CA2220123A1 - Human chemokine beta-8, chemokine beta-1 and macrophage inflammatory protein-4 - Google Patents

Abstract

Human Ck.beta.-8, MIP-4 and Ck.beta.-1 and DNA (RNA) encoding such chemokine polypeptides and a procedure for producing such polypeptides by recombinant techniques is disclosed. Also disclosed are methods for utilizing such chemokine polypeptides for the treatment of leukemia, tumors, chronic infections, autoimmune disease, fibrotic disorders, wound healing and psoriasis. Antagonists against such chemokine polypeptides and their use as a therapeutic to treat rheumatoid arthritis, autoimmune and chronic and acute inflammatory and infective diseases, allergic reactions, prostaglandin-independent fever and bone marrow failure are also disclosed. Also disclosed are diagnostic assays for detecting diseases related to mutations in the nucleic acid sequences and for detecting altered concentrations of the polypeptides.

Description

- ~==
¦ CA 02220l23 l997-ll-04 WO96/34891 PCT~S95/09058 ~MaN CEEMQ~ N~ ~ETA-8, ~ ~H ~ r~K ~ N~ BETA-1 AND MACROP~AGE INFT-~MM~TORY PROTEIN-4 This application is a continuation-in-part of pending application serial number 08/446,881 filed in the United States Patent and Trademark O~ice on May 5, 1995.
This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptides o~ the present invention have been putatively identified as human rh~mokine Beta-8 (Ck~-8), macrophage inflammatory protein-~ (MIP-4) and rhpmnkine Beta-1 (Ck~-1).
The invention also relates to inhibiting the action of such polypeptides.
rhemokines~ also re~erred to as intercrine cytokines, are a subfamily of structurally and ~unctionally related cytokines. These molecules are 8-10 kd in size. In yeneral, ch~mokines ~h~ h~ t 20~ to 75~ homology at the amino acid level and are characterized by four conserved cysteine residues that form two disul~ide bonds. Based on the arrangement of the first two cysteine residues, rh~m~kines CA 02220l23 l997-ll-04 W O 96/34891 PCT~US9~/09058 have been classi~ied into two sub~amilies, alpha and beta.
In the alpha su~amily, the ~irst two cysteines are separated by one amino acid and hence are re~erred to as the "C-X-CI' suh~amily. In the beta sub~amily, the two cysteines are in an adjacent position and are, there~ore, re~erred to as the "C-C" sub~amily. Thus ~ar, at least eight dif~erent members of this ~amily have been i~Pnt;fied in hllm~n~
The intercrine cytokines Pxh;hit a wide variety o~
~unctions. A h~llm~k ~eature is their ability to elicit chemotactic migration o~ distinct cell types, including monocytes, neutrophils, T lymphocytes, basophils and ~ibroblasts. Many rh~m~kines have proin~lammatory activity and are involved in multiple steps during an in~lammatory reaction. These activities include stimulation o~ hist~mi n~
release, lysosomal enzyme and leukotriene release, increased adherence o~ target immllne cells to endoth~ l cells, F~n h~n ce d hi n~ing o~ complement proteins, in~lllr~l expression o~ granulocyte adhesion molecules and complement receptors, and respiratory burst. In addition to their involvement in ini~lammation, certain ~h~m~kinF~s have been shown to ~Chi h;t other activities. For e a mple, macrophage in~lammatory protein 1 (MIP-l) is able to suppress hematopoietic stem cell proli~eration, platelet ~actor-4 (PF-4) is a potent inhihitor o~ endoth~li~l cell growth, Interleukin-8 (IL-8) promotes proli~eration o~ keratinocytes, and GRO is an autocrine growth ~actor ~or m~l ~n~m~ cells.
In light o~ the diverse biological activities, it is not ~u~Lising that ~h~mokines have been implicated in a num~er o~ physiological and disease conditions, including lymphocyte tra~icking, wound h~l ing, hematopoietic regulation and immllnQlogical disorders such as allergy, asthma and arthritis. An example o~ a hematopoietic lineage regulator is MIP-l. MIP-l was originally identi~ied as an endotoxin-induced proin~lammatory cytokine produced ~rom macrophages.
Subsequent studies have shown that MIP-l is composed o~ two _ WO96/34891 PCT~S95/09058 .
di~erent, but related, proteins MIP-l~ and MIP-l~. Both MIP-l~ and MIP-l~ are chemo-attractants for macrophages, monocytes and T lymphocytes. Interestingly, biochemical puri~ication and subsequent sequence analysis o~ a multi-potent stem cell inh;hitor (SCI) revealed that SCI is identical to MIP-l~. Furthermore, it has been shown that MIP-l~ can counteract the ability of MIP-l~ to suppress hematopoietiC stem cell proli~eration. This ~inding leads to the hypothesis that the primary physiological role o~ MIP-l is to regulate hematopoiesis in bone marrow, and that the proposed in~lammatory ~unction is secon~A~y. The mode o~
action o~ MIP-l~ as a stem cell ; nh; hi tor relates to its ability to block the cell cycle at the Gl/S interphase.
Furthermore, the i nhi bitory e~ect o~ MIP-l~ seems to be restricted to immature ~loge1itor cells and it is actually stimlllAtory to late ~oye~1itors in the presence o~
granulocyte macrophage-colony stimulating ~actor (GM-CSF).
Several groups have cloned what are likely to be the human homologs o~ MIP-l~ and MIP-l~. In all cases, cDNAs were isolated ~rom libraries prepared against activated T-cell RNA.
