JP2003102486A - HUMAN CHEMOKINE beta-8, CHEMOKINE beta-1 AND MACROPHAGE INFLAMMATORY PROTEIN-4 - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide human Ckβ-8, MIP-4 and Ckβ-1, a DNA (RNA) encoding such chemokine polypeptide, a method for producing the polypeptide by a recombination technology and a method for using the polypeptide for the treatment of leukemia, tumor, chronic infection, autoimmune disease, fibrosis, disorder healing and psoriasis. SOLUTION: The invention discloses an antagonist against the chemokine polypeptide, the use of the antagonist as an agent for the treatment of rheumatoid arthritis, autoimmune disease, acute inflammation and infection, allergic reaction, prostaglandin-dependent fever and bone marrow insufficiency, a diagnostic assay for the detection of diseases relating to the mutation in the nucleic acid sequence and a diagnostic assay for the detection of the varied concentration of the polypeptide.

Description

Detailed Description of the Invention

[0001]

FIELD OF THE INVENTION This invention relates to newly identified polynucleotides, polynucleotides encoded by such polynucleotides, uses of such polynucleotides and polypeptides, and such polynucleotides and It relates to the production of polypeptides.
More specifically, the polypeptides of the present invention putatively predict human chemokine beta-8 (Ckβ-8), macrophage inflammatory protein-4 (MIP-4), and chemokine beta-1 (Ckβ-). Identified as 1).
The invention also relates to inhibiting the action of such polypeptides.

[0002]

2. Description of the Related Art Chemokines are intercrin.
e) Also called cytokine, it is a subfamily of cytokines that are structurally and functionally related. These molecules are 8-10 kd in size. Chemokines generally exhibit 20% -75% homology at the amino acid level and are characterized by four conserved cysteine residues that form two disulfiyl bonds. Chemokines are classified into two subfamilies, alpha and beta, based on the arrangement of the first two cysteine residues. In the alpha subfamily, the first two cysteines are separated by one amino acid, and thus "C
-X-C "subfamily. In the beta subfamily, the two cysteines are in adjacent positions,
It is therefore referred to as the "CC" subfamily. So far, at least eight different members of this subfamily have been identified in humans.

Intercrine cytokines exhibit a wide variety of functions. A hallmark is the ability to attract chemotactic migration of different cell types including monocytes, neutrophils, T lymphocytes, basophils, and fibroblasts. Many chemokines have proinflammatory activity and are involved in many steps in the inflammatory response. These activities include stimulation of histamine release, release of lysosomal enzymes and leukotrienes, increased adhesion of target immune cells to endothelial cells, enhanced complement protein binding, enhanced expression of granulocyte adhesion molecules and complement receptors. , And respiratory burst (re
spiratory burst) is included. In addition to many chemokines involved in inflammation, it has also been shown that certain chemokines exhibit other activities. For example, macrofar
Diinflammatory protein-1 (MIP-1) can suppress the proliferation of hematopoietic stem cells and induce platelet factor-4 (PF-
4) is a potent inhibitor of endothelial cell growth and
Leukin-8 (IL-8) promotes the proliferation of keratinocytes and GRO is an autocrine growth factor for melanoma cells.

Given various biological activities, chemokines have many physiology including lymphocyte trafficking, wound healing, hematopoiesis control and immunological disorders such as allergic, asthma and arthritis. It is not surprising that it is related to the physical and disease states. Hematopoietic lineage (hemato
MIP is one example of a poietic lineage regulator
-1. MIP-1 was initially identified as an endotoxin-induced proinflammatory cytokine produced from macrophages. Subsequent studies have shown that MIP-1 has two distinct but related proteins, MIP-1α and MI.
P-1β. MIP-
Both 1α and MIP-1β are chemoattractants for macrophages, monocytes and T lymphocytes. Interestingly, biochemical purification of pluripotent stem cell inhibitor (SCI) and subsequent sequence analysis revealed it to be identical to MIP-1α. Moreover, MIP-1β can neutralize the ability of MIP-1α and suppress the proliferation of hematopoietic stem cells. This finding leads to the hypothesis that the main physiological role of MIP-1 is to control hematopoiesis in the bone marrow and the proposed inflammatory function is secondary. The mode of action of MIP-1α as a stem cell inhibitor is related to its ability to block the cell division cycle in the G1 / S phase. Furthermore, the inhibitory effect of MIP-1α seems to be restricted to immature progenitor cells, and indeed, granulocyte-macrophage colony-stimulating factor (GM-C).
(SF) is stimulatory for late progenitor cells.

Several research groups have identified MIP-1α.
And a human homolog of MIP-1β, which is considered to be a human homologue, have been cloned. CDN in all cases
Library prepared by A against activated T cell RNA
Isolated from. MIP-1 protein can be detected in early wound inflammatory cells, IL from wound fibroblasts
It has been shown to induce the production of -1 and IL-6.
In addition, purified natural MIP-1 (MIP-1, MI
P-1α and MIP-1β polypeptides).
Causes acute inflammation when injected subcutaneously in the foot of mice or intracisternally in the cerebrospinal fluid of rabbits (Wolpe and Cerami, 1989, FASK
BJ. 3: 2565-73). In addition to these direct or indirect pro-inflammatory properties of MIP-1, MIP-1
Have been recovered in the early inflammatory phase of wound healing in an experimental mouse model using sterile wound chambers (Fahey et al., 1
990, Cytokine, 2:92). For example, Chiron Corpor
PCT application WO92 / 051 filed by ation
98 is a mammalian macrophage inflammatory protein (M
IP) active DN as template for production in yeast
The A molecule is disclosed.

[0006] Mouse MIP-1α and MIP-1β are different but very closely related cytokines. A partially purified mixture of these two proteins acts on neutrophil function, causing local inflammation and fever. M
IP-1α is expressed in yeast cells and purified to homogeneity. Structural analysis confirmed that it has secondary and tertiary structures that are very similar to PF-4 and IL-8, which share only limited sequence homology. MIP-
1α has also been shown to be active in vivo and protect mouse stem cells from being subsequently killed in vitro by tritiated thymidine. MIP-1α has also been shown to promote further committed progenitor granulocyte-macrophage colony-forming cells in response to granulocyte-macrophage-colonie-stimulating factors (Clemens, J. M. . Et al, Cytokine, 4:76
-82 1992).

[0007]

The polypeptide of the present invention, Ckβ-1 (referred to as "MIP-1γ" in the parent application of the present application), is β-based on the amino acid sequence homology.
It is a new member of the chemokine family. Ckβ
The -8 polypeptide (referred to as “MIP-3” in the parent application of the present application) is also a new member of the β-chemokine family based on amino sequence homology. According to one aspect of the present invention, human Ckβ-8, human MIP
-4 and human Ckβ-1 novel mature polypeptides, and biologically active, diagnostically or therapeutically useful fragments, analogs and derivatives thereof are provided.

According to another aspect of the invention, an isolated nucleic acid molecule (mRNA, DN encoding such a polypeptide.
A, cDNA, genomic DNA) as well as biologically active, diagnostically or therapeutically useful fragments, analogs and derivatives thereof. According to a further aspect of the invention there is provided a method of producing such a polypeptide by recombinant methods, wherein a recombinant prokaryotic and / or eukaryotic host cell comprising a nucleic acid sequence is cultured under conditions that promote expression of the protein. Then, a method is provided that comprises recovering the protein.

According to a further aspect of the invention, such a polypeptide or a polynucleotide encoding such a polypeptide is used for therapeutic purposes, for example to protect bone marrow stem cells from chemotherapeutic agents during chemotherapy, white blood cells. , To stimulate immune responses, to control hematopoiesis and lymphocyte trafficking, to treat psoriasis, solid tumors, to promote host defense against resistant chronic and acute infections, and wound healing Methods are provided for stimulating. According to a further aspect of the invention there are provided antibodies against such polypeptides. According to yet another aspect of the invention, there are provided antagonists to such polypeptides, such antagonists inhibiting the action of such polypeptides, eg inhibiting the production of IL-1 and TNF-α, It can be used to treat non-regenerative anemia, myelodysplastic syndrome, asthma and arthritis.

According to another aspect of the invention, Ckβ-8, C
Nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to kβ-1 and MIP-4 nucleic acid sequences are also provided. In accordance with yet another aspect of the invention, diagnostics for detecting diseases associated with underexpression and overexpression of such polypeptides, and for detecting mutations in the nucleic acid sequences encoding such polypeptides. An assay is provided. According to yet another aspect of the present invention, such a polypeptide or a polynucleotide encoding such a polypeptide is used as a research reagent,
Methods are provided for use in developing therapeutic and diagnostic agents for the treatment of human diseases for in vitro purposes related to scientific research, DNA synthesis and DNA vector production. These and other aspects of the invention will be apparent to those skilled in the art from the teachings herein.

The following drawings illustrate aspects of the present invention and are not intended to limit the scope of the invention, which is encompassed by the claims. Figure 1 shows Ck
1 shows the cDNA sequence encoding β-8 and the corresponding amino acid sequence derived from this sequence. The first 21 amino acids are
Represents a putative leader sequence. All signal sequences were determined by N-terminal peptide sequencing of baculovirus expressed proteins. FIG. 2 shows the cDNA sequence encoding Ckβ-1 and the corresponding amino acid sequence derived from it. The first 19 amino acids represent the putative leader sequence. FIG. 3 is a cDNA encoding MIP-4
The sequence and the corresponding amino acid sequence derived from the sequence are shown. The first 20 amino acids represent the putative leader sequence.

FIG. 4 shows Ckβ-8 (upper row) and human MIP.
It represents the amino acid homology of -1α (lower row). The 4-cysteine properties of all chemokines are shown. Figure 5
Shows two amino acid sequences, of which the upper sequence is the human MIP-4 amino acid sequence and the lower sequence is human MIP-1α (human tonsil lymphocyte LD78 beta protein precursor). FIG. 6 shows an amino acid sequence alignment between Ckβ-1 (top) and human MIP-1α (bottom).

FIG. 7 shows HA-tagged Ckβ in COS cells.
1 is a photograph of a gel in which Ckβ-1 was electrophoresed after expressing -1. FIG. 8 shows Ck in the baculovirus expression system.
Fig. 6 is a photograph of an SDC-PAGE gel after expressing and purifying β-1. FIG. 9 shows Ck in the baculovirus expression system.
SDC-PAG after expression of β-8 and 3 step purification
It is a photograph of E gel. Figures 10-11: 46-well microchamber device (Neur
Ckβ by chemotaxis assay using a probe, Inc.)
The chemoacttractant activity of -8 was determined. The experimental procedure was as described in the manufacturer's manual. For each concentration of Ckβ-8 tested, migration in 5 high-power fields was investigated.
The results shown represent the average of the values obtained from two independent experiments. THP- (A) cells and human PBMCs
(B) shows chemoattractant activity.

FIG. 12: Changes in intracellular calcium concentration in response to Ckβ-8 were determined using a Hitachi F-2000 fluorescence spectrophotometer. Ckβ-8 expressed in bacteria was 5
Added to Indo-1-loaded THP-1 cells at a final concentration of 0 nM,
The intracellular level of calcium concentration was monitored. Figure 13: The monocyte cell line THP-1 was labeled with LPS (0.1-10n).
g / ml) or Ckβ-8 (up to 50 ng / ml) for 16 hours. Tissue culture supernatant was subjected to ELISA analysis
The amount of NF-α secreted was quantified. Figures 14-15: Human peripheral blood monocytes purified by elutriation were treated with increasing numbers of Ck [beta] -8 (produced by baculovirus) for 16 hours. The tissue culture supernatant was subjected to ELISA analysis to obtain TNF-α, I
The amount of secreted L-6, GM-CSF and granulocyte colony-stimulating factor (G-CSE) was quantified.

FIG. 16: A low density population of mouse bone marrow cells (1,500 cells / dish) with or without the indicated chemokines (100 ng / ml) in agar-containing medium, but with IL-3 (5 ng / ml). , SCF (100 ng / ml),
IL-1α (10 ng / ml), and M-CSF (5 ng / ml)
ml). The data shown is 2
Represents the average of the values obtained from 4 independent experiments (2 trials each). Colonies were counted on the 14th day of plating. The number of colonies generated in the presence of chemokines is expressed as the average percent of the number of colonies obtained in the absence of added chemokines. Figures 17-18 show HPP-CFC (Figure 17) and LP.
19 shows the effect of Ckβ-8 and Ckβ-1 on mouse bone marrow colony formation by P-CFC (FIG. 18).

FIG. 19 shows M-of newly isolated bone marrow cells.
Ckβ-1 and Ckβ-8 expressed by baculovirus against CFS and SCF stimulated colony formation
Shows the effect of. FIG. 20 ^: IL-3 of lin ⁻ population of bone marrow cells
And shows the effect of Ckβ-1 and Ckβ-8 on SCF stimulated proliferation and differentiation. Figure 21-22: of bone marrow cells lin ^- cells from a population GR-
1 and effect of Ckβ-8 and Ckβ-1 on generation of Mac-1 (surface marker) positive population. lin ⁻ cells were loaded with IL-3 (5 ng / ml) and SCF (100 ng / m).
l) alone (a), and Ckβ-8 (50 ng / ml) (b)
Alternatively, the cells were incubated in the growth medium supplemented with Ckβ-1 (50 ng / ml). The cells are then spinal cord (myeloid)
Differentiation GR.1, Mac-1, Sca-1, and CD45R
Stain with monoclonal antibody against surface antigen and
Analyzed by Scan. The data is large (Fig. 21)
And as a percentage of positive cells in both the small (FIG. 22) cell population.

