cosmetics, and foods. In particular, when the pomegranate juice is fermented under specific conditions, the above effect is improved.

Next, in order to describe the present invention in detail, examples of production of fermented products, formulation examples and experimental examples used in the present invention will be given as examples, but the present invention is not limited thereto. In the examples, the part of the amount is part by weight, and% is% by weight.
Below, the manufacture example of the fermentation product of the pomegranate juice which is a pomegranate juice or its lactic-acid-bacteria fermentation product is shown.

Production Example 1 Pomegranate juice Commercially available concentrated pomegranate juice (Brix65) prepared by a pressing method was used.

Production Example 2 Fermented Pomegranate Juice Concentrated pomegranate juice (Brix65) was diluted with water to adjust to Brix15, and adjusted to pH 5 using an aqueous sodium hydroxide solution. An inoculum of lactic acid bacteria (derived from pickles) belonging to Lactobacillus plantarum was added to 500 g of the adjustment liquid. Fermented at 30 ° C. for 2 days and filtered to obtain 450 g of a pomegranate juice fermented product.

Production Example 3 Fermented Pomegranate Juice Concentrated pomegranate juice (Brix65) was diluted with water to adjust to Brix11, and adjusted to pH 4.5 using an aqueous sodium hydroxide solution. An inoculum of lactic acid bacteria (derived from pickles) belonging to Lactobacillus plantarum was added to 500 g of the adjustment liquid. Fermented at 30 ° C. for 2 days and filtered to obtain 450 g of a pomegranate juice fermented product.

Production Example 4 Fermented Pomegranate Juice Concentrated pomegranate juice (Brix65) was diluted with water to adjust to Brix8, and adjusted to pH 4.5 using an aqueous sodium hydroxide solution. An inoculum of lactic acid bacteria (derived from pickles) belonging to Lactobacillus plantarum was added to 500 g of the adjustment liquid. Fermented at 30 ° C. for 2 days and filtered to obtain 450 g of a pomegranate juice fermented product.

Production Example 5 Fermented pomegranate juice Pomegranate juice was adjusted to pH 4.5 using an aqueous sodium hydroxide solution. An inoculum of lactic acid bacteria (derived from pickles) belonging to Lactobacillus plantarum was added to 500 g of the adjustment liquid. Fermented at 30 ° C. for 2 days and filtered to obtain 450 g of pomegranate juice fermented product

Production Example 6 Fermented Pomegranate Juice 90 g of 1,3-butylene glycol was added to 210 g of the fermented pomegranate juice of Production Example 3 and filtered to obtain 280 g of a pomegranate juice fermented product.

Production Example 7 Lyophilized product of fermented pomegranate juice 100 g of the fermented pomegranate juice of Production Example 2 was lyophilized to obtain 15 g of a lyophilized fermented pomegranate juice.

Production Example 8 Lyophilized Product of Fermented Pomegranate Juice 100 g of the fermented pomegranate juice of Production Example 4 was lyophilized to obtain 8 g of a lyophilized fermented pomegranate juice.

Production Example 9 Dried Pomegranate Juice Product 120 g of dextrin was added to 200 g of the pomegranate juice fermentation of Production Example 5 and dried with a spray dryer to obtain 145 g of a dried pomegranate juice product.

  Below, the example of prescription using the pomegranate fruit juice or its lactic-acid-bacteria fermented material is shown.

Formulation Example 1 Lotion Prescription Formulation Amount (parts)
1. Fermented pomegranate juice (Production Example 6) 0.5
2. 1,3-butylene glycol 8.0
3. Glycerin 2.0
4). Xanthan gum 0.02
5. Citric acid 0.01
6). Sodium citrate 0.1
7). Ethanol 5.0
8). Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1
10. Perfume proper amount11. [Manufacturing method] Components 1 to 6 and 11 and components 7 to 10 are uniformly dissolved in purified water, and both are mixed and filtered to obtain a product.

Comparative Example 1 Conventional Lotion A conventional lotion was obtained by replacing the fermented pomegranate juice (Production Example 6) with purified water in Formulation Example 1.