MIP-l proteins can be detected in early wound in~lammation cells and have been shown to induce production o~ IL-l and IL-6 ~rom wound ~ibroblast cells. In addition, puri~ied native MIP-l (comprising MIP-l, MIP-l~ and MIP-l~
polypeptides) causes acute in~lammation when injected either subcutaneously into the ~ootpads o~ mice or intracist~n~lly into the cerebrospinal ~luid o~ rabbits (Wolpe and Cerami, 1989, FASEB J. 3:2565-73). In addition to these pro-in~lammatory properties o~ MIP-l, which may be direct or indirec~, M~ ~s been ~-e~e~ duri~g the early in~lammatory phases o~ wound healing in an experim~ntAl mouse model employing sterile wound chambers (Fahey, et al., l990, Cytokine, 2:92). For example, PCT application WO 92/05198, ~iled by Chiron Corporation, discloses a DNA molecule which CA 02220l23 l997-ll-04 WO96/34891 PCT~S95/090~8 is active as a template ~or pro~ncin~ m~mm~ n macrophage in~lammatory proteins (MIPs) in yeast.
The murine MIP-l~ and MIP-l~ are distinct but closely related cytokines. Partially puri~ied mixtures o~ the two proteins a~ect neutrophil ~unction and cause local in~lammation and ~ever. MIP-l~ has been expressed in yeast cells and puri~ied to ho,,,oy~eity~ Structural analysis con~irmed that MIP-l~ has a very Simi 1~ secnn~y and tertiary structure to PF-4 and IL-8 with which it shares limited sequence homology. It has also been ~mon~trated that MIP-l~ is active in vivo to protect mouse stem cells ~rom subsequent in vitro k; 11 in~ by tritiated thymidine.
MIP-l~ was also ~hown to ~nh~nce the proli~eration o~ more committed progenitor granulocyte macrophage colony-~orming cells in response to granulocyte macrophage colony-stimulating ~actor (Clemens, J.M., et al., Cytokine~ 4:76-82 (1992)).
The polypeptides of the present invention, Ck~-l, originally re~erred to as MIP-l~ in the parent patent application, is a new member o~ the ~ ch~nkine ~amily based on amino sequence homology. The Ck~-8 polypeptide, originally re~erred to as MIP-3 in the parent application, is also a new m~mh~ 0~ the ~ rhem~kine ~amily based on the amino acid sequence homology.
In accordance with one aspect o~ the present invention, there are provided novel mature polypeptides which are human Ck~-8, human MIP-4 and human Ck~-l as well as biologically active and diagnostically or therapeutically use~ul ~ragments, ~n~l ogs and derivatives thereo~.
In accordance with another aspect o~ the present invention, there are provided i~olated nucleic acid molecules encoding such polypeptides, including mRNAs, DNAs, cDNAs, genomic DNA as well as biologically active and diagnostically or therapeutically use~ul ~ragments, analogs and derivatives thereo~.

_ In accor~Ance with yet a further aspect of the present invention, there is provided a process for producing such polypeptides by rec~mhinAnt techniques which c~,.~lises culturing recomhinAnt prokaryotic and/or eukaryotic host cells, contAin~ng nucleic acid sequences, under conditions promoting expression of said proteins and subsequent recovery of said proteins.
In accordance with yet a further aspect of the present invention, there is provided a process for utilizing such polypeptides, or polynucleotides ~nc~Ai ng such polypeptides for therapeutic purposes, for PYAmrle, to protect bone marrow stem cells from chemotherapeutic agents during chemotherapy, to remove leukemic cells, to stimml1~te an immllnP response, to regulate hematopoiesis and lymphocyte tra~icking, to treat psoriasis, solid tumors, to PnhAnre host de~enses against resistant chronic and acute infection, and to stimmllAte wound healing.
In accordance with yet a further aspect of the present invention, there are provided anti ho~i es against such polypeptides.
In accordance with yet another aspect of the present invention, there are provided antagonists to such polypeptides, which may be used to inhihit the action of such polypeptides, ~or example, to ~ nhi hi t production of IL-1 and TNF-~, to treat aplastic AnPmi~, myelodysplastic syndrome, asthma and arthritis.
In accordance with yet another aspect of the present invention, there are also provided nucleic acid probes comprising nucleic acid molecules o~ su~icient length to speci~ically hybridize to the Ck~-8, Ck~-1 and MIP-4 nucleic acid se~encles.
In accordance with still another aspect of the present invention, there are provided diagnostic assays ~or detecting diseases related to the underexpression and overexpression of =

Wos6/34891 PCT~S9~/09058 the polypeptides and ~or detecting mutations in the nucleic acid sequences encoding such polypeptides.
In accordance with yet another aspect of the present invention, there is provided a process ~or utilizing such polypeptides, or polynucleotides Pnco~tng such polypeptides, as research reagents ~or in vitro purposes related to scienti~ic research, synthesis o~ DNA and manu~acture o~ DNA
vectors, ~or the purpose o~ developing therapeutics and diagnostics ~or the treatment o~ human disease.
These and other aspects o~ the present invention should be apparent to those skilled in the art ~rom the t~rhtn~S
herein.
The ~ollowing drawings are illustrative o~ embodiments o~ the invention and are not meant to limit the scope of the invention as encomr-7ssed by the cl~7tm~
FIG. 1 displays the cDNA se~uence Pnco~-7ing Ck~-8 and the corresponding deduced amino acid sequence. The initial 21 amino acids represents the putative leader sequence. All the signal sequences were as determined by N-terminal peptide seq~7Pnctng o~ the baculovirus expressed protein.
FIG. 2 displays the cDNA sequence Pncor7ing Ck~-l and the correspon~7in~ deduced amino acid sequence. The initial l9 amino acids represent the leader sequence.
FIG. 3 displays the cDNA sequence encoding MIP-4 and the corresponntn~ deduced amino acid sequence. The initial 20 amino acids represent the leader sequence.
FIG. 4 illustrates the amino acid homology between Ck~-8 (top) and h7~man MIP-l~ ~bottom). The ~our cysteines characteristic o~ all c~emokines are shown.
FIG. 5 displays two amino acid sequences wherein, the top sequence is the human MIP-4 amino acid sequence and the bottom sequence is human MIP-l~ (Human Tonsillar lymphocyte LD78 Beta protein precursor).
FIG. 6 illustrates the amino acid sequence alignmPnt between Ck~-l (top) and human MIP-l~ (bottom).