FIG. 23 shows the presence of Ckβ-8 (+) in IL.
-3, shows suppression of bone marrow cell colony generation in response to M-CSF and GM-CSF. Figure 24: Ck [beta] -8 dose response suppresses myeloid cell colony production. Cells were isolated and processed as in Figure 23. Treated cells with agar-based colony formation in the presence of IL-3, GM-CSF or M-CSF (15 ng / ml) with or without 1, 10, 50 and 100 ng / ml Ckβ-8. 100 in the assay
Plated at a density of 0 cells / dish. Data are given as the percentage of colonies produced by a particular factor alone as colony formation. Data are shown as the average of duplicate dishes and error bars indicate standard deviation.

FIG. 25: Apoptosis by Ckβ-8 and Ckβ-1 in the presence or absence of hematopoietic cell growth factor.
Induction of cis. Mouse bone marrow cells were washed out of both the femur and tibia, separated by a phycol density gradient and monocytes removed by plastic attachment. Then, the obtained cell population was treated with IL-3 (5 ng / ml) and GM-CSF (5 ng / m).
l), M-CSF (10 ng / ml) and G-CSF (1
0 ng / ml) in a MEM-based medium supplemented with Ckβ-
Incubated overnight with or without 8 (50 ng / ml) or Ckβ-1 (250 ng / ml). In addition, cells were cultured in medium alone with or without Ckβ-8 and Ckβ-1. After 24 hours, cells were harvested and processed for apoptosis using the Boehringer Mannheim cell death ELISA kit. Data are presented as percent increase over background, which is the amount of apoptosis that occurs in cultures incubated in the presence of each growth factor.

FIG. 26: Expression of RNA encoding Ckβ-8 in human monocytes. Newly retried (elutri
ated) total RNA from monocytes was isolated and 100 U / ml hu
Treated with rIFN-g, 100 ng / ml LPS or both. RNA (8 μg) from each treatment was separated by electrophoresis on a 1.2% agarose gel and transferred to a nylon membrane. Quantification of Ckβ-8 mRNA was determined by ³² P-labeled cDNA.
The obtained band on autoradiography was quantified by a densitometer.

In accordance with one aspect of the invention, the derived amino acid sequences of FIGS. 1, 2 and 3 (SEQ ID NO: 2, respectively)
The mature polypeptide having 4 and 6), or 199
Mature Ck encoded by the cloned cDNA deposited under ATCC Deposit No. 75676 on February 9, 4th
β-8 polypeptide, and AT 9 Feb. 1994
Clone of the clone deposited as CC deposit number 75675
An isolated nucleic acid (polynucleotide encoding the mature MIP-4 polypeptide encoded by NA and the mature Ckβ-1 polypeptide encoded by the cDNA of the clone deposited on October 13, 1993 as ATCC Deposit No. 75572). Nucleotides) are provided.

The polynucleotide encoding the polypeptide of the present invention is structurally related to the pro-inflammatory supergene "intercrine" belonging to the cytokine and chemokine families. Ckβ-8 and MIP-4 are
Both are homologs of MIP-1, and MIP-1β
More homologous to MIP-1α. The polynucleotide encoding Ckβ-8 is derived from an aortic endothelial cDNA library and contains an open reading frame encoding a polypeptide of 120 amino acid residues, which exhibits significant homology with many chemokines. The best match is with human macrophage inflammatory protein 1 alpha, showing 36% identity and 66% similarity (Figure 4).

The polynucleotide encoding MIP-4 was derived from a human adult lung cDNA library, 89
It contains an open reading frame encoding a polypeptide of amino acid residues, which exhibits significant homology with many chemokines. The best match is with the human tonsillar lymphocyte LD78 beta protein, with 60% identity and 8
It shows a similarity of 9% (Fig. 5). In addition, the four cysteine residues found in all chemokines with a characteristic motif are conserved in both clones. Due to the fact that the first two cysteine residues in these genes are in adjacent positions, they are the "C-C" or β of chemokines.
Classified into subfamilies. In the other subfamily, the “CXC” or α subfamily, two cysteine residues are separated by one amino acid.

The polynucleotide encoding Ckβ-1 contains an open reading frame encoding a polypeptide of 93 amino acids, of which the first 1
Nine amino acids are the leader sequence and therefore the mature polypeptide contains 74 amino acid residues. Ckβ-1 shows significant homology with human macrophage inflammatory protein α, with 48% identity and 72% over 80 amino acids.
Have similarities. In addition, four cysteine residues containing the characteristic motif are conserved.

The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA form includes cDNA, genomic DNA and synthetic DNA. DN
A may be double-stranded or single-stranded and, if single-stranded, may be a code strand or a non-code (antisense) strand. The code sequence encoding the mature polypeptide is
The code sequence shown in FIGS. 1, 2 and 3 (SEQ ID NOS: 1, 3 and 5) or the coding sequence of the deposited clone may be the same or may be different. The sequence may encode the same mature polypeptide as Figures 1, 2 and 3 (SEQ ID NOS: 1, 3 and 5) or the deposited cDNA as a result of duplication or degeneracy of the genetic code.

The polynucleotides that coat the mature polypeptide of FIGS. 1, 2 and 3 (SEQ ID NOS: 2, 4 and 6) or the mature polypeptide encoded by the deposited cDNA are the coding sequence of the mature polypeptide only; the mature polypeptide. Peptide coding sequences and additional coding sequences such as leader sequences, secretory sequences and proprotein sequences; mature polypeptide coding sequences (and optionally additional coding sequences) and non-coding sequences, such as intron or mature polypeptide coding sequences. Non-coding sequences 5'and / or 3'to. Thus, the term "polynucleotide encoding a polypeptide" includes polynucleotides that contain only the coding sequence for the polypeptide and polynucleotides that contain additional coding and / or non-coding sequence.

The invention further relates to variants of the polynucleotides described herein, which variants have the deduced amino acid sequences of Figures 1, 2 and 3 (SEQ ID NOs: 2, 4 and 6). C of the polypeptide or the deposited clone
It encodes fragments, analogs and derivatives of the polypeptide encoded by DNA. The variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.

Accordingly, the invention provides a polynucleotide encoding the same mature polypeptide shown in FIGS. 1, 2 and 3 (SEQ ID NOs: 2, 4 and 6) or the same mature polypeptide encoded by the cDNA of the deposited clone,
As well as variants of such polynucleotides,
The variant is the polypeptide of Figures 1, 2 and 3 (SEQ ID NOs: 2, 4 and 6) or the cDNA of the deposited clone.
Encodes a fragment, inducible or analog of the polypeptide encoded by Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.

As mentioned above, the polynucleotide is
It has a code sequence shown in FIGS. 1, 2 and 3 (SEQ ID NOS: 1, 3 and 5) or a naturally occurring allelic variant of the code sequence of the deposited clone. You may As is known in the art, allelic variants may include alternative forms in which one or more nucleotide substitutions, deletions or additions may be included without substantially altering the function of the encoding polypeptide. Is a polynucleotide sequence of.

The present invention also provides a polynucleotide sequence that aids in the expression and secretion of the polypeptide from a host cell, such as a leader sequence that functions as a secretory sequence to control the movement of the polypeptide out of the cell. It also includes polynucleotides in which the coding sequences are fused in the same open reading frame. A polypeptide having a leader sequence is a preprotein and can be cleaved by the host cell to produce the mature form of the polypeptide. The polynucleotide may also encode a proprotein, which contains the mature protein and an additional 5'amino acid residue. A mature protein with a prosequence is a proprotein and is an inactive form of the protein. Cleavage of the prosequence leaves an active mature protein. Thus, for example, a polynucleotide of the invention may be a mature protein, or a protein having a prosequence, or a prosequence and a presequence (leader sequence).
It may encode a protein having both of the following.

The polynucleotide of the present invention may also have a coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention. The marker sequence may be a hexahistidine tag provided by the pQE-9 vector, which allows purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a mammalian host. , For example, when using COS-7 cells, hemagglutinin (H
A) It may be a tag. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (W
ilson, I. et al., Cell, 37: 767 (1984)).

The invention further provides that at least 50 between sequences.
%, Preferably 70% identity to a polynucleotide which hybridizes to the above sequence. In particular, the present invention relates to polynucleotides that hybridize to the above polynucleotides under stringent conditions. As used herein, "stringent conditions" means that hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences. In a preferred embodiment, the polynucleotide that hybridizes to the above polynucleotide is of substantially the same biological sequence as the mature polypeptide encoded by the cDNA of Figures 1, 2 and 3 (SEQ ID NOS: 1, 3 and 5) or the deposited cDNA. Encodes a polypeptide that retains function or activity.

Alternatively, the polynucleotide of the present invention comprises
It may be a polynucleotide having at least 20 bases, preferably 30 bases, more preferably at least 50 bases, which hybridizes to the above-mentioned polynucleotide of the present invention, has identity with the polynucleotide, and does not retain activity. . Such polynucleotides can be used, for example, as probes for the polynucleotides of SEQ ID NOS: 1, 3 and 5 for recovery, or as diagnostic probes, or as PCR primers.

The deposits herein will be maintained under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the purposes of Patent Procedure. These deposits are provided only for the convenience of those of ordinary skill in the art and are included in 35 USC § 11
It does not acknowledge that a deposit is required under paragraph 2. The sequence of the polynucleotide contained in the deposited material and the amino acid sequence encoded by the polynucleotide are incorporated herein by reference, and if there is any inconsistency with the description of the present specification, the sequence will prevail. . A license is required to manufacture, use, or sell the deposited material, and such a license is not permitted here.

The present invention further comprises Ckβ-8, MIP, which has the deduced amino acid sequence of FIGS. 1, 2 and 3 (SEQ ID NOs: 2, 4 and 6) or has the amino acid sequence encoded by the deposited cDNA. -4 and Ck
Beta-1 polypeptides, as well as fragments, analogs and derivatives of such polypeptides. The terms “fragment”, “derivative” and “analog” when referring to the polypeptides of FIGS. 1, 2 and 3 (SEQ ID NOs: 2, 4 and 6) or the polypeptide encoded by the deposited cDNA are as such A polypeptide that retains essentially the same biological function or activity as the polypeptide.
Thus, analogs include proproteins that can be activated by cleavage of the proprotein portion to produce the active mature polypeptide.

The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide. Fragments, derivatives or analogs of the polypeptides of Figures 1, 2 and 3 (SEQ ID NOS: 2, 4 and 6) or of the polypeptide encoded by the deposited cDNA are (i) conserved in one or more amino acid residues. Or is replaced by a non-conserved amino acid residue (preferably a conserved amino acid residue),
Such substituted amino acid residues are either encoded or not encoded by the genetic code, or (ii) one or more amino acid residues contains a substituent, or (iii) mature A polypeptide fused to another compound, such as a compound that increases the half-life of the polypeptide (eg, polyethylene glycol), or (iv) used for the purification of leader or secretory sequences or mature polypeptides. Additional amino acids, such as sequences or proprotein sequences, may be fused to the mature polypeptide. Such fragments, derivatives and analogs are within the purview of those skilled in the art from the teachings herein.

The polypeptides of the present invention are preferably provided in isolated form, preferably purified to homogeneity. By "gene" or "cistron" is meant a segment of DNA involved in the production of polypeptide chains. This includes regions preceding and following the coding region (leaders and trailers), as well as intervening sequences (introns) between individual coding segments (exons).

"Isolated" means that the material is removed from its original environment (eg, the natural environment if it is naturally occurring). For example, a natural polynucleotide or polypeptide present in a living animal is not isolated, but is isolated from some or all of the substances in which the polynucleotide or DNA or polypeptide coexists in the natural system. In some cases, it is isolated. Such a polynucleotide may be part of a vector, and / or such a polynucleotide or polypeptide may be part of a composition, nevertheless such vector or composition is native. It is isolated because it is not part of the environment.

The present invention also relates to vectors containing the polynucleotides of the invention, host cells genetically engineered with the vectors of the invention, and the production of polypeptides of the invention by recombinant techniques. Host cells are genetically engineered (transduced or transformed or transfected) with a vector of the invention (which may be, for example, a cloning vector or an expression vector). The vector may be in the form of, for example, a plasmid, virus particle, phage or the like. The genetically engineered host cell may activate the promoter, select a transformant, or Ck.
It can be cultured in a normal nutrient medium which is appropriately modified to amplify the β-8, MIP-4 and Ckβ-1 genes. Culture conditions such as temperature, pH and the like are those already used in the host cell selected for expression and will be apparent to those skilled in the art.

The expressed polynucleotides can be used to produce polypeptides by recombinant techniques. Thus, for example, the polynucleotide sequences may be included in any of a variety of expression vehicles, especially vectors or plasmids for expressing the polypeptide. Such vectors include chromosomal DNA, non-chromosomal DNA,
And synthetic DNA sequences such as derivatives of SV40; bacterial plasmids; phage DNA; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNAs such as vaccinia virus,
Includes adenovirus, fowlpox virus and pseudorabies. However, any other plasmid or vector can be used, so long as it can replicate and survive in the host.

Insertion of the appropriate DNA sequence into the vector can be accomplished by a variety of methods. Generally, the DNA sequence is inserted into the appropriate restriction endonuclease site by procedures known in the art. Such and other procedures are within the skill of those in the art. The DNA sequence in the expression vector is operably linked to an appropriate expression control sequence (promoter) to form an mRNA.
Direct synthesis. Typical examples of such promoters include the LTR or SV40 promoter, E. coli la
c or trp , the phage lambda P _L promoter, and other promoters known to control gene expression in prokaryotic or nucleated cells, or their viruses. The expression vector also contains a ribosome binding site for translation initiation and a transcription termination region. The vector also contains appropriate sequences for amplifying expression.