Formulation Example 2 Latex Formulation Formulation amount (parts)
1. Fermented pomegranate juice (Production Example 6) 0.5
2. Squalane 5.0
3. Olive oil 5.0
4). Jojoba oil 5.0
5. Cetanol 1.5
6). Glycerol monostearate 2.0
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Polyoxyethylene sorbitan monooleate 2.0
9. Fragrance 0.1
10. Propylene glycol 1.0
11. Glycerin 2.0
12 Methyl paraoxybenzoate 0.2
13. [Manufacturing method] Components 2 to 8 are heated and dissolved and mixed with purified water to a total amount of 100, and kept at 70 ° C to obtain an oil phase. Ingredients 10 to 13 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring. Then, component 9 is added at 45 ° C., and further cooled to 30 ° C., and component 1 is added to obtain a product.

Comparative Example 2 Conventional Emulsion In Formulation Example 2, a product obtained by replacing the fermented pomegranate juice (Production Example 6) with purified water was used as a conventional emulsion.

Formulation Example 3 Cream Ingredients Amount (parts)
1. Fermented pomegranate juice (Production Example 6) 0.5
2. Squalane 5.5
3. Olive oil 3.0
4). Stearic acid 2.0
5. Beeswax 2.0
6). Octyldodecyl myristate 3.5
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Behenyl alcohol 1.5
9. Glycerol monostearate2.5
10. Fragrance 0.1
11. Methyl paraoxybenzoate 0.2
12 Ethyl paraoxybenzoate 0.05
13.1,3-Butylene glycol 8.5
14 [Manufacturing method] Components 2 to 9 are heated and dissolved and mixed with purified water to a total amount of 100, and kept at 70 ° C to obtain an oil phase. Ingredients 1 and 11 to 14 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring. The component 10 is added at 45 ° C., and further cooled to 30 ° C. to obtain a product.

Comparative Example 3 Conventional Cream A conventional cream was prepared by replacing the fermented pomegranate juice (Production Example 6) with purified water in Formulation Example 3.

Formulation Example 4 Gel component Ingredients (parts)
1. Pomegranate juice (Production Example 1) 5.0
2. Ethanol 5.0
3. Methyl paraoxybenzoate 0.1
4). Polyoxyethylene hydrogenated castor oil (60 EO) 0.1
5. Perfume appropriate amount 6.1,3-butylene glycol 5.0
7). Glycerin 5.0
8). Xanthan gum 0.1
9. Carboxyvinyl polymer 0.2
10. Potassium hydroxide 0.2
11. [Production method] Ingredients 2 to 5 and ingredients 1 and 6 to 11 are uniformly dissolved in purified water, and the two are mixed to obtain a product.

Formulation Example 5 Bath agent Ingredients Amount (parts)
1. Lyophilized product of fermented pomegranate juice (Production Example 7) 1.0
2. Sodium bicarbonate 50.0
3. Yellow No. 202 (1) Appropriate amount 4. Perfume appropriate amount 5. [Manufacturing method] Ingredients 1 to 5 are mixed uniformly with sodium sulfate to make a product.

Formulation Example 6 Tablet Ingredient Amount (parts)
1. Lyophilized product of fermented pomegranate juice (Production Example 8) 5.0
2. Dried corn starch 25.0
3. Carboxymethylcellulose calcium 20.0
4). Microcrystalline cellulose 40.0
5. Polyvinylpyrrolidone 7.0
6). Talc 3.0
[Production method] Components 1 to 4 are mixed, and then an aqueous solution of component 5 is added as a binder to form granules. Ingredient 6 is added to the molded granules and compressed. One tablet is 0.52 g.

Formulation Example 7 Tablet Confectionery Ingredient Amount (parts)
1. Dry product of fermented pomegranate juice (Production Example 9) 2.0
2. Dried corn starch 49.8
3. Erythritol 40.0
4). Citric acid 5.0
5. Sucrose fatty acid ester 3.0
6). Fragrance 0.1
7). Purified water 0.1
[Production method] Components 1 to 4 and 7 are mixed and granulated. Ingredients 5 and 6 are added to the molded granules and tableted. One tablet is 1.0 g.

  In order to effectively explain the present invention, experimental examples will be given below. In addition, this invention is not limited by this.