CA 02220l23 l997-ll-04 WO96J34891 PCT~S95logos8 FIG. 7 is a photograph of a gel ln which Ck~-1 has been electrophoresed a_ter the expression o_ HA-tagged Ck~-1 in COS cells.
FIG. 8 is a photograph o~ a SDS-PAGE gel a_ter expression and purification of Ck~-1 in a baculovirus expression system.
FIG. 9 is a photograph of an SDS-PAGE gel after expression and a three-step purification o~ Ck~-8 in a baculovirus expression system.
FIG. 10. The ch~mo~cttractant activity of Ck~-8 was determined with chemotaxis assays using a 48-well microchamber device (Neuro Probe, Inc.). The experim~nt~l procedure was as described in the manufacturers m~nll~l For each concentration of Ck~-8 tested, migration in 5 high-power fields was ~X~mi ne~. The results presented represent the average values obt~in~ _rom two indep~n~nt eXperim~nt~
The rh~mn~cttractant activity on THP-1 (A) cells and human PBMCs (8) is shown.
FIG. 11. ~h~nge in intracellular calcium concentration in response to Ck~-8 was determined using a Hitachi F-2000 luorescence spectrophotometer. Bacterial expressed Ck~-8 was added to Indo-1 loaded THP-1 cells to a ~inal concentration o~ 50 nM and the intracellular level of calcium concentration was monitored.
FIG. 12. The monocyte cell line THP-1 was treated for 16 hours with LPS (0.1-10 ng/ml) or Ck~-8 (to 50 ng/ml).
Tissue culture supernatants were subjected to ELISA analysis to quantify the secretion of TNF-~.
FIG. 13. Human peripheral blood monocytes purified by elutriation were treated ~or 16 hours with increasing amounts of Ck~-8 (produced by baculovirus). Tissue culture supernatants were subjected to ELISA analysis to quanti~y the secretion o~ TNF-~, IL-6, IL-1, GM-CSF, and granulocyte-colony stimulating factor (G-CSF).

CA 02220l23 lss7-ll-04 O96/34891 PCT~S9~/09058 FIG. 14. A low density population of mouse bone marrow cells was plated (1,500 cells/dish) in agar rnn~ning medium with or without the indicated ch~mokines (100 ng/ml), but in the presence o~ IL-3 (5 ng/ml), SCF (100 ng/ml), IL-1~ ~10 ng/ml), and M-CSF (5 ng/ml). The data shown represents the average obt~ n~ ~rom two indepPn~nt experiments (each performed in duplicate). Colonies were counted 14 days after plating. The number o~ colonies generated in the presence of ch~mnkines is expressed as a mean percentage of those produced in the absence o~ any added ch~mnkines.
FIG. 15 illustrates the effect of Ck~-8 and Ck~-1 on mouse bone marrow colony formation by HPP-CFC (A) and LPP-CFC
(B).
FIG. 16 illustrates the effect of baculovirus-expressed Ck~-1 and Ck~-8 on M-CFS and SCF-stimulated colony formation o~ freshly isolated bone marrow cells.
FIG. 17 illustrates the e~ect of Ck~-8 and Ck~-1 on IL-3 and SCF-stim~ ted proliferation and di~ferentiation o~ the lin~population of bone marrow cells.
FIG. 18. Effect of Ck~-8 and Ck~-1 on the generation o~
GR-1 and Mac-1 (surface markers) positive population of cells ~rom lin~ population of bone marrow cells. lin~ cells were incubated in growth medium supplemented with IL-3 (5 ng/ml) and SCF (100 ng/ml) alone (a) and Ck~-8 (50 ng/ml) (b) or Ck~-1 (50 ng/ml). Cells were then st~ine~ with Monoclon~l antibodies against myeloid differentiation GR.1, Mac-1, Sca-1, and CD45R surface antigens and analyzed by FACScan. Data is presented as percentage o~ positive cells in both large (A) and small (B) cell populations.
FIG. 19 illustrates that the presence o~ Ck~-8 (+) ;nhih;ts bone marrow cell colony formation in response to IL-3, M-CSF and GM-CSF.
FIG. 20. Dose response o~ Ck~-8 inhihits bone marrow cell colony formation. Cells were isolated and treated as in Figure 19. The treated cells were plated at a density of WO96/34891 PCT~S95/09058 l,000 cells/dish in agar-based colony formation assays in the presence o~ IL-3, GM-CSF or M-CSF (5 ng/ml) with or without Ck~-8 at l, lO, 50 and lO0 ng/ml. The data is presented as colony ~ormation as a percentage o~ the nllmher o~ colonies formed with the speci~ic ~actor alone. The data is depicted as the average of duplicate ~i ~h~s with error bars indicating the st~n~d deviation.
FIG. 21. Induction o~ apoptosis by Ck~-8 and Ck~-l in the presence or absence o~ hematopoietic growth ~actors.
Mouse bone marrow cells were flushed from both the femur and tibia, separated on a ~icol density gradient and monocytes removed by plastic adherence. The resulting population o~
cells were then incubated overnight in an M~M-based medium supplemented with IL-3 t5 ng/ml), GM-CSF (5 ng/ml), M-CSF (lO
ng/ml) and G-CSF (lO ng/ml) with or without the addition of Ck~-8 (50 ng/ml) or Ck~-l (250 ng/ml). In addition, cells were cultured in medium alone, with or without Ck~-8 and Ck~-l. After 24 hours, cells were harvested and processed ~or apoptosis using the boehringer m~nnh~m cell death ELISA kit.
Data is shown as percentage increase abo~e background with the backylo~d considered as the amount of apoptosis occurring in the cultures incubated in the presence o~ each o~ the growth ~actors.