Furthermore, the expression vector contains a phenotypic trait for selection of transformed host cells, for example, dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or tetracycline resistance or ampicillin resistance in Escherichia coli. Is preferred. A vector containing an appropriate DAN sequence or an appropriate promoter or control sequence as described above transforms an appropriate host cell,
It can be used to express the protein in host cells. Representative examples of suitable host cells include bacterial cells,
E. coli, Streptomyces , Salmonella typhimuri
um ; fungal cells such as yeast; Drosophila S2 and Sf9
Insect cells such as; animal cells such as CHO, COS or Bowes melanoma; plant cells and the like. Selection of the appropriate host cell is within the skill of those in the art given the teachings herein.

More specifically, the present invention also includes recombinant constructs containing one or more of the sequences broadly described above. Such constructs include vectors such as plasmids and viral vectors in which the sequences of the invention are inserted in either the forward or reverse orientation. In a preferred embodiment of the invention, the construct further comprises a regulatory sequence, which regulatory sequence is
For example, it includes a promoter operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are examples. Bacterial: pQE70, pQE6
0, pQE-9 (Qiagen), pbs, pD10, phagescrip
t, psiX174, pbluescript SK, pBSKS, pNH
8A, pNH16a, pNH18A, pNH46A (Strata
gene), pTRC99a, pKK223-3, pKK2
33-3, pDR540, pRIT5 (Pharmacia).
Eukaryotic: pWLNEO, pSV2CAT, pOG44, p
XT1, pSG (Stratagene) pSVK3, pBPV, pM
SG, pSVL (Pharmacia). However, any other plasmid or vector can be used, so long as it can replicate and survive in the host.

The promoter region can be selected from the desired gene using a CAT (chloramphenicol transferase) vector, or another vector with a selectable marker. There are two such suitable vectors, PKK232-8 and PCM7. Specific named bacterial promoters include lac
I, lacZ, T3, T7, gpt, lambda P _R , P _L and tr
There is p etc. For eukaryotic promoters, the immediate early CMV,
These include HSV thymidine kinase, early and late SV40, LTRs from retroviruses, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.

In a further aspect, the invention relates to a host cell containing the above-described construct. The host cell may be a highly eukaryotic cell such as a mammalian cell, or a lower eukaryotic cell such as a yeast cell, or the host cell may be a prokaryotic cell such as a bacterial cell. Introduction of the construct into the host cell may be carried out by calcium phosphate transfection, DE
AE-dextran mediated transfection or electroporation (Davis, L., Dib
ner, M., Battey, I., Basic Methods in Molecular
Biology, (1986)). The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptide of the present invention can be synthesized and produced by a conventional peptide synthesizer.

The mature protein can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. A cell-free translation system is also the D of the present invention.
By using RNA derived from NA constructs,
It can be used for the production of such proteins.
Suitable cloning and expression vectors for use in prokaryotic and eukaryotic hosts are described by Sambrook et al.
Molecular Cloning; A Laboratory manual, 2nd
Edition, Cold Spring Harbor, NY, (1989), the disclosure of which is incorporated herein by reference.

Transcription of the DNA encoding the polypeptides of the present invention by highly eukaryotic organisms can be increased by inserting an enhancer sequence into the vector. The enhancer is
A cis-acting element of DNA, usually about 10
It is 300 bp long and acts on the promoter to increase its transcription. Origin of replication bp 100-270 SV40 on the late side
Examples include enhancers, cytomegalovirus early promoter enhancers, polyoma virus enhancers on the late side of the replication origin, and adenovirus enhancers.

Generally, the recombinant expression vector contains an origin of replication and a selectable marker which enables the transformation of the host cell such as the ampicillin resistance gene of E. coli and the S. cerevisiae TRP1 gene, and the downstream side. A promoter derived from a highly expressed gene that directs the transcription of the structural sequence of will be included. Such promoters may be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGR), α-factor, acid phosphatase, or heat shock proteins, among others. Heterologous structural sequences are assembled in proper phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space and extracellular environment. Optionally, the heterologous structural sequence may encode a fusion protein containing an N-terminal identification peptide that confers desired properties, such as stabilization and simplified purification of the expressed recombinant product.

Expression vectors useful for bacterial use are constructed by inserting a structural DNA sequence encoding the desired protein into a functional promoter and in operable reading frame with appropriate translation initiation and termination signals. The vector will include one or more phenotypic selectable markers, and an origin of replication to ensure maintenance of the vector and, if desired, amplification in the host.
Suitable prokaryotic hosts for transformation include E. coli, Ba
cillus subtilis , Salmonella typhimurium , and Pse
Various species within the genera udomonas, genus Streptomyces , and Staphylococcus are included, but others can be selected and used.

By way of non-limiting example, expression vectors useful for bacterial use include selectable markers and bacterial replication derived from a commercial plasmid containing the gene sequence of the well known cloning vector pBR322 (ATCC37017). There is a starting point. Such commercially available vectors include, for example, pKK223-3 (Pharmaci
a Fine Chemicals, Uppsala, Sweden) and GEM1 (Pro
mega Biotec, Madison, WI, USA) and the like. The "backbone" part of these pBR322 is combined with a suitable promoter and the structural sequence to be expressed.

After transformation of the appropriate host strain and growth of the host strain to the appropriate density, the selected promoter is induced by appropriate means (eg, temperature shift or chemical induction) and the cells are allowed to continue for a period of time. Incubate. Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification. Bacterial cells used for protein expression are freeze / thaw cycles, sonication, mechanical disruption,
Alternatively, it may be disrupted by any convenient method, such as by using a cytolytic agent. Such methods are well known to those of ordinary skill in the art.

Various mammalian cell culture systems can be used to express the recombinant protein.
Examples of mammalian expression systems include Gluzman, Cell, 2
3: 175, COS- of monkey kidney fibroblasts.
7 strains and other cell lines capable of expressing compatible vectors such as C127, 3T3, CHO, HeLa and B
HK cell line is mentioned. Mammalian expression vectors will contain an origin of replication, appropriate promoters and enhancers, and the required ribosome binding site, polyA site, splice donor and acceptor sites, transcription termination sequences, and 5'flagging nontranscribed sequences. . DNA sequences derived from the SV40 splice and the poly A site can be used to provide the required nontranscribed gene sequences.

Ckβ-8, MIP-4 and Ckβ-1
Is ammonium sulfate or ethanol precipitation, acid extraction,
Recovered from recombinant cell culture and purified by methods such as anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, and lectin chromatography. Protein refolding can be used as necessary to complete the three-dimensional structure of the mature protein. Finally, high performance liquid chromatography (HPLC) can be used for the final purification step.

The polypeptide of the present invention is a naturally purified product or a chemically synthesized product, or is recombinant from a prokaryotic or eukaryotic host (for example, cultured bacteria, yeast, higher plants, insects and mammalian cells). It is the product produced by the operation. Depending on the host cell used in the recombinant production method, the polypeptides of the present invention may or may not be glycosylated with mammalian or other eukaryotic carbohydrates. The polypeptides of the present invention may also include an initial methionine amino acid residue.

The polypeptides of the present invention can be used in a variety of immunoregulatory and inflammatory functions, as well as in numerous disease states. Ckβ-8, MIP-4 and Ckβ-
1 belongs to the chemokine family and is therefore a chemoattractant for white blood cells (mononuclear, middle neutrophils, T lymphocytes, eosinophils, basophils, etc.). Northern blot analysis is C
It shows that kβ-8, MIP-4, and Ckβ-1 are mainly expressed in hematopoietic tissues. Ckβ-8 has been shown to play an important role in the control of immune responses and inflammation. FIG. 26 shows that lipopolysaccharide induces Ckβ-8 expression from human mononuclear leukocytes.
Therefore, in response to the presence of endotoxin, C
Since kβ-8 is expressed by mononuclear leukocytes, administration of Ckβ-8 can be employed to regulate the immune response of host cells.

As shown in FIGS. 10-11, THP-
The chemoattractant action of Ckβ-8 on 1 cell (A) and PBMC (B) is significant. In addition, Ckβ-8 is THP
-1 induces significant mobilization of calciu in cells (Fig. 12), C
It has been shown that kβ-8 has a biological effect on monocytes. Furthermore, Ckβ-8 causes a dose-dependent chemotaxis and calcium mobilization response in human monocytes. Therefore, Ckβ-8, MIP-4, and Ckβ-1 can be used to promote wound healing by controlling the infiltration of target immune cells into the wound site. Similarly, the polypeptide of the present invention can enhance host defense against chronic infections such as mycobacterial infection by attracting or activating bactericidal leukocytes.

Furthermore, the polypeptide of the present invention can be used for antitumor therapy. This is because there is a demonstration example in which the tumor is regressed by injecting chemokine-expressing cells into the tumor as seen in the treatment of Karposi sarcoma. According to the analysis of FIG. 13 and FIGS.
It has been revealed that β-8 secretes TNF-α known as a tumor regression drug from THP-1 cells.
250 ng / ml of Ckβ-8 is 1200 picogram / m
Induces the production and secretion of l TNF-α. Also Ckβ
-8 induces human monocytes to secrete other tumor and tumor suppressors such as IL-6, IL-1 and G-CSF. Further, Ckβ-8, MIP-4 and Ckβ-1 are
Its chemoattractant activity stimulates invasion and activation of host defense (tumor killing) cells such as cytotoxic T cells and macrophages and thus can also be used to treat solid tumors.

The polypeptides of the present invention can also be used to inhibit the proliferation and differentiation of hematopoietic cells and thus protect bone marrow stem cells from chemotherapeutic agents during chemotherapy. 16 and 17 to 18 show Ckβ-
8 and Ckβ-1 are low proliferative latent colony forming cells (low
It has been revealed that it suppresses colony formation of proliferative potential colony forming cells) and that Ckβ-8 is a potent and specific inhibitor of LPP-CFC colony growth. FIG. 19 shows Ckβ-1
Specifically inhibits M-CSF-stimulated colony formation, whereas Ckβ-8 does not. However, as already shown, Ck
Both β-8 and Ckβ-1 significantly suppress the proliferation and differentiation of bone marrow cells. This antiproliferative effect allows for greater exposure to chemotherapeutic agents, thus making chemotherapy more effective.

Ckβ-8 and Ckβ-1 on a subpopulation of progenitor cells (granulocytes and macrophage cells / monocyte cells)
The inhibitory effect of polypeptides can be used for therapy to inhibit the proliferation of leukemia cells. 20, FIG. 21 to 22, and FIG.
Then, the committed cell (committed cell) of the cell line used
s) is removed and the resulting cell population is contacted with Ckβ-8 and Ckβ-1. Ckβ-1 reduces the Mac-1 positive cell population by nearly 50 percent. This is consistent with the result in FIG. 19 showing that Ckβ-1 induces suppression of M-CSF responsive colony forming cells. As shown in FIG. 23, Ckβ-8 suppresses the ability of progenitor cells to form colonies in response to IL-3, GM-CSF and M-CSF. Furthermore, as shown in Figure 24, a dose response of Ckβ-8 has been shown to suppress colony formation. This suppressive effect is due to the specific blockade of differentiation signals mediated by these factors or the cytotoxic effect on progenitor cells.

As another method of using the polypeptide of the present invention, T cell proliferation can be suppressed by suppressing IL-2 biosynthesis in, for example, autoimmune diseases and lymphocytic leukemia. In addition, Ckβ-8, MIP-4
And Ckβ-1 show that Langerhans cells in the skin are M
Since it is known to produce IP-1α, it can be used to suppress epidermal keratinocyte proliferation due to psoriasis (keratinocyte hyperproliferation). Ckβ-8, M
IP-4 and Ckβ-1 replenish cell debris-removing and connective tissue-promoting inflammatory cell recruitment and excess TGF
It can be used to prevent scarring during wound healing by both controlling β-mediated fibrosis. In addition, Ckβ-8,
Since MIP-4 and Ckβ-1 enhance vascular permeability, these polypeptides can be used to treat stroke, thrombocytosis, pulmonary embolism and myeloproliferative disorders.

Ckβ-8 can also be used in the treatment of leukemia and abnormally proliferating cells, such as tumor cells, by inducing apoptosis. As shown in FIG. 21, Ckβ-8 induces apoptosis in a population of hematopoietic progenitor cells. The polypeptides of the invention, and the polynucleotides encoding such polypeptides, are used as research reagents for in vitro purposes related to scientific research, DNA synthesis and the production of DNA vectors, and for the treatment of human diseases. It can be used to develop therapeutic and diagnostic agents for. For example, Ckβ-8 and Ckβ-1 are available for expansion of immature hematopoietic progenitor cells such as granulocytes, macrophages or monocytes by temporarily arresting differentiation. These bone marrow cells can be cultured in vitro.

Full length Ckβ-8, MIP-4 or Ck
The β-1 gene fragment can be used to isolate a full-length gene,
It can be used as a hybridization probe for a cDNA library to isolate a gene having a high sequence similarity or a similar biological activity to the gene. However, the probe preferably has at least 30 bases, and may include, for example, 50 or more bases. The probe can also be used to identify cDNA and genomic clones corresponding to full-length transcripts or clones containing the complete gene including regulatory and promoter regions, exons and introns. As an example of the screening, D that is already known for synthesizing an oligonucleotide probe is used.
There is a method of isolating the coding region of a gene by using the NA sequence. The labeled oligonucleotide having a sequence complementary to the sequence of the gene of the present invention is human cDNA
It is used to screen a library of A, genomic DNA or mRNA to determine which member of the library the probe hybridizes to.