Experimental Example 1 GATA3 Production Inhibition Test in Epithelial Cells The GATA3 production inhibitory effect in keratinocytes, which are epithelial cells, was measured under the following conditions.

In order to culture fetal human normal keratinocytes (hereinafter abbreviated as HNK), Humedia KG2 (Kurabo) was used as a culture solution and cultured at 37 ° C. and 5% CO ₂ . The medium was changed at a rate of 3 times a week. HNK was seeded on a 24-well plate at a density of 2 × 10 ⁴ cells / cm ² , and after confirming that the cells adhered, each sample was added. Moreover, the solvent used for dissolution of the sample was added to the control. After the addition, the cells were cultured until they reached semiconfluence, and then RNA was isolated using RNAiso reagent (Takara Bio). For this RNA, cDNA synthesis was performed by reverse transcription using PrimeScript RT Master Mix reagent (Takara Bio), then PCR reaction was performed using PLATINUM SYBER GREEN QPCR reagent (Invitrogen), and the expression level of GATA3 Was measured. In the measurement, initial denaturation was performed at 95 ° C. for 2 minutes, and then PCR reaction was performed for 40 cycles, with 20 seconds at 95 ° C. and 30 seconds at 60 ° C. as one cycle. For other operations, the expression level of GATA3 was determined as a ratio to the expression level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH), which is an internal standard, according to a predetermined method. The production inhibitory effect of GATA3 was calculated as the ratio of the expression level of GATA3 in the sample addition group to the expression level of GATA3 in the control. The primers used for measuring the expression level of each gene are as follows.

Primer set for GATA3 Forward CACAATATTAACAGACCCCCTGAACTATGA (SEQ ID NO: 1)
Reverse CCGGGTTAAACGAGCTGTTTCT (SEQ ID NO: 2)
Primer set for GAPDH Forward TGCACCACCAACTGCCTTAGC (SEQ ID NO: 3)
Reverse TCTTCTGGGGTGCAGTGATG (SEQ ID NO: 4)

  The test results are shown in Table 1. Since the expression level of GATA3 was reduced by the addition of unfermented pomegranate juice (p <0.1), pomegranate juice has the effect of suppressing the expression of GATA3 It was shown that. In addition, when the lactic acid bacteria fermented product of pomegranate juice was added, the expression level of GATA3 decreased in a concentration-dependent manner compared with the control (no sample added) (p <0.05). Since the expression level of GATA3 was reduced when the lactic acid bacteria fermentation product of pomegranate juice was added (p <0.1) than when pomegranate juice was added, the GATA3 expression inhibitory action in pomegranate juice was obtained by lactic acid bacteria fermentation. It was shown to be enhanced in the lactic acid bacteria fermentation product of the obtained pomegranate juice.

Experimental Example 2 Production Promotion Test of 17β Hydroxysteroid Dehydrogenase Type 2 (HSD17B2) in Epithelial Cells The effect of promoting production of HSD17B2 in keratinocytes, which are epithelial cells, was measured under the following conditions.

In order to culture HaCaT, which is a cell line derived from human keratinocytes, Dulbecco's modified Eagle medium containing 10% fetal calf serum was used as the culture medium, and cultured under conditions of 37 ° C. and 5% CO ₂ . The medium was changed at a rate of 3 times a week. 1 × 10 ⁵ pieces of HaCaT were seeded on a 60 mm dish, and the sample was added when it became confluent. As a control, the solvent used for dissolving the sample was added. After incubation for 24 hours, RNA was isolated using RNAiso reagent (Takara Bio). For this RNA, cDNA synthesis was performed by reverse transcription using PrimeScript RT Master Mix reagent (Takara Bio), followed by PCR reaction using PLATINUM SYBER GREEN QPCR reagent (Invitrogen), and the expression level of HSD17B2 Was measured. In the measurement, initial denaturation was performed at 95 ° C. for 2 minutes, and then PCR reaction was performed for 40 cycles, with 20 seconds at 95 ° C. and 30 seconds at 60 ° C. as one cycle. In other operations, the expression level of HSD17B2 was determined as a ratio to the expression level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH), which is an internal standard, in accordance with a predetermined method. The production promoting effect of HSD17B2 was calculated as the ratio of the expression level of HSD17B2 in the sample addition to the expression level of HSD17B2 in the control. The primers used for measuring the expression level of each gene are as follows.