FIG. 22. Expression o~ RNA ~nro~ n~ Ck~-8 in human monocytes. Total RNA ~rom ~resh elutriated monocytes was isolated and treated with lO0 U/ml hu rIFN-g. lO0 ng/ml LPS, or both RNA ~8 ~g) ~rom each treatment was separated electrophoretically on a l.2~ agarose gel and trans~erred to a nylon ~ dne. Ck~-8 mR~A was quanti_ied by probing with 2P-labeled cDN~ and the bands on the resulting autoradiograph wer2 ~uar.t fied densitGmetrlcally.
In accordance with an aspect o~ the present invention, there are provided isolated nucleic acids (pol~nucleotides) which encode for the mature polypeptides having the deduced amino acid sequence o~ Figures l, 2 and 3 (SEQ ID No. 2, 4 WO 96/34891 PCT/US9a/09058 and 6, respectively) or for the mature Ck~-8 polypeptide encoded by the cDNA of the clone(s) deposited as ATCC Deposit No. 75676 on February 9, 1994, and _or the mature MIP-4 polypeptide encoded by the cDNA o~ the clone deposited as ATCC Deposit No. 75675 on February 9, 1994 and _or the mature Ck~-1 polypeptide encoded by the cDNA o~ the clone deposited as ATCC Deposit No. 75572, deposited on October 13, 1993.
Polynucleotides rnrq~i ng polypeptides of the present invention are structurally related to the pro-in_lammatory supergene "intercrine" which is in the cytokine or ch~mnkine ~amily. Both Ck~-8 and MIP-4 are MIP-l homologues and are more homologous to MIP-l~ than to MIP-l~. The polynucleotide encoding _or Ck~-8 was derived from an aortic endothelium cDNA library and Cont~; n~ an open rr~i ng ~rame encoding a polypeptide o~ 120 amino acid residues, which rxh; h; ts signi~icant homology to a number of rhem~kinP5. The top match is to the human macrophage in~lammatory protein 1 alpha, showing 36~ nt;ty and 66~ sim;l~nity (~igure 4).
The polynucleotide rnco~;n~ for MIP-4 was derived ~rom a human adult lung cDNA library and ront~;n~ an open r~; ng ~rame encoding a polypeptide o~ 89 amino acid r~ , which ~hi hi ts signi~icant homology to a number o~ rhrm~k;n~5. The top match is to the human tonsillar lymphocyte LD78 beta protein, showing 60~ identity and 89~ s;m;l~ity (_igure 5).
Furthermore, the $our cysteine residues occurring in all rhrmnkines in a characteristic moti~ are conserved in both clone~s). The fact that the _irst two cysteine residues in the genes are in adjacent positions classifies them as "C-C"
or ~ subfamily o~ rhemokines. In the other su~amily, the "CXC" or ~ sub~amily, the _irst two cysteine residues are separated by one amino acid.
The polynucleotide encoding _rom Ck~-l contains and open reading _rame encoding a polypeptide of 93 amino acids of which the _irst 19 are a leader sequence such that the mature polypeptide cont~in~ 74 amino acid residues. Ck~-1 exhi~its WO96/34891 PCT~S9~/09058 significant homology to human macrophage inflammatory protein ~ with 48% identity and 72~ sim;l~ity over a stretch of 80 amino acids. Further, the four cysteine residues comprising a characteristic motif are conserved.
The polynucleotides of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which ~nco~s the mature polypeptides may be identical to the coding sequence shown in Figures 1, 2 and 3 (SEQ ID No. 1, 3 and 5) or that of the deposited clone~s) or may be a different coding sequence which co~ing sequence, as a result of the rP~lln~ncy or degeneracy of the genetic code, encodes the same, mature polypeptides as the DNA of Figure 1, 2 and 3 (SEQ ID No. 1, 3 and 5) or the deposited cDNA(s).
The polynucleotides which ~nco~ for the mature polypeptides of Figures 1, 2 and 3 (SEQ ID No. 2, 4 and 6) or for the mature polypeptides encoded by the deposited cDNA~s) may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptides and additional ro~i ng sequence such as a leader or secretory sequence or a ~ otein sequence; the coding sequence for the mature polypeptides (and optionally additional ro~; ng sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the ro~i ng sequence for the mature polypeptides.
Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coAi ng sequence for the polypeptide as well as a polynucleotide which includes additional ro~i ng and/or non-coding sequence.
The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figures 1, 2 and 3 (SEQ ID

WO96/34891 PCT~S95/09058 No. 2, 4 and 6) or the polypeptides encoded by the cDNA of the deposited clone(s). The variants of the polynucleotides may be a naturally occurring allelic variant of the polynucleotides or a non-naturally occurring variant of the polynucleotides.
Thus, the present invention includes polynucleotides ro~ing the same mature polypeptides as shown in Figures l, 2 and 3 (SEQ ID No. 2, 4 and 6) or the same mature polypeptides encoded by the cDNA of the deposited clone(s) as well as variants of such polynucleotides which variants encode for a frA~m~nt, derivative or analog of the polypeptides of Figures l, 2 and 3 (SEQ ID No. 2, 4 and 6) or the polypeptides ~nco~ by the cDNA of the deposited clone(s). Such nucleotide variants include deletion vari sts, substitution variants and addition or insertion variants.
As her~nAhove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figures l, 2 and 3 (SEQ ID No. l, 3 and 5) or of the coding sequence of the deposited clone(s). As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substAnt; Al ly alter the function of the encoded polypeptide.
The present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptides may be fused in the same r~ ng frame to a polynucleotide sequence which aids in expression and secretion of a polypeptide from a host cell, for example, a leader sequence which ~unctions as a secretory sequence ~or controlling transport of a polypeptide ~rom the cell. The polypeptide having a leader sequence is a ~L~lotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide. The polynucleotides may also encode -WO 96/34891 PCT/US9~;1090!;8 for a proprotein which is the mature protein plus additional 5' amino acid residues. A mature protein having a prosequence is a proprotein and is an inactive form of the protein. once the prosequence is cleaved an active mature protein r~m~ n ~, Thus, _or example, the polynucleotides of the present invention may encode _or a mature protein, or _or a protein having a prosequence or for a protein having both a prosequence and a preseguence (leader seguence).