The present invention also relates to Ckβ-8, M, as part of a diagnostic assay for detecting a disease associated with the presence of a mutation in a nucleic acid sequence or susceptibility to the disease.
It relates to the use of the IP-4 and Ckβ-1 genes. Such diseases are associated with underexpression of the chemokine polypeptide. Individuals with mutations in Ckβ-8, MIP-4 and Ckβ-1 can be detected at the DNA level by a variety of methods. Diagnostic nucleic acids can be obtained from cells of a patient, such as blood, urine, saliva, tissue biopsy and autopsy. Genomic DNA can be used directly for detection, or PCR (Saikiet) prior to analysis.
al., Nature, 324: 163-166 (1986)). RNA or c
DNA can also be used for the same purpose. For example, C
PCR primers complementary to the nucleic acids encoding kβ-8, MIP-4 and Ckβ-1 were Ckβ-8, MIP-
4 and Ckβ-1 mutations can be used to identify and analyze. For example, deletions and insertions can be detected from changes in the size of the amplification product compared to the normal genotype. The point mutation is Ckβ-, which is a radiolabeled amplified DNA.
8, MIP-4 and Ckβ-1 RNA, or radiolabeled Ckβ-8, MIP-4 and Ckβ-1 antisense DNA sequences. A perfectly matched sequence can be distinguished from a mismatched duplex by the difference in RNase A digestion and the melting temperature.

Genetic testing based on DNA sequence differences can be performed by detecting changes in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be seen by high resolution gel electrophoresis. DNA fragments with different sequences are denatured formamide gradient gel
(Here, the mobility of different DNA fragments is delayed at different positions according to their specific melting and partial melting temperatures) (eg Myers
Et al., Science, 230: 1242 (1985)).

Sequence changes at specific positions can also be revealed by nuclease protection assays such as RNase and S1 protection or chemical cleavage methods (eg Cotton et al., PNAS. USA. 8).
5: 4397-4401 (1985)). Therefore, the detection of a particular DNA sequence can be performed by hybridization, R
Nase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes (eg restriction fragment length polymorphism (RFLP)) and Southern blotting of genomic DNA.

In addition to conventional gel electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis. The present invention also relates to diagnostic assays for detecting altered levels of Ckβ-8, MIP-4 and Ckβ-1 proteins within various tissues. Because overexpression of these proteins compared to normal control tissue samples detects the presence of susceptibility to disease, eg, tumor or disease. Assays used to detect levels of Ckβ-8, MIP-4 and Ckβ-1 proteins in samples taken from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analyses. EL
Includes ISA and "sandwich" assays. ELISA assay (Coligan et al., Current Proto
cols in Immunology, 1 (2), Chapter 6, (1991))
First, Ckβ-8, MIP-4 and Ckβ-1
It involves preparing an antibody specific for the antigen, preferably a monoclonal antibody. Furthermore, a reporter antibody is prepared for the monoclonal antibody. For the reporter antibody,
Radioactive, fluorescent or, particularly here, a detectable reagent such as the horseradish peroxidase enzyme is attached. The sample is removed from the host and incubated on a solid support, such as a polyethylene dish, which binds the proteins in the sample. The free protein binding sites on the dish are then covered by incubating with a non-specific protein such as BSA.

The monoclonal antibody then binds to the Ckβ-8, MIP-4 and Ckβ-1 proteins attached to the polyethylene dish during incubation of the monoclonal antibody in the dish. All unbound monoclonal antibody is washed away with buffer. Here, addition of a reporter antibody conjugated to horseradish peroxidase to the dish results in the reporter antibody binding to monoclonal antibodies bound to Ckβ-8, MIP-4 and Ckβ-1. The unbound reporter antibody is then washed away. The peroxidase substrate was then added to the dish and the amount of color developed within a given time, Ckβ-8, MIP-4 and Ckβ contained in a given amount of patient sample when compared to a standard curve.
-1 Measure the amount of protein.

A competition assay can be used in which antibodies specific for Ckβ-8, MIP-4 and Ckβ-1 are bound to a solid support and labeled Ckβ.
Samples taken from −8, MIP-4 and Ckβ-1 and the host can be added to a solid support and the amount of label detected can be correlated with the amount of protein in the sample by, for example, liquid scintillation chromatography. The "sandwich" assay is similar to the ELISA assay. In the "sandwich" assay, Ckβ
-8, MIP-4 and Ckβ-1 are added to the solid support and allowed to bind to the antibody attached to the solid support. Then,
The second antibody binds to Ckβ-8, MIP-4 and Ckβ-1. A third antibody, labeled and specific for the second antibody, is then added to the solid support to bind the second antibody and then quantitate.

The present invention provides a method for identifying a chemokine polypeptide receptor. The gene encoding the receptor can be identified by any method well known to those skilled in the art, such as ligand panning and FACS sorting (Coligan et al., Current Pro.
tocols in Immu..1 (2), Chapter 5, (1991)). Preferably expression cloning can be used, in which polyadenylated RNA was prepared from cells responsive to the polypeptide and prepared from this c
The DNA library is divided into pools and used to transfect COS cells and other cells that are not responsive to the polypeptide. Transfected cells grown on glass slides are exposed to labeled polypeptides.
Labeling the polypeptide can be accomplished in a variety of ways, including iodination or incorporating recognition sites for site-specific protein kinases. After immobilization and incubation, slides are subjected to autoradiographic analysis. Positive pools were identified and repeated (iterativ
e) Subpools are prepared and retransfected by using the subpooling and rescreening process, which ultimately results in a single clone encoding the putative receptor.

As another approach to receptor identification,
The labeled polypeptide can be photoaffinity-linked with cell membrane or extract preparations that express the receptor molecule. The crosslinked material is separated by PAGE analysis and exposed to X-ray film. A labeled complex containing the receptor for the polypeptide is cut out and decomposed into peptide fragments,
It can be subjected to protein microsequencing. Amino acid sequences obtained from microsequencing identify genes encoding putative receptors
It can be used to design a set of degenerate oligonucleotide probes for screening a cDNA library.

This invention provides a method of screening compounds to identify agonists and antagonists to the chemokines polypeptides of the invention. An agonist is a compound that has a biological function similar to that of the polypeptide, while an antagonist interferes with such function. Chemotaxis is achieved by placing cells that are chemically attracted by any of the polypeptides of the invention on top of a filter with pores of sufficient diameter (about 5 μm) to allow the cells. It can be assayed. The concentration of agonist is placed by placing a solution of the potential agonist in the lower part of the chamber and an appropriate control medium in the upper compartment, thus counting cells migrating into the porous membrane or through the membrane over time. Measure the slope.

When assaying for antagonists, the chemokine polypeptides of the invention are placed at the bottom of the chamber and potential antagonists are added to determine if chemotaxis of cells is impeded. Alternatively, mammalian cell or membrane preparations expressing the receptor for the polypeptides of the invention can be incubated with a labeled chemokine polypeptide (eg, radiolabeled) in the presence of the compound. The ability of the compound to interfere with this interaction can then be measured. When assaying agonists by this method, the ability of the agonist itself to interact with the receptor in the absence of chemokines can be measured.

Ckβ-8, MIP-4 and Ckβ-1
Examples of potential antagonists of A. cerevisiae include antibodies, or in some cases oligonucleotides that bind to the polypeptide. Another example of a potential antagonist is a negative dominant mutation of the polypeptide. A negative dominant mutation is a polypeptide that binds to the receptor for wild-type polypeptide but retains no biological activity. Antisense constructs prepared using the antisense method are also potential antagonists. Antisense methods control gene expression by triple-helix formation of antisense DNA or RNA, both methods based on the binding of polynucleotides to DNA or RNA. For example, the 5'coding portion of the polynucleotide sequence encoding the mature polypeptide of the invention is used to design an antisense RNA oligonucleotide of about 10-40 base pairs in length.

DNA oligonucleotides are designed to be complementary to regions of genes involved in transcription (triple-helix, Lee et al., Nucl. Acids Res., 6:
3073 (1979); Cooney et al., Science, 241:
456 (1988); and Dervan et al., Science. 25.
1: 1360 (1991)), which prevents transcription and production of the chemokine polypeptide. Antisense RNA oligonucleotides hybridize to mRNA in vivo and prevent the mRNA molecule from being translated into a polypeptide (antisense-Okano, J. Neuroch.
em., 56: 560 (1991); Oligonucleotides as
Antisense Inhibitors of Gene Expression, CR
C Press, Boca Raton, FL (1988)). Also,
The oligonucleotides can also be delivered to cells such that the antisense RNA or DNA is expressed in vivo to suppress the production of the chemokine polypeptide.

Other potential chemokine antagonists are:
A peptide derivative of a polypeptide of the invention, which naturally or synthetically of the polypeptide, has lost biological function but still binds to the polypeptide, thereby effectively interfering with the receptor. It is a modified analog. Examples of peptide derivatives include, but are not limited to, small peptides or peptide-like molecules. Antagonists can be used to treat diseases elicited or enhanced by MIPs, such as autoimmune diseases and chronic inflammatory and infectious diseases. Examples of autoimmune diseases are multiple sclerosis and insulin-dependent diabetes.

Antagonists can also be used in the treatment of infectious diseases including silicosis, sarcoidosis and idiopathic pulmonary fibrosis by preventing the recruitment and activation of mononuclear phagocytes. Antagonists can also be used in the treatment of infectious diseases, including idiopathic hypereosinophilic syndrome, by preventing the production and migration of eosinophils. Endotoxin shock can also be treated with antagonists by preventing the migration of macrophages and the production of chemokines of the invention by macrophages. Antagonists can also be used to treat atherosclerosis by preventing monocyte infiltration in the arterial wall.

Antagonists also inhibit histamine mediated, including late phase allergic reactions, chronic urticaria and atopic dermatitis, by inhibiting mast cell and basophil degranulation and histamine release induced by chemokines. It can also be used to treat allergic reactions and immune disorders. In addition, Ig of allergic asthma, allergic rhinitis, allergic dermatitis, etc.
E-mediated allergic reactions can also be treated. Antagonists can also be used to treat chronic and acute inflammation by preventing monocytes from being attracted to the wound site. Also, since chronic and acute inflammatory lung diseases are associated with sequestration of monocyte-phagocytic cells in the lung, antagonists can also be used to control normal pulmonary macrophage populations.

Antagonists can also be used to treat rheumatoid arthritis by preventing monocytes from being attracted to the synovial fluid in the joints of patients. Monocyte influx and activation play an important role in the pathogenesis of both degenerative and inflammatory arthritis. Antagonists can also be used to interfere with deleterious cascades primarily attributed to IL-1 and TNF and prevent biosynthesis of other inflammatory cytokines. In this way the antagonist can be used to prevent inflammation. Antagonists can also be used to suppress chemokine-induced prostaglandin-independent fever.

The antagonist can also be used to treat bone marrow failure cases such as aplastic anemia and myelodysplastic syndrome. Antagonists can also be used in the treatment of asthma and allergies by preventing the accumulation of eosinophils in the lung. Antagonists are also prominent in the asthmatic lung, the subepithelial basement membrane fibros.
can be used to treat is). The antagonist can be used in the composition with a pharmaceutically acceptable carrier, as described below.

The chemokines polypeptides and agonists and antagonists can be used in combination with a suitable drug carrier. Such compositions comprise a therapeutically effective amount of the polypeptide and a pharmaceutically acceptable carrier excipient. Such carriers include, but are not limited to, saline, buffered saline, glucose, water, glycerol, ethanol, and combinations of the above components. The formulation should suit the mode of administration.

The present invention also relates to 1 of the pharmaceutical composition of the present invention.
Also provided are pharmaceutical packs or kits containing one or more containers filled with one or more ingredients. Such containers may be accompanied by a notice in the form prescribed by governmental authorities regulating the manufacture, use or sale of pharmaceutical or biological products. This notification letter gives the license to manufacture, use or sell for administration to humans by governmental authorities. In addition, the polypeptides and agonists and antagonists of the invention can be used with other therapeutic compounds.

The pharmaceutical compositions may be administered in a convenient manner by the topical, intravenous, intraperitoneal, intramuscular, intratumoral, subcutaneous, intranasal or intradermal routes. The pharmaceutical composition is administered in an amount effective to treat and / or prevent the particular indication. Generally, the polypeptides of the invention will be administered in an amount of at least 10 μg / kg body weight per day, and most often in an amount not exceeding about 8 mg / kg body weight. In most cases, the dosage is from about 10 μg / kg body weight to about 1 mg / kg body weight per day, considering the route of administration, symptoms, etc. Chemokine polypeptides, and agonists or antagonists that are polypeptides, can be used in accordance with the present invention by expressing such polypeptides in vivo, which is often referred to as "gene therapy."

Therefore, for example, cells removed from a patient are treated with a polynucleotide (D
NA or RNA) is engineered ex vivo and then the cells so engineered are provided to the patient to be treated with the polypeptide. Such methods are well known in the art. For example, cells can be engineered by procedures known in the art by using retroviral particles containing RNA encoding the polypeptides of the present invention.

Similarly, cells may be engineered in vivo to express a polypeptide in vivo, for example by procedures known in the art. Producer cells producing retroviral particles containing RNA encoding the polypeptides of the invention, as known in the art, may be used to engineer cells in vivo to express the polypeptide in vivo. Can be administered to. These and other methods of administering the polypeptides of the present invention by such methods must be apparent to those skilled in the art from the teachings of the present invention. For example, the expression vehicle for manipulating cells may be an adenovirus other than a retrovirus, eg, one that can be used to engineer cells in vivo after combination with a suitable delivery vehicle.

The retroviral plasmid vector may be derived from a retrovirus, and the retrovirus is not limited to these, but includes Moloney murine sarcoma virus, Moloney murine leukemia virus, spleen necrosis virus, and Rous sarcoma. Virus and Harvey sarcoma virus. In a preferred embodiment, the retroviral expression vector pMV-7 is flagged by the Moloney murine sarcoma virus long terminal repeat (LTP) and is a selectable drug resistance gene under the control of the herpes simplex virus (HSV) thymidine kinase (tk) promoter. Including neo. The unique EcoRI and HindIII sites facilitate the introduction of coding sequences (Kirschmeier, PT et al.,
DNA, 7: 219-25 (1988)).