Primer set Forward TGGTGACAGGGTGGTGATTGC for HSD17B2 (SEQ ID NO: 5)
Reverse ATACCGTGAAGCCCCCTCAT (SEQ ID NO: 6)
Primer set for GAPDH Forward TGCACCACCAACTGCCTTAGC (SEQ ID NO: 3)
Reverse TCTTCTGGGGTGCAGTGATG (SEQ ID NO: 4)

  The test results are shown in Table 2. The amount of HSD17B2 produced increased by 20% compared to the control (no sample added) with the addition of pomegranate juice lactic acid bacteria fermentation product (p <0.05). It was shown to have an expression promoting effect.

Experimental example 3 Continuous test 1
Using Prescription Example 1 and Comparative Example 1 containing a fermented lactic acid bacterium of pomegranate juice, a one-month continuous test was conducted on 10 male subjects in their 20s to 40s. The test is a blind test in which the presence or absence of the active ingredient is not notified to the subject, and the prescription example 1 containing the active ingredient is used continuously on one half-face cheek of the subject, and the comparative example 1 is used continuously on the other half-face cheek. Twice a day in the morning and evening for 1 month. Porphyrin fluorescence, which is an index of horn plug formation, and the amount of male hormone in the keratin were measured on the cheeks before and after one month of continuous use.

  The amount of porphyrin, which is an index of horn plug formation, is obtained by obtaining an ultraviolet image of the cheek using a horn plug scope Charm View (Mortex), smoothing the image with a Gaussian filter, binarizing it, and using it as white pixels It was obtained by quantifying the fluorescent site to be detected. On the side where Formulation Example 1 containing the lactic acid bacteria fermented product of pomegranate juice as an active ingredient was used continuously, the porphyrin fluorescence decreased from the side where Comparative Example 1 was used continuously (p <0.05). The effect of inhibiting the formation of horn plugs by fermented lactic acid bacteria of pomegranate juice was shown (Table 3).

  Immediately after washing the face, a 1.5 cm × 1.5 cm Blenderm tape (3M) was affixed to the facial cheek, and after confirming that the tape was sufficiently adhered, the tape was peeled off to obtain a keratin sample. The stratum corneum sample collected from each subject was added with 350 μl of PBS containing 0.1% Tween 20, stirred for about 1 minute by vortex, and then subjected to ultrasonic treatment for 5 seconds × 3 times. After removing the tape, centrifugation is performed at 10,000 rpm, 4 ° C. for 5 minutes, and the supernatant is used as a keratin extract to quantify dehydroepiandrosterone (DHEA) and dihydrotestosterone (DHT). Provided. For quantification of DHEA, Salivary DHEA Enzyme Immunoassay Kit (Salimetrics) was used, and for quantification of DHT, Dihydrotestosterone ELISA (ALPCO Immunoassays) was used according to the attached manual. The measured value was corrected by the amount of protein in the keratin extract. As a result, the DHEA increased and the amount of DHT decreased on the side where the prescription example 1 containing the lactic acid bacteria fermented product of pomegranate juice as an active ingredient was used continuously compared to the case where the comparative example 1 was used continuously. It confirmed (Table 4, Table 5). From this result, it was shown that the activation of male hormones in the skin was suppressed by using a lactic acid bacteria fermented product of pomegranate juice.

Experiment 4 Continuous test 2
A two-month continuous test was conducted on 16 female subjects in their 20s to 40s using Formulation Example 2 and Comparative Example 2 of emulsions containing lactic acid bacteria fermented pomegranate juice. The test is a blind test in which the presence or absence of the active ingredient is not notified to the subject, the prescription example 2 including the active ingredient in one half-face cheek of the subject, and the half-side test in which the comparative example 2 is used continuously on the other half-face cheek Analyzes of porphyrin content that is an index of horn plug formation in cheeks, analysis of pore shape using replica, and image data The pore impression degree analysis using was performed.