The polynucleotides of the present invention may also have the coding sequence _used in frame to a marker sequence which allows _or puri~ication of the polypeptides o~ the present invention. The marker seguence may be a hexa-histidine tag supplied by a pQE-9 vector to provide for puri_ication of the mature polypeptides fused to the marker in the case of a bacterial host, or, ~or example, the marker sequence may be a hemaggllltinin (HA) tag when a ~-mm~ n host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived ~rom the in~luenza hemagglnti n i n protein (Wilson, I., et al., Cell, 37:767 (1984)).
The present invention ~urther relates to polynucleotides which hybridize to the her~in~hove-described sequences i~ there is at least 50~ and pre~erably 70~
identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the herPin~hove-described polynucleotides . As herein used, the term "stringent conditions" means hybridization will occur only i~ there is at least 95~ and preferably at least 97~ identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a pre~erred embodiment ~nco~e polypeptides which retain substantially the same biological ~unction or activity as the mature polypeptides encoded by the cDNA o~ Figure 1, 2 and 3 (SEQ ID
No. 1, 3 and 5) or the deposited cDNAs.

WO 96/34891 PCT/US9~i/09058 Alternatively, the polynucleotides may be polynucleotides which has at least 20 bases, pre~erably 30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which has an identity thereto, as her~tn~hove described, and which does not retain activity. Such polynucleotides may be employed as probes for the polynucleotides o~ SEQ ID NOS:1, 3 and 5 for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.
The deposit(s) referred to herein will be m~int~in~
under the terms o~ the Budapest Treaty on the International Recognition of the Deposit o~ Micro-org~ni cm~ for purposes of Patent Procedure. These deposits are provided merely as convenience to those o~ skill in the art and are not an admission that a deposit is required under 35 U.S.C. ~112.
The sequence of the polynucleotides cont~ in the deposited materials, as well as the amino acid sequence o~
the polypeptides Pnco~ thereby, are incorporated herein by reference and are controlling in the event of any con~lict with description o~ seql~Pn~Ps herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.
The present invention further relates to Ck~-8, MIP-4 and Ck~-1 polypeptides which have the deduced amino acid sequence of Figures 1, 2 and 3 (SEQ ID No. 2, 4 and 6) or which have the amino acid sequence encoded by the deposited cDNAs, as well as fragment~, analogs and derivatives of such polypeptides.
The terms "~ragment," "derivative" and "analog" when re~erring to the polypeptides o~ Figures 1, 2 and 3 (SEQ ID
No. 2, 4 and 6) or that encoded by the deposited cDNA, means a polypeptide which retains ess~nti~lly the same biological function or activity as such polypeptide. Thus, an analog includes a proprotein which can be activated by cleavage of CA 02220l23 l997-ll-04 WO 96/34891 PCT/US9~;/0905 the proprotein portion to produce an active mature polypeptide.
The polypeptides of the present invention may be a recomhin~nt polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a re~omhin~nt polypeptide.
The fragment, derivative or analog of the polypeptides of Figures 1, 2 and 3 ~SFQ ID No. 2, 4 and 6) or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferahly a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptides are fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptides, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptides or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art ~rom the t~hings herein.
The polypeptides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
The term "gene" or "cistron~ means the segment of DNA
involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).
The term "isolated" means that the material is removed from its original environment (e.g., the natura~ envi~ t if it is naturally occurring). For example, a naturally-occurring polynucleotides or polypeptides present in a living WO96/34891 PCT~s95/09058 ~nim~l is not isolated, but the same polynucleotides or DNA
or polypeptides, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part o_ a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part o~ its natural enviro~m~nt.
The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors o_ the invention and the production of polypeptides o_ the invention by recomhin~nt techniques.
Host cells are genetically engineered ttransduced or trans_ormed or trans_ected) with the vectors of this invention which may be, for ~x~mrle, a cloning vector or an expression vector. The vector may be, _or example, in the form o_ a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in c~-lv~lltional nutrient media modi~ied as d~' iate _or acti~ating promoters, selecting trans_ormants or amplifying the Ck~-8, MIP-4 and Ck~-l genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected ~or expression, and will be apparent to the ordinarily skilled artisan.
The polynucleotides o~ the present invention may be employed ~or pronllr~ng polypeptides by recomh~n~nt techniques. Thus, ~or example, the polynucleotide sequence may be included in any one o~ a variety o~ expression vehicles, in particular vectors or plasmids ~or expressing a polypeptide. Such vectors include chromosomal, n~nch~omosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; yeast plasmids; vectors derived from combinations o~ plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. However, any other pl ~m~ ~ or vector may be used as long they are replicable and viable in the host.
The a~ylo~riate DNA sequence may be inserted into the vector by a variety of procedures. In yeneral, the DNA
sequence is inserted into an appropriate restriction ~n~onllclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
The DNA se~uence in the expression vector is operatively lirked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E coli. ac or trD, the phage 1 Amh~ PL
promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
The expression vector also contains a ribosome hin~ing site for translation initiation and a transcription terminator.
The vector may also include d~' ~liate se~uences ~or amplifying expr~ssion.
In addition, the expression vectors preferably cont~in a gene to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicill in resistance in E. coli.
The vector cnnt~inin~ the a~lup,iate DNA se~uence as herein~hove described, as well as an appropriate promoter or control sequence, may be employed to trans~orm an d~lo~iate host to permit the host to express the protein.
As representative examples of a~lu~iate hosts, there may be mentioned: bacterial cells, such as E. coli, Streptomyces, S~lmnn~lla Ty~himurium; ~ungal cells, such as yeast; insect cells such as Droso~hila S2 and S~9;
adenoviruses; ~nim~l cells such as CHO, COS or Bowes melanoma; plant cells, etc. The selection of an d~' ~iate host is ~em~ to be within the scope o~ those skilled in the art ~rom the t~chings herein.