Vectors include one or more suitable promoters, including, but not limited to, retrovirus LTR; SV40 promoter; and human cytomegalovirus (CM).
V) (CMV) promoter (Miller et al., Biotechniqu
es , Vol. 7, No. 9, 980-990 (1989)), or other promoters such as eukaryotic promoters including (but not limited to) histmin, polIII, and β-actin promoters. Cell promoter). Selection of a suitable promoter will be apparent to those of ordinary skill in the art in view of the teachings contained herein. The nucleic acid sequence encoding the polypeptide of the invention is under the control of a suitable promoter,
The promoters include, but are not limited to, viral thymidine kinase promoters such as herpes simplex thymidine kinase promoter; retrovirus LTR, β-actin promoter, and natural promoters that control the gene encoding the polypeptide. .

Retroviral plasmid vectors can be used to transduce packaging cell lines to produce producer cell lines. Examples of packaging cells that can be transfected include, but are not limited to, PE501, P
A317 and GP + am12. Any means known in the art can be used to transduce the packaging cells with the vector. Such means include, but are not limited to, electroporation, the use of liposomes, and CaPO ₄ precipitation.

The producer cell line produces infectious retroviral vector particles which contain a nucleic acid sequence encoding a polypeptide of the invention. Such retroviral vector particles can then be used to transduce eukaryotic cells in vitro or in vivo. Transduced eukaryotic cells express a nucleic acid sequence encoding the polypeptide. Eukaryotic cells that can be transduced include, but are not limited to, fibroblasts and endothelial cells.

The sequences of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize to a particular location on an individual human chromosome. Moreover, there is an ongoing need to identify specific sites on chromosomes. Chromosome mark reagent based on actual sequence data (repeating polymorphism)
Is currently rarely used to mark the location of chromosomes. DN to the chromosome according to the invention
Mapping A is an important first step in correlating these sequences with genes associated with disease.

Briefly, the sequence is from cDNA to PC
It can be mapped on the chromosome by preparing the R primer (15-25 bp is preferred). c
Computer analysis of DNA is used to quickly select primers that do not span more than one exon within genomic DNA, complicating the amplification process. Then,
These primers are used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only hybrids containing the human gene corresponding to that primer will produce an amplified fragment.

PCR mapping of somatic cell hybrids is a method for rapidly assigning a particular DNA to a particular chromosome. The present invention can be used with the same oligonucleotide primers to perform sublocalization in a similar manner on a panel of fragments from a particular chromosome or pool of larger genomic clones. Other mapping strategies that can also be used to map to that chromosome include in situ hybridization, labeled flow-sor.
ted) prescreening with chromosomes and preselection by hybridization to a constructed chromosome-specific cDNA library.

Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosome spreads can be used to provide accurate chromosomal location in one step. This method can be used with short cDNAs of only 500 or 600 bases. For an overview of this method, see Verma et al., Human Chromsom.
es: a Manual of Basic Techniques, Pergamon
See Press, New York (1988).

Once a sequence has been mapped to a precise chromosomal location, the physical location of the sequence on the chromosome can be correlated with genetic map data. Such data can be found, for example, in V.I. McKusick, Mendelian Inheritanc
It can be found at e in Man, available online from the Jones Hopkins University Welch Medical Library. Then, the relationship between the gene mapped to the same chromosomal region and the disease is identified by linkage analysis (coinheritance of physically adjacent genes).

Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is found in some or all of the affected individuals but not in any of the normal individuals, then such mutations are considered to be the cause of the disease. With the current resolution of physical and genetic mapping, a cDNA precisely localized to a chromosomal region associated with disease can be one of 50 to 500 potential etiological genes.

The polypeptides of the invention, fragments or other derivatives thereof, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies may be, for example, polyclonal or monoclonal antibodies. The invention also includes chimeric antibodies, single chain antibodies and humanized antibodies, as well as Fab fragments, or the products of Fab expression libraries. Various methods known in the art can be used to produce such antibodies and fragments.

Antibodies raised against the polypeptides corresponding to the sequences of the invention or their in vivo receptors are:
It can be obtained by directly injecting the polypeptide into an animal or by administering the polypeptide to an animal, preferably a non-human. The antibody so obtained will then bind the polypeptide itself. In this way, even sequences encoding fragments of the polypeptide can be used to generate antibodies that bind to the complete native polypeptide. Such antibodies can then be used to isolate the polypeptide from tissues expressing the polypeptide.

For the preparation of monoclonal antibodies, any method which produces antibodies by continuous cell line culture can be used. As an example, the hybridoma method (Kohler and Milstein, 1975, Nature, 2
56: 495-497), trioma method, human B cell hybridoma method (Kozbor et al., 1983, Immunology T.
4:72), and the EBV-hybridoma method for the production of human monoclonal antibodies (Cole et al., 1985,
Monoclonal Antibodies and Cancer Therapy, Ala
n R. Liss, Inc., pp. 77-96).

The methods described for the production of single chain antibodies (US Pat. No. 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. .. Also, transgenic mice can be used to express humanized antibodies to immunogenic polypeptide products of this invention. The invention will be further described in more detail with reference to the following examples. However, it should be understood that the invention is not limited to these examples. All parts or amounts are by weight unless otherwise noted.

To facilitate the understanding of the following examples, we will describe frequently occurring methods and / or terminology. “Plasmid” is designated by a lowercase p before and / or after an uppercase letter and / or number.
The starting plasmids described herein are either commercially available, publicly available without restriction, or can be constructed from available plasmids according to published procedures. In addition, plasmids equivalent to those described are known in the art,
It will be apparent to those skilled in the art.

"Digestion" of DNA means catalytic cleavage of DNA by a restriction enzyme that acts only on a specific sequence in the DNA. Various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were similar to those known to those skilled in the art. For analytical purposes, typically around 20μ
Use 1 μg of plasmid or DNA fragment with l buffer containing about 2 units of enzyme. For the purpose of isolating DNA fragments for plasmid construction, usually 5 to 50 μg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate amounts of buffer and substrate for a particular restriction enzyme have been specified by the manufacturer. Incubation times of about 1 hour at 37 ° C are commonly used, but may vary according to the supplier's instructions. After digestion, the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.

Size separation of the cleaved fragments was performed by Goeddel,
D. et al., Nucleic Acids Res., 8: 4057 (198).
Performed using an 8 percent polyacrylamide gel as described in 0). "Oligonucleotide"
Refers to chemically synthesized single-stranded polydeoxynucleotides or two complementary polydeoxynucleotide strands. Since such synthetic oligonucleotides do not have a 5'phosphate, they will not bind to other oligonucleotides without the addition of phosphate with ATP in the presence of the kinase. Synthetic oligonucleotides will ligate to fragments that have not been dephosphorylated.

"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T. et al., Supra, p. 146). Unless otherwise stated, ligation was carried out using known buffers and conditions, with T4 DNA ligase (“ligase”) per 0.5 μg of approximately equimolar concentration of the DNA fragment to be ligated.
It can be carried out using 10 units. Unless otherwise stated, transformation was done by Graham, F. and Van der Eb, A.,
Virology, 52: 456-457 (1973).

Example 1 Bacterial Expression and Purification of Ckβ-8 DNA Sequence Encoding Ckβ-8, ATCC # 7
5676 was first amplified using PCR oligonucleotide primers corresponding to the 5'and 3'terminal sequences of the processed Ckβ-8 protein (excluding the signal peptide sequence) and the 3'side vector sequence of the Ckβ-8 gene. did. The nucleotides corresponding to BamHI and XbaI were added to the 5'and 3'sequences, respectively.
The 5'oligonucleotide primer has the sequence 5'TCAGGAT
Having CCGTCACAAAAGATGCAGA3 '(SEQ ID NO: 7), BamH
It contains an I-restriction enzyme site followed by 18 nucleotides of the Ckβ-8 coding sequence starting at the putative final amino acid of the processing protein. 3'sequence: 5'CGCTCTA
GAGTAAAACGACGGCCAGT3 '(SEQ ID NO: 8) contains a sequence complementary to the XbaI site.

These restriction enzyme sites correspond to those on the bacterial expression vector PQE-9 (Qiagen, Inc., Chatsworth, CA). PQE-9 is
Antibiotic resistance (Amp ^r ), bacterial origin of replication (ori), I
Promoter operator (P /
O), ribosome binding site (RBS), 6-His tag and restriction enzyme site. Then, pQE-
9 is digested with BamHI and XbaI. The amplified sequence is ligated and inserted in-frame into PQE-9 with the sequences encoding the histidine tag and RBS. The ligation mixture is then used to transform E. coli strain M15 / rep4 available from Qiagen. M15 / r
ep4 contains multiple copies of the plasmid pREP4,
This plasmid expresses the 1acI repressor and also confers kanamycin resistance (Kan ^r ). L transformant
Ampicillin / kanamycin resistant colonies are selected, identified by their ability to grow on B plates.

Plasmid DNA is isolated and confirmed by restriction analysis. A clone containing the desired construct was cloned into Amp
(100 ug / ml) and Kan (25 ug / ml) were grown overnight in liquid culture in LB medium (O / N).
This O / N medium is used to inoculate a large culture at a ratio of 1: 100 to 1: 250. Cells are grown to an optical density 600 (OD ⁶⁰⁰ ) of 0.4 to 0.6. next,
IPTG (“Isopropyl-BD-thiogalactopyranoside”) is added at a final concentration of 1 mM. IPTG is 1
Induced by inactivating the acI repressor, P
Removal of / O leads to increased gene expression. Allow cells to grow for an additional 3-4 hours. The cells are then harvested by centrifugation. The cell pellet is chaotropic.
opic) agent, solubilized in 6 molar guanidine HC1. After clarification, nickel-chelate column chromatography (Hochuli, E. et al., J. Chromatogra ) under conditions that allow for tight binding by proteins containing a 6-His tag.
phy 411: by 177-184 (1984)), to purify the Ckβ-8 dissolved from the solution. Ckβ-8
(95% pure) was eluted from the column with 6M guanidine HC1 pH 5.0 and 3M guanidine HC1 for regeneration.
Adjust to 1,100 mM sodium phosphate, 10 mol glutathione (reduced) and 2 mol glutathione (oxidized). After a 12 hour incubation in this solution, the protein is dialyzed against 10 molar sodium phosphate.

Example 2 Bacterial Expression and Purification of MIP-4 DNA Sequence Encoding MIP-4, ATCC # 7
5675 was first amplified using PCR oligonucleotide primers corresponding to the 5'and 3'sequences of the processed MIP-4 protein (excluding the signal peptide sequence). The nucleotides corresponding to BamHI and XbaI were added to the 5'and 3'sequences, respectively. The 5'oligonucleotide primer has the sequence 5'TCA
MIP having GGATCCTGTGCACAAGTTGGTACC 3 '(SEQ ID NO: 9) and starting from the BamHI restriction enzyme site and the putative final amino acid of the following processing protein
-4 containing 18 nucleotides of the coding sequence. 3'sequence:
5'CGCTCTAGAGTAAAACGACGGCCAGT 3 '(SEQ ID NO: 1
0) contains a sequence complementary to the XbaI site.

These restriction enzyme sites correspond to the bacterial expression vector pQE-9 (Qiagen, Inc., Chatsworth, CA).
It corresponds to the above restriction enzyme site. pQE-9
Is antibiotic resistance (Amp ^r ), bacterial origin of replication (ori),
IPTG controllable promoter operator (P / O), ribosome binding site (RBS), 6-His
It encodes tags and restriction enzyme sites. Then p
QE-9 was digested with BamHI and XbaI and the amplified sequence was ligated and inserted in frame with the sequences encoding the histidine tag and RBS into pQE-9. The ligation mixture was then used to transform an E. coli strain available from Qiagen. M15 / rep4
Contains multiple copies of the plasmid pREP4, which expresses the 1acI repressor and also confers kanamycin resistance (Kan ^r ). Transformants are identified by their ability to grow on LB plates and ampicillin / kanamycin resistant colonies are selected.

Plasmid DNA is isolated and confirmed by restriction analysis. A clone containing the desired construct was cloned into Amp
(100 ug / ml) and Kan (25 ug / ml) were grown overnight in liquid culture in LB medium (O / N). Using the O / N culture medium, 1: 100 to 1: 250
Inoculate a large culture at the ratio of. Cells to 0.4-0.6
To an optical density of 600 (OD ⁶⁰⁰ ). IPTG (“Isopropyl-BD-thiogalactopyranoside”) was then added at a final concentration of 1 mM. IPTG
Induces by inactivating the 1acI repressor, removing P / O leading to increased gene expression. The cells were grown for an additional 3-4 hours. The cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic agent, 6 molar guanidine HC1. After clarification, nickel-chelate column chromatography (Hochuli, E. et al., J. Chromatography ) under conditions that allow for tight binding by proteins containing 6-His tags.
411: 177-184 (1984)), the dissolved MIP-4 was purified from this solution. MIP-4
(95% pure) was eluted from 6 mol guanidine HC1 pH 5.0 and 3 mol guanidine HC1, 10 for regeneration.
Adjusted to 0 mM sodium phosphate, 10 mol glutathione (reduced form) and 2 mol glutathione (oxidized form).
After a 12 hour incubation in this solution, the protein was dialyzed against 10 molar sodium phosphate.

Example 3 Bacterial Expression and Purification of Ckβ-1 DNA Sequence Encoding Ckβ-1, ATCC # 7
5572 was first amplified using PCR oligonucleotide primers corresponding to the 5'and 3'terminal sequences of the processed Ckβ-1 protein (excluding the signal peptide sequence), and the nucleotides corresponding to BamHI and XbaI were Added to the 5'and 3'sequences respectively. The 5'oligonucleotide primer has the sequence 5'G
CCCGCGGATCCTCCTCACGGGGACCTTAC 3 '(SEQ ID NO: 11)
With a BamHI restriction site followed by the amino acid that is assumed to be the last amino acid in the processing protein.
It contains 15 nucleotides of the kβ-1 coding sequence. 3'sequence: 5'GCCTGCTCTAGATCAAAGCAGGGAAGCTCCAG 3 '(SEQ ID NO: 12) contains a sequence complementary to the XbaI site, a transcription termination codon and the last 20 nucleotides of the Ckβ-1 coding sequence.