  The amount of porphyrin, which is an index of horn plugs, is detected as white pixels by obtaining an ultraviolet image of the cheek using a horn plug scope Charm View (Mortex), smoothing the image with a Gaussian filter, and binarizing it. It was obtained by quantifying the fluorescent site. On the side where Comparative Example 2 containing no active ingredient was used continuously, the amount of porphyrin increased during the continuous period, while on the side where Formulation Example 2 containing a fermented lactic acid bacterium of pomegranate juice as an active ingredient was used, there was an increase in the amount of porphyrin. Since no difference was observed between groups (p <0.05), an inhibitory effect on the formation of keratin plugs by pomegranate juice fermented with lactic acid bacteria was shown (Table 6).

  A cheek replica was collected using a replica agent SILFLO (FLEXICO), and the collected replica was photographed under a stereomicroscope and at a light source incident angle of 30 degrees. The obtained image was subjected to noise reduction processing due to bubbles and the like, and the maximum pore average depth was measured for the pores obtained by binarization, and calculated as the ratio before use. As a result, on the side where Comparative Example 2 was used continuously, an increase in the maximum pore average depth over time was observed (P <0.05), but on the side where Formulation Example 2 was used continuously, changes due to continuous use were recognized. I couldn't. In addition, after 2 months of use, there was a difference between groups between the prescription example 2 continuous side and the comparative example 2 continuous side (P <0.05). The effect of improving the conspicuousness of pores by decreasing the depth was shown (Table 7).

  A color image obtained by clinical photography taken with Facial Stage DM-3 (Mortex) is color-separated into RGB and binarized using a Green image, and then the dispersion of the number of black pixels in the analysis region is dispersed. The pore impression degree was determined as an index for obtaining a uniform pore conspicuousness. On the side where Comparative Example 2 containing no active ingredient was used continuously, the impression of pores increased significantly during the continuous use period (p <0.05), but Formulation Example 2 containing a lactic acid bacteria fermentation product of pomegranate juice as an active ingredient There was no increase in the impression of pores on the side of continuous use. Moreover, since the difference between groups was recognized between the prescription example 2 continuous use side and the comparative example 2 continuous use side (P <0.05), it is because pore impression degree is improved by the lactic acid bacteria fermented product of pomegranate juice. The effect of improving the conspicuous pores was shown (Table 8).

Experiment 5 Continuous test 3
Using Formulation Example 3 and Comparative Example 3 of a cream containing a lactic acid bacteria fermented product of pomegranate juice, a continuous test for one month was conducted on 12 male subjects in their 20s to 40s. The test was a blind test in which the presence or absence of the active ingredient was not notified to the test subject, Prescription Example 3 containing the active ingredient in one forearm portion of the test subject was used as a half side test in which Comparative Example 3 was used continuously on the other forearm portion. Then, it was used twice a day in the morning and evening for one month, and a questionnaire survey was conducted one month later. As a result, when Formulation Example 3 containing an active ingredient was used continuously, an answer was obtained that recognized the effect of improving the noticeability of body hair and the effect of improving the condition of the skin.

  The invention of the present application suppresses the formation of the inner root sheath of hair follicles involved in horn plug formation and suppresses the activation of male hormones by using pomegranate juice and / or fermented lactic acid bacteria of pomegranate juice based on the mechanism of horn plug formation. By doing so, it is possible to provide a horn plug formation inhibitor, a GATA3 expression inhibitor, a 17β hydroxysteroid dehydrogenase type 2 expression promoter, and a body hair inhibitor that can prevent the formation of horn plugs and improve the conspicuousness of pores.

Claims (5)

  A horn plug formation inhibitor comprising pomegranate juice and / or a lactic acid bacteria fermentation product of pomegranate juice.   A GATA3 expression inhibitor comprising pomegranate juice and / or a fermented lactic acid bacterium of pomegranate juice.   A 17β-hydroxysteroid dehydrogenase type 2 expression promoter comprising pomegranate juice and / or a fermented lactic acid bacterium of pomegranate juice.   A corneal plug formation inhibitor characterized by containing a lactic acid bacteria fermentation product of pomegranate juice, wherein the lactic acid bacterium is Lactobacillus plantarum. A body hair inhibitor comprising pomegranate juice and / or a lactic acid bacteria fermentation product of pomegranate juice.