More particularly, the present invention also includes reromhin~nt constructs comprising one or more o~ the se~l~nc~s as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence o~ the invention has been inserted, in a ~orward or reverse orientation. In-a pre~er~ed ~sp~ct sr th~s embo~im~nt, the construct ~urther c~--~ ises regulatory seauences, including, ~or example, a ~Iu---uLer, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those o~ skill in the art, and are r~mme~cially av~ hle~ The ~ollowing vectors are provided by way of example. Bacterial: pQE70, pQ~60, pQE-9 (Qiagen), pbs, pD10, phagescript, psiX174, pbluescript SK, pBSKS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); pTRC99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). Bukaryotic: pWLN~O, pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSV~3, pBPV, pMSG, pSVL tPharmacia). However, any other pl~mi~ or vector may be used as long as they are replicable and viable in the host.
Promoter regions can be selected ~rom any desired gene using CAT (chlor~mph~nicol trans~erase) vectors or other vectors with selectable markers. Two a~u~iate vectors are PKK232-8 and PCM7. Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, l~mh~ PR, PL and trp.
Eukaryotic ~ -uLers include CMV imm~ te early, B V
thymidine kinase, early and late SV40, LTRs ~rom retrovirus, and mouse metallothionein-I. Selection o~ the ~y~LO~ iate vector and promoter is well within the level o~ ordinary skill in the art.
In a further embo~iment~ the present invention relates to host cells ront~ining the above-described construct. The host cell can be a higher eukaryotic cell, such as a m~mm~lian cell, or a lower eukaryotic cell, such as a yeast WO96/34891 PCT~Ss~/09058 cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEA~-Dextran mediated transfection, or electroporation ~Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, ~1986)).
The constructs in host cells can be used in a conventional m~nnP~ to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides o~
the invention can be synthetically produced by conventional peptide synthesizers.
Mature proteins can be expressed in m~mn~~ n cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory ~nllAl, Second Edition, Cold Spring Harbor, N.Y., ~1989), the disclosure of which is hereby incorporated by reference.
Transcription of the DNA encoding the polypeptides of the present in~ention by higher eukaryotes is increased by inserting an Pnh~ncer sequence into the vector. ~nhAncers are cis-acting elPmPnts o~ DNA, usually about from lO to 300 bp that act on a promoter to increase its transcription.
EAxamples including the SV40 ~nh~ncer on the late side of the replication origin bp lO0 to 270, a cytomegalovirus early promoter enh~ncer, the polyoma PAnh~ncer on the late side of the replication origin, and adenovirus enhancers.
Generally, recombinant expression vectors will include origins o~ replication and selectable markers permitting transformation of the host cell, e.g., the ampic;ll~ n resistance gene o~ E coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct CA 02220l23 l997~ 04 WO 96/34891 PCT/US9~/09058 transcription of a downstream structural sequence. Such promoters can be derived from operons ~nco~i n~ glycolytic enzymes such as 3-phosphoglycerate kinase ~PGK), ~-_actor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in a~ iate phase with translation initiation and termination sequences, and pre~erably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., st~h;l~zation or simpli_ied puri_ication of expressed recombinant product.
Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable r~A~ ng phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide ampli~ication within the host. Suitable prokaryotic hosts ~or trans~ormation include E coli, Bacillus subtilis, Salmonella tvDhimurium and various species within the yenera Psell~n~nn~, Streptomyces, and Staphylococcus, although others may also be employed as a matter o~ choice.
As a representative but nonl im~ ting example, use~ul expression vectors ~or bacterial use can comprise a selectable marker and bacterial origin o~ replication derived ~rom comm~cially available plasmids comprising genetic elements o~ the well known cloning vector pBR322 (ATCC
37017). Such commercial vectors include, _or ~mple, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA). These pBR322 "back~one"
sections are combined with an a~L~yriate promoter and the CA 02220l23 l997-ll-04 WO96/34891 PCT~S95/09058 structural sequence to be expressed. F o l l o w i n g trans~ormatiOn o~ a suitable host strain and growth of the host strain to an a~ru~Liate cell density, the selected promoter is induced by ay~ u~riate means (e.g., temperature shift or chemical induction) and cells are cultured ~or an additional period.
Cells are typically harvested by centri~ugation, disrupted by physical or chemical means, and the resulting crude extract ret~t n~ ~or ~urther purification.
Microbial cells employed in expression of proteins can be disrupted by any convenient method, including ~reeze-thaw cycling, sonication, mechanical disruption, or use o~ cell lysing agents, such methods are well known to those skilled in the art.
Various m~mm~ 1 t ~n cell culture systems can also be employed to express re~omh~nAnt protein. Bxamples of m~mm~ l ian expression system.s include the COS-7 lines o~
monkey kidney ~ibroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines c~p~hle of expressing a compatible vector, ~or ~mple~ the C127, 3T3, CHO, HeLa and BHK cell lines . MAmm~ n expression vectors will c~-"~ r ise an origin o~ replication, a suitable promoter and ~nh~nc~, and also any necessary ribosome h; n~ing sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5~ nktng nontranscribed sequences. ~NA sequences derived ~rom the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
Ck~-8, MIP-4 and Ck~-l are recovered and purified ~rom recombinant cell cultures by methods including ~ont um sulfate or ethanol precipitation, acid extraction, anion or cation ~h~nge chromatography, phosphocellulose chromatography, hydrophobic interaction ch~omatography, a~finity chromatography hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, W O 96/34891 PCT~US9~/09058 as necessary, in completing con~iguration o~ the mature protein. Finally, high per~ormance liquid chromatography (HPLC) can be employed ~or ~inal puri~ication steps.
The polypeptides o~ the present invention may be a naturally puri~ied product, or a product o~ chemical synthetic procedures, or produced by recomhin~nt techniques ~rom a prokaryotic or eukaryotic host (~or example, by bacterial, yeast, higher plant, insect and m~mm~ n cells in culture). Depending upon the host employed in a recomh~ n~nt production procedure, the polypeptides o~ the present invention may be glycosylated with m~ 1 i An or other eukaryotic carbohydrates or may be non-glycosylated.