These restriction enzyme sites correspond to those on the bacterial expression vector PQE-9 (Qiagen, Inc., Chatsworth, CA). PQE-9 is
Antibiotic resistance (Amp ^r ), bacterial origin of replication (ori), I
Promoter operator (P /
O), ribosome binding site (RBS), 6-His tag and restriction enzyme site. Then, pQE-
9 was digested with BamHI and XbaI and the amplified sequence was ligated into PQE-9 and inserted in frame with the sequences encoding the histidine tag and RBS. Then,
The ligation mixture was used to transform an E. coli strain available from Qiagen. M15 / rep4 contains multiple copies of the plasmid pREP4, which expresses the 1acI repressor and also confers kanamycin resistance (Kan ^r ). Transformants were identified by their ability to grow on LB plates and ampicillin / kanamycin resistant colonies were selected.

Plasmid DNA was isolated and confirmed by restriction analysis. A clone containing the desired construct was cloned into Amp
(100 ug / ml) and Kan (25 ug / ml) were grown overnight in liquid culture in LB medium (O / N).
This O / N medium is used to inoculate a large culture at a ratio of 1: 100 to 1: 250. Cells were grown to an optical density 600 (OD ⁶⁰⁰ ) of 0.4 to 0.6. next,
IPTG (“Isopropyl-BD-thiogalactopyranoside”) was added at a final concentration of 1 mM. IPTG is 1
Induced by inactivating the acI repressor, P
Removal of / O leads to increased gene expression. The cells were grown for an additional 3-4 hours. The cells were then harvested by centrifugation. The cell pellet is chaotropic.
opic) agent, solubilized in 6 molar guanidine HC1. After clarification, nickel-chelate column chromatography (Hochuli, E. et al., J. Chromatogra ) under conditions that allow for tight binding by proteins containing a 6-His tag.
phy 411: by 177-184 (1984)), was purified Ckβ-1 dissolved from the solution. Ckβ-1
(95% pure) was eluted from the column with 6M guanidine HC1 pH 5.0 and 3M guanidine HC1 for regeneration.
Adjustments were made to 1,100 mM sodium phosphate, 10 mol glutathione (reduced form) and 2 mol glutathione (oxidized form). After a 12 hour incubation in this solution, the protein was dialyzed against 10 molar sodium phosphate.

Example 4 Expression of Recombinant Ckβ-8 in COS Cells Expression of plasmid CMV-Ckβ-8HA is derived from vector pcDNAI / Amp (Invitrogen) containing: 1) SV40 origin of replication, 2 ) Ampicillin resistance gene, 3) E. coli origin of replication, 4) CMV promoter followed by polylinker region, SV40 intron and polyadenylation site. A DNA fragment encoding all of the Ckβ-8 precursor and the HA tag fused in-frame to the 3'end of the precursor was cloned into the polylinker site of the vector, therefore expression of the recombinant protein is dependent on the CMV promoter. Commanded below. HA tags are as previously described (I.W.
ilson et al., Cell, 37: 767 (1984)), corresponding to an epitope derived from the influenza hemagglutinin protein. By injecting the HA tag into the target protein, the recombinant protein can be easily detected with an antibody that recognizes the HA epitope.

The construction strategy of the plasmid is as follows: the DNA sequence encoding Ckβ-8, ATCC
# 75676 is constructed by PCR using two primers: 5'primer 5'GGAAAGCTTATGAAGGTC.
TCCGTGGCT 3 '(SEQ ID NO: 13) contains 18 nucleotides of the Ckβ-8 coding sequence starting from the HindIII site followed by the start codon; 3'sequence 5'CGCTCTAGAT
CAAGCGTAGTCTGGGACGTCGTATGGGTAATTCTTCCTGGTCTTGATCC
The 3 '(SEQ ID NO: 14) contains the sequence complementary to the XbaI site, the translation stop codon, the HA tag and the last 20 nucleotides of the Ckβ-8 coding sequence (excluding the stop codon). Therefore, the PCR product contains a HindIII site, a Ckβ-8 coding sequence followed by an HA tag fused in frame, a translation stop codon next to the HA tag, and an XbaI site. PCR amplified DN
A fragment and vector, pcDNAI / Amp to HindII
Digest with I and XbaI restriction enzymes and ligate.

The ligation mixture was transformed into E. coli strain SURE.
(Stratagene Cloning Systems, La Jolla, CA), and the transformed culture is plated on ampicillin medium plates to select resistant colonies. Plasmid DNA is isolated from transformants and checked for the presence of the correct fragment by restriction analysis. Recombinant Ckβ
For expression of −8, COS cells were treated with DEAE-DEXTRA.
N method (J. Sambrook, E. Fritsch, T. Maniatis,
Molecular Cloneing: A Laboratory Manual, Cold Spri
ng Laboratory Press, (1989)). The Ckβ-8-HA protein was radiolabeled and immunoprecipitated (E. Harlo
w, D. Lane, Antibodies: A Laboratory Manual, Col
d Spring Harbor Laboratory Press, (1988)). Cells are labeled with ³⁵ S-cysteine for 8 hours, 2 days after transfection. Next, the medium was collected and the cells were washed with a detergent (RIPA buffer (150 m
M NaCl, 1% NP-40, 0.1% SDS, 1% N
P-40, 0.5% DOC, 50 mM Tris, pH 7.5)
(Wilson, I., et al., Supra, 37: 767 (198).
Dissolve in 4)). Both cell lysate and medium are precipitated with HA-specific monoclonal antibody. The precipitated protein is analyzed on a 15% SDS-PAGE gel.

Example 5 Expression of Recombinant MIP-4 in COS Cells Expression of plasmid CMV-MIP-4HA is derived from vector pcDNAI / Amp (Invitrogen) containing: 1) SV40 origin of replication, 2 ) Ampicillin resistance gene, 3) E. coli origin of replication, 4) CMV promoter followed by polylinker region, SV40 intron and polyadenylation site. A DNA fragment encoding all of the MIP-4 precursors, and the HA tag fused in frame to the 3'end of the precursor, was cloned into the polylinker site of the vector, therefore expression of the recombinant protein is dependent on the CMV promoter. Commanded below. HA tags are as previously described (I.W.
ilson et al., Cell, 37: 767 (1984)), corresponding to an epitope derived from the influenza hemagglutinin protein. By injecting the HA tag into the target protein, the recombinant protein can be easily detected with an antibody that recognizes the HA epitope.

The plasmid construction strategy is as follows: DNA sequence encoding MIP-4, ATCC
# 75675 is constructed by PCR using two primers: 5'primer 5'GGAAAGCTTATGAAGGGC.
CTTGCATGCTGCC 3 '(SEQ ID NO: 15) is HindIII
Contains 20 nucleotides of the MIP-4 coding sequence starting from the site followed by the start codon; 3'sequence 5'CGCTCT
AGATCAABCGTAGTCTGGGACGTCGTATGGGTAGGCATTCAGCTTCAGGT
C3 '(SEQ ID NO: 16) contains the sequence complementary to the XbaI site, the translation stop codon, the HA tag and the last 19 nucleotides of the MIP-4 coding sequence (excluding the stop codon). Therefore, the PCR product contains a HindIII site, a MIP-4 coding sequence followed by an HA tag fused in frame, a translation stop codon next to the HA tag, and an XbaI site. PCR amplified DN
A fragment and vector, pcDNAI / Amp to HindII
Digest with I and XbaI restriction enzymes and ligate.

The ligation mixture was transformed into E. coli strain SURE.
(Stratagene Cloning Systems, La Jolla, CA), and the transformed culture is plated on ampicillin medium plates to select resistant colonies. Plasmid DNA is isolated from transformants and checked for the presence of the correct fragment by restriction analysis. Recombinant MIP
COS cells for DE-4 expression by DEAE-DEXTRA
N method (J. Sambrook, E. Fritsch, T. Maniatis,
Molecular Cloneing: A Laboratory Manual, Cold Spri
ng Laboratory Press, (1989)). The MIP-4-HA protein was radiolabeled and immunoprecipitated (E. Harlo
w, D. Lane, Antibodies: A Laboratory Manual, Col
d Spring Harbor Laboratory Press, (1988)). Cells are labeled with ³⁵ S-cysteine for 8 hours, 2 days after transfection. Next, the medium was collected and the cells were washed with a detergent (RIPA buffer (150 m
M NaCl, 1% NP-40, 0.1% SDS, 1% N
P-40, 0.5% DOC, 50 mM Tris, pH 7.5)
(Wilson, I., et al., Supra, 37: 767 (198).
Dissolve in 4)). Both cell lysate and medium are precipitated with HA-specific monoclonal antibody. The precipitated protein is analyzed on a 15% SDS-PAGE gel.

Example 6 Expression of Recombinant Ckβ-1 in COS Cells Expression of plasmid CMV-Ckβ-1HA is derived from vector pcDNAI / Amp (Invitrogen) containing: 1) SV40 origin of replication, 2 ) Ampicillin resistance gene, 3) E. coli origin of replication, 4) CMV promoter followed by polylinker region, SV40 intron and polyadenylation site. A DNA fragment encoding all of the Ckβ-1 precursors and the HA tag fused in frame to the 3'end of the precursor was cloned into the polylinker site of the vector, therefore expression of the recombinant protein is dependent on the CMV promoter. Commanded below. HA tags are as previously described (I.W.
ilson et al., Cell, 37: 767 (1984)), corresponding to an epitope derived from the influenza hemagglutinin protein. By injecting the HA tag into the target protein, the recombinant protein can be easily detected with an antibody that recognizes the HA epitope.

The plasmid construction strategy is as follows: ATCC, DNA sequence encoding Ckβ-1.
# 75572 is constructed by PCR using two primers: 5'primer 5'GGAAAGCTTATGAAGATT.
CCGTGGCTGC 3 '(SEQ ID NO: 17) contains 18 nucleotides of the Ckβ-8 coding sequence starting from the HindIII site followed by the start codon; 3'sequence 5'CGCTCTAGAT
CAAGCGTAGTCTGGGACGTCGTATGGGTAGTTCTCCTTCATGTCCTTG
3 '(SEQ ID NO: 18) contains the sequence complementary to the XbaI site, the translation stop codon, the HA tag and the last 19 nucleotides of the Ckβ-1 coding sequence (excluding the stop codon). Therefore, the PCR product contains a HindIII site, a Ckβ-1 coding sequence followed by an HA tag fused in frame, a translation stop codon next to the HA tag, and an XbaI site. PCR amplified DN
A fragment and vector, pcDNAI / Amp to HindII
Digest with I and XbaI restriction enzymes and ligate.

The ligation mixture was transformed into E. coli strain SURE.
(Stratagene Cloning Systems, La Jolla, CA), and the transformed culture is plated on ampicillin medium plates to select resistant colonies. Plasmid DNA is isolated from transformants and checked for the presence of the correct fragment by restriction analysis. Recombinant Ckβ
-1 expression, COS cells were treated with DEAE-DEXTRA.
N method (J. Sambrook, E. Fritsch, T. Maniatis,
Molecular Cloneing: A Laboratory Manual, Cold Spri
ng Laboratory Press, (1989)). Ckβ-1HA protein was radiolabeled and immunoprecipitated (E. Harlow,
D. Lane, Antibodies: A Laboratory Manual, Cold S
pring Harbor Laboratory Press, (1988)). Cells are labeled with ³⁵ S-cysteine for 8 hours, 2 days after transfection. Next, the medium was collected and the cells were washed with a detergent (RIPA buffer (150 m
M NaCl, 1% NP-40, 0.1% SDS, 1% N
P-40, 0.5% DOC, 50 mM Tris, pH 7.5)
(Wilson, I., et al., Supra, 37: 767 (198).
Dissolve in 4)). Both cell lysate and medium are precipitated with HA-specific monoclonal antibody. The precipitated protein is analyzed on a 15% SDS-PAGE gel.

Example 7 Expression Pattern of Ckβ-8 in Human Tissue Northern blot analysis was performed to show Ckβ in human tissue.
The expression level of -8 was examined. R for whole cell RNA samples
NAzol ^™ B system (Biotecx Labortories, Inc., Ho
uston, TX77033). About 10 μg of total RNA isolated from each specified human tissue was separated on a 1% agarose gel, and a nylon filter (Sambroo
k, Fritsch and Maniatis, Molecular Cloning,
Blotting on Cold Spring Harbor Press, (1989)). The labeling reaction is performed with 50 ng of DNA fragment according to the Stratagene Prime-It kit.
Select-G-50 Column (5 Prime-3 Prime, Inc. Boulde
r, CO). Then, set the filter to 0.5M
1,000, in NaPO ₄ , pH 7.4 and 7% SDS.
000 cpm / ml radiolabeled full-length Ckβ-8 gene and 6
Hybridize overnight at 5 ° C. 0.5xSSC, 0.
After washing twice with 1% SDS at room temperature and twice at 60 ° C., the filter was placed on an intensifying screen overnight, -7.
Expose at 0 ° C.