Polypeptides o~ the invention may also include an initial methionine amino acid residue.
The polypeptides o~ the present invention may be employed in a variety o~ ;m~nn~egulatory and in~lammatory ~unctions and also in a number o~ disease conditions. Ck~-8, MIP-4 and Ck~-l are in the rhpmnkine ~amily and there~ore they are rhPmo~ttractants ~or leukocytes ~such as monocytes, neutrophils, T lymphocytes, eosinophils, basophils, etc.).
Northern Blot analyses show that Ck~-8, MIP-4 and Ck~-1 are expressed pre~nm~n~ntly is tissues o~ haemopoietic origin.
Ck~-8 is shown to play an important role in the regulation o~ the ~mmlln~ response and in~lammation. In Figure 22, it is shown that lipopoly~r~h~ide ;n~ P~ the expression of Ck~-8 ~rom human monocytes. Accordingly, in response to the presence o~ an endotoxin, Ck~-8 is expressed ~rom monocytes and, there~ore, ~m;n;~tration of Ck~-8 may be employed to regulate the imm~ne response o~ a host.
As illustrated in Figure 10, the ~hpmn~ttractant activity o~ Ck~-8 on THP-1 cells ~A) and PBMCs ~B) is signi~icant. Ck~-8 also induces signi~icant calcium mnhi 1 i zation in THP-1 cells (Figure 11) showing that Ck~-8 has a biological e~ect on monocytes. Further, Ck~-8 CA 02220l23 l997-ll-04 WO96/34891 PCT~S95/09058 produces a dose dependent chemotactic and calcium mobilization response in human monocytes.
Accordingly, Ck~-8, MIP-4 and Ck~-1 can be employed to ~acilitate wound h~ling by controlling in~iltration o~
target immlln~ cells to the wound area. In a sim~ ashion, the polypeptides o~ the present invention can ~nh~nce host de~enses against chronic in~ections, e.g., mycobacterial, via their attraction and activation o~ microbicidal leukocytes.
Further, the polypeptides o~ the present invention may be employed in anti-tumor therapy since there is evidence that rh~mnkine expressing cells injected into tumors have caused regression o~ the tumor, ~or example, in the treatment o~ Karposi sarcoma. An analysis o~ Figures 12 and 13 illustrate that Ck~-8 in~nc~ THP-1 cells to secrete TNF-~, which is a known agent ~or regressing L~-.o~s. 250 ng/ml of Ck~-8 induces the production and secretion o~ 1200 picograms/ml o~ TNF-~. Ck~-8 also signi~icantly in~llr~c human monocytes to secrete other tumor and cancer ;nh; h; ting agents such as IL-6, IL-1 and G-CSF. Also, Ck~-8, MIP-4 and Ck~-1 stimulate the invasion and activation o~ host de~ense ttumoricidal) cells, e.g., cytotoxic T-cells and macrophages via their chemotactic activity, and in this way may also be employed to treat solid tumors.
The polypeptides may also be employed to ;nh; ht t the proli~eration and di~erentiation o~ hematopoietic cells and there~ore may be employed to protect bone marrow stem cells ~rom chemotherapeutic agents during chemotherapy. Figures 14 and 15 illustrate that Ck~-8 and Ck~-1 inhi hi t colony ~ormation of low proli~erative pot~nti~l colony ~orming cells, and that Ck~-8 is a potent and speci~ic inhihitor of LPP-CFC colony growth. Figure 16 illustrates that Ck~-l speci~ically inhihits M-CSF-stimulated colony ~ormation, while Ck~-8 does not. However, as also shown, both Ck~-8 and Ck~-1 signi~icantly inhibit growth or di~erentiation o~ bone marrow cells. This antiproli~erative e~ect allows a greater -WO 96/34891 PCT/US95/090~8 exposure to chemotherapeutic agents and, there_ore, more effective chemotherapeutic tr~tm~nt.
The inhihitory effect o~ the Ck~-l and Ck~-8 polypeptides on the subpopulation of committed ~yel~itor cells, (for example granulocyte, and macrophage/monocyte cells) may be employed therapeutically to inh~hit proliferation of leukemic cells.
In Figures 17, 18 and 19 the committed cells of the cell lineages utilized were removed and the resulting population of cel]s were contacted with Ck~-l and Ck~-8. Ck~-l causes a decrease in the Mac-l positive population o~ cells by nearly 50~, which is consistent with the results of Figure 16 which shows Ck~-l induces ~nhihition of M-CSF responsive colony-forming cells. Ck~-8, as shown in Figure 19, inhihit5 the ability of committed ~loye~itor cells to form colonies in response to IL-3, GM-CSF and M-CSF. Further, as shown in Figure 20, a dose response of Ck~-8 is shown to ;nh;htt colony formation. This inh;hition could be due to a ~peci~ic blockage of the differPnt;~tive signal mediated by these ~actors or to a cytotoxic effect on the ~Loy~..itor cells.
Another employment of the polypeptides is the inh;h;tion of T-cell proliferation via ~nh; hi tion of IL-2 biosynthesis, ~or example, in auto-immlln~ diseases and lymphocytic leukemia .
Ck~-8, MIP-4 and Ck~-l may also be employed _or inhibiting epidermal keratinocyte proliferation _or psoriasis (keratinocyte hyper-proliferation) since Langerhans cells in skin have been _ound to produce MIP-l~.
Ck~-8, MIP-4 and Ck~-l may be employed to prevent scarring during wound healing both via the recruitment of debris-cleaning and connective tissue-promoting inflammatory cells and by control of excessive TGF~-mediated fibrosis In addition, these polypeptides may be employed to treat stroke, thrombocytosis, plllm~n~ry emboli and myeloproliferative WO96/34891 PCT~S95/09058 disorders, since Ck~-8, MIP-4 and Ck~-l increase vascular perm~h;lity.