Example 8 MIP-4 Expression Patterns in Human Tissue Northern blot analysis was performed to perform MIP in human tissue.
The expression level of -4 was investigated. R for whole cell RNA samples
NAzol ^™ B system (Biotecx Labortories, Inc., Ho
uston, TX77033). About 10 μg of total RNA isolated from each specified human tissue was separated on a 1% agarose gel, and a nylon filter (Sambroo
k, Fritsch and Maniatis, Molecular Cloning,
Blotting on Cold Spring Harbor Press, (1989)). The labeling reaction is performed with 50 ng of DNA fragment according to the Stratagene Prime-It kit.
Select-G-50 Column (5 Prime-3 Prime, Inc. Boulde
r, CO). Then, set the filter to 0.5M
1,000, in NaPO ₄ , pH 7.4 and 7% SDS.
Hybridize with radiolabeled full length MIP-4 gene at 000 cpm / ml at 65 ° C overnight. 0.5xSSC,
After washing twice with 0.1% SDS at room temperature and twice at 60 ° C., the filter was intensified overnight using an intensifying screen.
Photosensitize at -70 ° C.

Example 9 Expression Pattern of Ckβ-1 in Human Tissue Ckβ in human tissue was examined by Northern blot analysis.
The expression level of -1 was examined. R for whole cell RNA samples
NAzol ^™ B system (Biotecx Labortories, Inc., Ho
uston, TX77033). About 10 μg of total RNA isolated from each specified human tissue was separated on a 1% agarose gel, and a nylon filter (Sambroo
k, Fritsch and Maniatis, Molecular Cloning,
Blotting on Cold Spring Harbor Press, (1989)). Labeling reaction was performed with 50 ng of DNA fragment according to the Stratagene Prime-It kit.
Select-G-50 column (5 Prime-3 Prime, Inc. Bould
er, CO). Then, set the filter to 0.5
1.00 in MNaPO ₄ , pH 7.4 and 7% SDS
Hybridization was performed overnight at 65 ° C. with the radiolabeled full-length Ckβ-1 gene at 2,000 cpm / ml. 0.5xSS
C, twice with 0.1% SDS at room temperature and 2 at 60 ° C
After washing twice, the filters were exposed overnight at -70 ° C using an intensifying screen. A large amount of Ckβ-1 messenger RNA is found in the spleen.

Example 10 Chemokine Ckβ-8 Using Baculovirus Expression System
Expression and purification of SF9 cells were infected with recombinant baculovirus designed to express Ckβ-8 cDNA.
Cells were infected with a MOI of 2 and incubated at 28 ° C for 72-96 hours. Cell debris from infected cultures was removed by low speed centrifugation. Protease inhibitor cocktail was added to Pefablox (Pefablo) at 20 μg / ml.
c) SC, 1 μg / ml leupeptin, 1 μg / ml E-
The final concentrations of 64 and 1 mM EDTA were added to the supernatant. Ckβ-8 levels in the supernatant were monitored by loading 20-30 μl of the supernatant on a 15% SDS-PAGE gel. Ckβ-8 was detected as a visible band of 9 Kd, which corresponded to an expression level of a few mg per liter.

Ckβ-8 was further purified by a three step purification procedure. Heparin-binding affinity chromatography: supernatant of baculovirus culture was treated with 100 mM H
EPES / MES / NaOAc, 1 of buffer containing pH 6
/ 3 volume and filtered through a 0.22 μm membrane. The sample is then loaded onto a heparin binding column (HE1 p
oros20, Bio-Perceptive System Inc.). Ckβ-08 is 50 mM HEPES / pH 6
Elution with approximately 300 mM NaC1 in a linear gradient of 50-100 mM NaC1 in MES / NaOAc. Cation exchange chromatography: Ckβ8 concentrated by heparin chromatography was added to 50MM HEPES / MES / NaOAc,
It was subjected to 5-fold dilution with a buffer solution containing pH 6. Then, the obtained mixture was subjected to a cation exchange column (S / M poros2).
0, Bio-Perceptive System Inc.).
Ckβ-8 is 50 mM HEPES / MES / pH6
Approximately 2 with a linear gradient of 25-300 mM NaC1 in NaOAc.
Eluted with 50 mM NaCI. Size exclusion chromatography: Ckβ-8 after cation exchange chromatography
A size exclusion column (HW50, TOSO HAAS,
Further purification by subjecting to 1.4 x 45 cm).
Ckβ-8 fractionated near the 13.7 Kd molecular weight standard (RNase A), which corresponded to a dimer of the protein. Ckβ-8 obtained after the above three-step purification
Was determined to be> 90% pure as determined from Coomassie blue staining of SDS-PAGE gels (Figure 9). Purified Ckβ-8 was also tested for endotoxin / LPS contamination. LAL assay (Bi
The LPS content was less than 0.1 ng / ml according to oWhittaker).

Example 11 M-CSF and SCF of freshly isolated bone marrow cells.
Baculovirus against colony formation stimulated by
Effect of expressed Ckβ-1 and Ckβ-8 Monoclonal cells were prepared by incubating a low density population of mouse bone marrow cells in treated tissue culture dishes at 37 ° C for 1 hour.
Macrophages and other cells attached to the plastic surface were removed. Then the non-adherent cell population is
The agar-containing growth medium was plated in the presence or absence of the factors shown in Figure 19 (10,000 cells / dish).
The culture was incubated at 37 ° C for 10 days (88% N
₂ , 5% CO ₂ , and 7% O ₂ ), colonies were counted under an inverted microscope. Data are expressed as the average number of colonies and were obtained from assays performed in triplicate.

[0126]Example 12 IL-3 and SCF of the lin-population of bone marrow cells
And Ckβ-8 on stimulated proliferation and differentiation
Effect of Ckβ-1 Primitive hematopoietic progenit
enriched mouse bone marrow cells in
It was obtained by using the selection method.
The restricted cells of lineages are converted to monoclonal antibody (cd
11b, CD4, CD8, CD45R, and Gr-1 antigens
Against) and with a panel of magnetic beads
I removed it. The resulting cell population (Lin^-cell)
In the presence or absence of a given chemokine (50 ng / ml).
IL-3 (5 ng / ml) and SCF (100 ng / ml)
Was plated on the growth medium supplemented with
^FourCells / ml). Wet incubator (5% CO₂, 27
% O₂And 88% N₂Environment) at 37 ° C for 7 days
After incubation, the cells are collected, HPP-CFC,
And immature progenitor cells were analyzed. In addition, cells
A certain kind of knowledge by FACSscan
The expression of different antigens was analyzed. The colony data is
The average number of colonies ± SD is displayed, and
Obtained from the assay performed in 6 dishes on cells (Fig.
20).

Example 13 Ckβ-8 is IL-3, M-CSF, and GM-CS
Mouse bone marrow cells that suppress colony formation in response to F were washed from both femur and tibia, separated by phycol density gradient, and monocytes removed by plastic attachment. The resulting cell population was designated IL-3 (5
ng / ml), GM-CSF (5 ng / ml), M-CSF (1
0 ng / ml) and G-CSF (10 ng / ml) were added and incubated overnight in MEM-based medium. These cells were treated with IL-3 (5 ng / ml), GM-CSF (5 ng / ml) with or without Ckβ-8 (50 ng / ml).
ml) or M-CSF (10 ng / ml) and plated at 1000 / dish in an agar-based colony forming assay. Data represent colony formation as a percentage of the number of colonies formed with a particular factor alone. Two experiments are shown with the data shown as the average of two dishes and error bars indicate the standard deviation for each experiment (Figure 23).

Example 14 Expression by Gene Therapy Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in tissue culture medium and divided into small pieces. A small chunk of tissue is placed on the moistened surface of the tissue culture flask and approximately 10 pieces are placed in each flask. The flask is turned upside down, tightly closed and left at room temperature overnight. 2 at room temperature
After 4 hours, the flask is inverted and the tissue mass remains attached to the bottom of the flask, leaving fresh media (eg 10% FB).
Ham 'with S, penicillin and streptomycin
s F12 medium). It is then incubated at 37 ° C. for about 1 week. At this point fresh medium is added and replaced every few days thereafter. After culturing for another 2 weeks, a monolayer of fibroblasts appears. The monolayer is trypsinized and scaled up to a larger flask.
PMV-7 (Kirschmeie) flagged by long terminal repeats of Moloney murine sarcoma virus.
r, P. T. Et al., DNA, 7: 219-25 (198
8)) is digested with EcoRI and HindIII and subsequently treated with calf intestinal phosphatase. The linear vector is fractionated on an agarose gel and purified using glass beads.

CDNA encoding the polypeptide of the present invention
A is a PC corresponding to the 5'and 3'terminal sequences, respectively
Amplify using the R primer. 5'primer is Eco
It contains a RI site and the 3'primer contains a HindIII site. Equal amounts of Moloney murine sarcoma virus linear backbone and EcoRI and Hin in the presence of T4 DNA ligase.
Add together the fragment of dIII. The resulting mixture is 2
Keep under suitable conditions for ligation of the two fragments.
Bacterial HB101 is transformed with this ligation mixture, and then the transformants are plated on agar-containing kanamycin to confirm that the gene of interest has been correctly inserted into the vector. Both species directivity (am
photropic) pA317 or GP + am12 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% calf serum (CS), penicillin and streptomycin. The MSV vector containing the gene is then added to the medium and the packaging cells are transduced with the vector. Thus the packaging cell now produces infectious viral particles containing the gene (this packaging cell is referred to as the producer cell).

Fresh medium is added to the transduced producer cells, after which the medium is harvested from a 10 cm plate of confluent producer cells.
The used medium containing infectious viral particles is filtered through a Millipore filter to remove detached producer cells, which is then used to infect fibroblasts. Remove medium from plates of fibroblasts below confluency and quickly replace with medium from producer cells. This medium is removed and replaced with a new medium. If the virus titer is high, virtually all fibroblasts are infected and no selection is necessary. If the titer is very low, it is necessary to use a retroviral vector with a selectable marker such as neo or his. The genetically engineered fibroblasts are then propagated alone or on confluency on cytodex 3 microcarrier beads prior to injection into the host. The fibroblasts now produce the protein product. Many modifications and variations of the present invention are possible in light of the above teachings, and therefore, unless otherwise indicated, the present invention can be practiced within the scope of the appended claims.

[0131] SEQUENCE LISTING <110> Human Genome Sciences, Inc. <120> Human Chemokine Beta-8, Chemokine Beta-1 and Macrophage Inflammato ry Protein-4 <130> 184547 <160> 19 <210> 1 <211> 363 <212> DNA <213> Homo Sapiens <400> 1 atgaaggtct ccgtggctgc cctctcctgc ctcatgcttg ttactgccct tggatcccag 60 gcccgggtca caaaagatgc agagacagag ttcatgatgt caaagcttcc attggaaaat 120 ccagtacttc tggacagatt ccatgctact agtgctgact gctgcatctc ctacacccca 180 cgaagcatcc cgtgttcact cctggagagt tactttgaaa cgaacagcga gtgctccaag 240 ccgggtgtca tcttcctcac caagaagggg cgacgtttct gtgccaaccc cagtgataag 300 caagttcagg tttgcatgag aatgctgaag ctggacacac ggatcaagac caggaagaat 360 tga 363 <210> 2 <211> 120 <212> PRT <213> Homo Sapiens <400> 2 Met Lys Val Ser Val Ala Ala Leu Ser Cys Leu Met Leu Val Thr     -20 -15 -10 Ala Leu Gly Ser Gln Ala Arg Val Thr Lys Asp Ala Glu Thr Glu      -5 1 5 Phe Met Met Ser Lys Leu Pro Leu Glu Asn Pro Val Leu Leu Asp 10 15 20 Arg Phe His Ala Thr Ser Ala Asp Cys Cys Ile Ser Tyr Thr Pro 25 30 35 Arg Ser Ile Pro Cys Ser Leu Leu Glu Ser Tyr Phe Glu Thr Asn 40 45 50 Ser Glu Cys Ser Lys Pro Gly Val Ile Phe Leu Thr Lys Lys Gly 55 60 65 Arg Arg Phe Cys Ala Asn Pro Ser Asp Lys Gln Val Gln Val Cys 70 75 80 Met Arg Met Leu Lys Leu Asp Thr Arg Ile Lys Thr Arg Lys Asn 85 90 95 <210> 3 <211> 282 <212> DNA <213> Homo Sapiens <400> 3 atgaagatct ccgtggctgc aattcccttc ttcctcctca tcaccatcgc cctagggacc 60 aagactgaat cctcctcacg gggaccttac cacccctcag agtgctgctt cacctacact 120 acctacaaga tcccgcgtca gcggattatg gattactatg agaccaacag ccagtgctcc 180 aagcccggaa ttgtcttcat caccaaaagg ggccattccg tctgtaccaa ccccagtgac 240 aagtgggtcc aggactatat caaggacatg aaggagaact ga 282 <210> 4 <211> 93 <212> PRT <213> Homo Sapiens <400> 4 Met Lys Ile Ser Val Ala Ala Ile Pro Phe Phe Leu Leu Ile Thr                 -15 -10 -5 Ile Ala Leu Gly Thr Lys Thr Glu Ser Ser Ser Arg Gly Pro Tyr                   1 5 10 His Pro Ser Glu Cys Cys Phe Thr Tyr Thr Thr Tyr Lys Ile Pro              15 20 25 Arg Gln Arg Ile Met Asp Tyr Tyr Glu Thr Asn Ser Gln Cys Ser              30 35 40 Lys Pro Gly Ile Val Phe Ile Thr Lys Arg Gly His Ser Val Cys              45 50 55 Thr Asn Pro Ser Asp Lys Trp Val Gln Asp Tyr Ile Lys Asp Met              60 65 70 Lys Glu Asn <210> 5 <211> 270 <212> DNA <213> Homo Sapiens <400> 5 atgaagggcc ttgcagctgc cctccttgtc ctcgtctgca ccatggccct ctgctcctgt 60 gcacaagttg gtaccaacaa agagctctgc tgcctcgtct atacctcctg gcagattcca 120 caaaagttca tagttgacta ttctgaaacc agcccccagt gccccaagcc aggtgtcatc 180 ctcctaacca agagaggccg gcagatctgt gctgacccca ataagaagtg ggtccagaaa 240 tacatcagcg acctgaagct gaatgcctga 270 <210> 6 <211> 89 <212> PRT <213> Homo Sapiens <400> 6 Met Lys Gly Leu Ala Ala Ala Leu Leu Val Leu Val Cys Thr Met -20 -15 -10 Ala Leu Cys Ser Cys Ala Gln Val Gly Thr Asn Lys Glu Leu Cys  -5 1 5 10 Cys Leu Val Tyr Thr Ser Trp Gln Ile Pro Gln Lys Phe Ile Val                  15 20 25 Asp Tyr Ser Glu Thr Ser Pro Gln Cys Pro Lys Pro Gly Val Ile                  30 35 40 Leu Leu Thr Lys Arg Gly Arg Gln Ile Cys Ala Asp Pro Asn Lys                  45 50 55 Lys Trp Val Gln Lys Tyr Ile Ser Asp Leu Lys Leu Asn Ala                  60 65 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 7 tcaggatccg tcacaaaaga tgcaga 26 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 8 cgctctagag taaaacgacg gccagt 26 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 9 tcaggatcct gtgcacaagt tggtacc 27 <210> 10 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 10 cgctctagag taaaacgacg gccagt 26 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 11 gcccgcggat cctcctcacg gggaccttac 30 <210> 12 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 12 gcctgctcta gatcaaagca gggaagctcc ag 32 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 13 ggaaagctta tgaaggtctc cgtggct 27 <210> 14 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 14 cgctctagat caagcgtagt ctgggacgtc gtatgggtaa ttcttcctgg tcttgatcc 59 <210> 15 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 15 ggaaagctta tgaagggcct tgcagctgcc 30 <210> 16 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 16 cgctctagat caabcgtagt ctgggacgtc gtatgggtag gcattcagct tcaggtc 57 <210> 17 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 17 ggaaagctta tgaagattcc gtggctgc 28 <210> 18 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 18 cgctctagat caagcgtagt ctgggacgtc gtatgggtag ttctccttca tgtccttg 58 <210> 19 <211> 92 <212> PRT <213> Homo Sapiens <400> 19 Met Gln Val Ser Thr Ala Ala Leu Ala Val Leu Leu Cys Thr Met   1 5 10 15 Ala Leu Cys Asn Gln Phe Ser Ala Ser Leu Ala Ala Asp Thr Pro                  20 25 30 Thr Ala Cys Cys Phe Ser Tyr Thr Ser Arg Gln Ile Pro Gln Asn                  35 40 45 Phe Ile Ala Asp Tyr Phe Glu Thr Ser Ser Gln Cys Ser Lys Pro                  50 55 60 Gly Val Ile Phe Leu Thr Lys Arg Ser Arg Gln Val Cys Ala Asp                  65 70 75 Pro Ser Glu Glu Trp Val Gln Lys Tyr Val Ser Asp Leu Glu Leu                  80 85 90 Ser Ala

[Brief description of drawings]

1 shows the cDNA sequence encoding Ckβ-8 and the corresponding amino acid sequence derived from it.

FIG. 2 shows the cDNA sequence encoding Ckβ-1 and the corresponding amino acid sequence derived from it. First one
Nine amino acids represent the putative leader sequence.

FIG. 3 shows the cDNA sequence encoding MIP-4 and the corresponding amino acid sequence derived from it. First two
0 amino acids represent the putative leader sequence.

FIG. 4 shows amino acid homology between Ckβ-8 (upper row) and human MIP-1α (lower row). The 4-cysteine properties of all chemokines are shown.

FIG. 5 shows two amino acid sequences, of which the upper sequence is the human MIP-4 amino acid sequence and the lower sequence is human MIP-1α (human tonsil lymphocyte LD78 beta protein precursor).

FIG. 6 shows an amino acid sequence alignment between Ckβ-1 (top) and human MIP-1α (bottom).

FIG. 7 is a photograph of a gel in which Ckβ-1 was electrophoresed after expressing HA-tagged Ckβ-1 in COS cells.

FIG. 8 is a photograph of an SDC-PAGE gel after expressing and purifying Ckβ-1 in a baculovirus expression system.

FIG. 9 is a photograph of an SDC-PAGE gel after Ckβ-8 was expressed in a baculovirus expression system and purified by 3 steps.

FIG. 10 shows chemoattractant activity in THP-cells.

FIG. 11 shows chemoattractant activity on human PBMCs (B).

FIG. 12 shows the results of determination of changes in intracellular calcium concentration in response to Ckβ-8 using a Hitachi F-2000 fluorescence spectrophotometer.

FIG. 13: Monocytic cell line THP-1 was tested for LPS (0.1-
1 with 10 ng / ml) or Ckβ-8 (up to 50 ng / ml)
The results of treating the tissue culture supernatant for 6 hours and subjecting the tissue culture supernatant to ELISA analysis to quantify the secreted amount of TNF-α are shown.

FIG. 14: Human peripheral blood monocytes purified by elutriation were treated with increasing numbers of Ckβ-8 (produced by baculovirus) for 16 hours, and tissue culture supernatant was subjected to ELI.
The result of having carried out SA analysis and having quantified the secretion amount of TNF- (alpha) and IL-6 is shown.

Figure 15: Human peripheral blood monocytes purified by elutriation were treated with increasing numbers of Ckβ-8 (produced by baculovirus) for 16 hours and tissue culture supernatants were ELI.
The result of having carried out SA analysis and quantifying the secretion amount of IL-1, GM-CSF, and a granulocyte colony-stimulating factor (G-CSE) is shown.

FIG. 16: Low density population of mouse bone marrow cells (1,500
Cells / dish) in the agar-containing medium with the specified chemokine (1
00 ng / ml) with or without IL-3
(5 ng / ml), SCF (100 ng / ml), IL-1α
(10 ng / ml), and in the presence of M-CSF (5 ng / ml). The data shown represent the average of the values obtained from two independent experiments (two trials each).
Colonies were counted on the 14th day of plating.
The number of colonies generated in the presence of chemokines is expressed as the average percent of the number of colonies obtained in the absence of added chemokines.

FIG. 17: Mouse bone marrow colony by HPP-CFC
3 shows the effect of Ckβ-8 and Ckβ-1 on formation.

FIG. 18: Mouse bone marrow colony by LPP-CFC
3 shows the effect of Ckβ-8 and Ckβ-1 on formation.

FIG. 19 shows the effect of baculovirus expressed Ckβ-1 and Ckβ-8 on M-CFS and SCF stimulated colony formation of freshly isolated bone marrow cells.

FIG. 20: IL-3 and SC of lin ⁻ population of bone marrow cells
Ckβ-1 and Ckβ for F-stimulated proliferation and differentiation
The effect of -8 is shown.

FIG. 21. GR-1 of cells from a lin ⁻ population of bone marrow cells.
And the effect of Ckβ-8 and Ckβ-1 on the generation of Mac-1 (surface marker) positive population is shown as the percentage of positive cells in the large cell population.

FIG. 22 GR-1 of cells from a lin ⁻ population of bone marrow cells
And the effect of Ckβ-8 and Ckβ-1 on the generation of Mac-1 (surface marker) positive population is shown as the percentage of positive cells in both small cell populations.

FIG. 23: Presence of Ckβ-8 (+) indicates IL-3, M-
Bone marrow cell colony in response to CSF and GM-CSF
Indicates that the generation is suppressed.

FIG. 24: Ckβ-8 dose response shows bone marrow cell colony.
Suppress generation. Cells were isolated and processed as in Figure 23. Treated cells in the presence of IL-3, GM-CSF or M-CSF (15 ng / ml) at 1, 10, 5
1.0 in an agar-based colony formation assay with or without 0 and 100 ng / ml Ckβ-8
Plated at a density of 00 cells / dish. The data are colonies generated by specific factors alone as colony formation.
Shown as a percentage of the number. Data is a double dish
Are shown as the mean, and the error bars show the standard deviation.

FIG. 25 shows induction of apoptosis by Ckβ-8 and Ckβ-1 in the presence or absence of hematopoietic cell growth factor.

FIG. 26. Expression of RNA encoding Ckβ-8 in human monocytes. Total RNA from freshly elutriated monocytes was isolated and isolated with 100 U / ml hurIFN.
-G, 100 ng / ml LPS or both. RNA (8 μg) from each treatment was separated by electrophoresis on a 1.2% agarose gel and transferred to a nylon membrane. C
Quantification of kβ-8 mRNA was carried out by probing with ³² P-labeled cDNA, and the band obtained on autoradiography was quantified by a densitometer.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61P 11/06 A61P 17/06 4C084 17/02 19/02 4H045 17/06 29/00 19/02 31 / 00 29/00 35/00 31/00 35/02 35/00 37/02 35/02 37/08 37/02 C07K 14/52 37/08 C12N 1/15 C07K 14/52 1/19 C12N 1/15 1/21 1/19 C12P 21/02 C 1/21 C12Q 1/02 5/10 G01N 33/15 Z C12P 21/02 33/50 Z C12Q 1/02 C12N 15/00 ZNAA G01N 33/15 5/00 A 33/50 A61K 37/02 (72) Inventor Craig A. Rosen 22400 Rolling Hill Road, Raytonsville, Maryland, USA 20882 (72) Inventor Steven M. Ruben United States 20832 Orni, Maryland , Heritage Hills Drive No. 18528 (72) Inventor Lee Hao Dong United States, 20878 Maryland, Gaithersburg, Rutridge Drive No. 11033 (72) Inventor, Mark Di Adams United States, 20878 Maryland, North Potomac, Duffif・ Drive 15205 No. F term (reference) 2G045 AA40 4B024 AA01 AA11 BA21 CA03 DA02 DA06 EA02 EA04 GA11 HA01 HA17 4B063 QA01 QA05 QA18 QQ08 QR48 QR77 QS33 QS34 QX01 4B064 AG02 CA02 CA10 CA19 CC24 CE0 A93A13 A01 CE13 CE11 CE11 CE11 CE11 CE11 CE12 CE13 CE11 CE11 CE12 AB01 BA02 CA24 CA44 CA46 4C084 AA02 AA07 AA13 AA17 BA01 BA08 BA20 BA23 BA44 CA53 DA01 NA14 ZA512 ZA592 ZA892 ZA962 ZB072 ZB112 ZB132 ZB152 ZB262 ZB272 ZB312 4H045 AA10 AA20 AA30 GA22 GA23 FA23

Claims (22)

[Claims] 1. An isolated polynucleotide containing a member selected from the group consisting of: (a) a polynucleotide encoding a polypeptide containing amino acids -21 to 99 of SEQ ID NO: 2; (b) SEQ ID NO: 2 A polynucleotide encoding a polypeptide comprising amino acids 1 to 99 of (c); (c) a polynucleotide which is capable of hybridizing to the polynucleotide of (a) or (b) and is at least 70% identical to said polynucleotide; And (d) a polynucleotide fragment of the polynucleotide of (a) or (b). 2. The polynucleotide according to claim 1, wherein the polynucleotide is DNA. 3. The polynucleotide according to claim 1, wherein the polynucleotide is RNA. 4. The polynucleotide according to claim 1, wherein the polynucleotide is genomic DNA. 5. The polynucleotide of claim 2 which encodes a polypeptide comprising amino acid-21 to amino acid 99 of SEQ ID NO: 2. 6. Amino acid 1 to amino acid 9 of SEQ ID NO: 2
The polynucleotide of claim 2 which encodes a polypeptide comprising 9. 7. An isolated polynucleotide comprising a member selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having an amino acid sequence expressed by the DNA contained in ATCC Deposit No. 75676; ) A polynucleotide capable of hybridizing to the polynucleotide of (a) and being at least 70% identical to said polynucleotide; (c) A polynucleotide fragment of the polynucleotide of (a) or (b). 8. The polynucleotide of claim 1 comprising the sequence from nucleotide 1 to nucleotide 363 set forth in SEQ ID NO: 1. 9. A vector containing the DNA according to claim 2. 10. A host cell genetically engineered with the vector of claim 9. 11. From the host cell of claim 10, the D
A method for producing a polypeptide, which comprises expressing a polypeptide encoded by NA. 12. A method for producing a cell capable of expressing a polypeptide, which comprises genetically engineering the cell with the vector according to claim 9. 13. (i) A polypeptide having the amino acid sequence of SEQ ID NO: 2 and fragments, analogs and derivatives thereof; and (ii) ATCC accession number 75676 cDNA.
And polypeptides, fragments, analogs and derivatives thereof encoded by. A polypeptide selected from the group consisting of: 14. The polypeptide of claim 13, wherein the polypeptide has the amino acid sequence of SEQ ID NO: 2. 15. An agonist to the polypeptide according to claim 13. 16. An antagonist to the polypeptide of claim 13. 17. A Ckβ-8 comprising administering to a patient a therapeutically effective amount of the polypeptide of claim 13.
How to treat a patient in need. 18. The method of claim 17, wherein administration of a therapeutically effective amount of the polypeptide is performed by providing a patient with DNA encoding the polypeptide and then expressing the polypeptide in vivo. Method. 19. A method of treating a patient in need of Ckβ-8 comprising administering to the patient a therapeutically effective amount of the agonist of claim 16. 20. A method for diagnosing a disease associated with underexpression of the polypeptide of claim 13 or susceptibility to a disease, comprising determining a mutation in a nucleic acid sequence encoding the polypeptide. Method. 21. A diagnostic method comprising analyzing the presence of a polypeptide of claim 13 in a sample taken from a host. 22. A method of identifying antagonists and agonists to the polypeptide of claim 13, wherein the cells, the compound to be screened and the polypeptide are mixed, wherein the cells are porous from the polypeptide. Separation by filter; then determining the extent of migration of the cells to determine whether the compound is an effective antagonist or agonist.