Ck~-8 may also be employed to treat leukemia and abnormally proliferating cells, for example tumor cells, by in~ncing apoptosis. Ck~-8 induces apoptosis in a population of hematopoietic progenitor cells as shown in Figure 21.
The polypeptides of the present invention, and polynucleotides ~nCo~ing such polypeptides, may be employed as research reagents for in vi tro purposes related to scientific research, synthesis of DNA and manufacture of DNA
vectors, and for the purpose of developing therapeutics and diagnostics for the treatment of human disease. For example, Ck~-l and Ck~-8 may be employed for the ~p~n~ion of immature hematopoietic ~loye~itor cells, for example, granulocytes, macrophages or monocytes, by temporarily preventing their differentiation. These bone marrow cells may be cultured in vi tro .
Fra~m~nt~ of the full length Ck~-8, MIP-4 or Ck~-l genes may be used as a hybridization probe for a cDNA library to isolate the full length gene and to isolate other genes which have a high sequence si m; 1 ~ity to the gene or si mi 1 biological activity. Preferably, however, the probes have at least 30 bases and may cnnt~in, for example, 50 or more bases. The probe may also be used to i~ntify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete genes including regulatory and promotor regions, exons, and introns. An example of a screen ~~ ises isolating the coding region of the genes by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the genes of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which m~m~s of the library the probe hybridizes to.

CA 02220l23 l997-ll-04 O 96/34891 PCTrUS9~/09058 This invention is also related to the use o~ the Ck~-8, MIP-4 and Ck~-l gene as part of a diagnostic assay for detecting diseases or suscept; h;l; ty to diseases related to the presence of m~t~t;ons in the nucleic acid sequences.
Such diseases are related to under-expression o~ the rhPmnkine polypeptides.
Individuals carrying mutations in the Ck~-8, MIP-4 and Ck~-1 may be detected at the DNA level by a variety of techniques. Nucleic acids for diagnosis may be obt~ineA _rom a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material. The genomic DNA may be used directly $or detection or m y be amplified enzymatically by using PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to analysis. RNA or cDNA may also be used $or the same purpose.
As an example, PCR primers compl~m~nt~y to the nucleic acid ~nroA;ng Ck~-8, MIP-~ and Ck~-1 can be used to identify and analyze Ck~-8, MIP-4 and Ck~-1 mutations. For ~r~ e, deletions and insertions can be detected by a change in size of the amplified product in cnmr~ison to the norm~l genotype. Point mutations can be iA~nt~fied by hybridizing amplified DNA to radiolabeled Ck~-8, MIP-4 and Ck~-1 RNA or alternatively, radiolabeled Ck~-8, MIP-4 and Ck~-1 antisense DNA seqnPnr~fi Per$ectly matched sequences can be disting~ h~r9 $rom mismatched duplexes by RNase A digestion or by di~$erences in melting temperatures.
Genetic testing based on DNA sequence differences may be achieved by detection o$ alteration in electrophoretic mobility of DNA $ragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA
$ragments o$ di$$erent sequences may be disting~ h~A on denaturing ~ormamide gradient gels in which the m oh;l ities of dif~erent DNA ~ragments are retarded in the gel at dif$erent positions according to their specific melting or partial CA 02220l23 Iss7-ll-04 WO96/34891 PCT~S95/09058 melting temperatures (see, e.g., Myers et al., Science, 230:1242 ~1985)).
Sequence ch~nges at specific locations may also be revealed by nuclease protection assays, such as RNase and S1 protection or the chemical cleavage method (e.g., Cotton et al., PNAS, USA, 85:4397-4401 ~1985)).
Thus, the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA se~lPncing or the use of restriction enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP)) and Sol~the~n blotting of genomic DNA.
In addition to more conventional gel-electrophoresis and DNA seqn~ncing, mutations can also be detected by in situ analysis.
The present invention also relates to a Ai~gnostic assay for detecting altered levels of Ck~-8, MIP-4 and Ck~-l protein in various tissues since an over-expression of the proteins rnmr~ed to normal control tissue samples may detect the presence of a disease or suscept;h;l;ty to a disease, for example, a tumor. Assays used to detect levels of Ck~-8, MIP-4 and Ck~-1 protein in a sample derived from a host are well-known to those of skill in the art and include radioimm~no~ssays, competitive-hinAing assays, Western Blot analysis, ELISA assays and "sandwich" assay. An ELISA assay (Coligan, et al., Current Protocols in Tmmllnology, 1(2), Chapter 6, (1991)) initially comprises preparing an ~ntihoAy specific to the Ck~-8, MIP-4 and Ck~-1 antigens, preferably a monoclonal antibody. In addition a reporter ~ntihody is prepared against the monoclonal ~nt;hody. To the reporter antibody is attached a detectable reagent such as radioactivity, fluorescence or, in this example, a horseradish peroxidase enzyme. A sample is removed from a host and incubated on a solid support, e.g. ~ polystyrene dish, that binds the proteins in the sample. Any free protein hi nAing sites on the dish are then covered by CA 02220l23 l997-ll-04 incubating with a non-specific protein like BSA. Next, the monoclonal ~nt~ho~y is ;n~nh~ted in the dish during which time the monoclonal ~ntihodies attach to any Ck~-8, MIP-4 and Ck~-l proteins att~chP~ to the polystyrene dish. A11 unhound monoclonal antibody is washed out with buf~er. The reporter ~nt; hody linked to horseradish peroxidase is now placed in the dish resulting in hi n~ing of the reporter ~ntih~dy to any monoclonal ~ntihody bound to Ck~-8, MIP-4 and Ck~-1.
Unatt~chP~ reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount o~ color developed in a given time period is a measul~...~,.t of the amount of Ck~-8, MIP-4 and Ck~-l protein present in a given volume o~ patient sample when romp~ed against a st~n~d curve.
A competition assay may be employed wherein ~ntihodies specific to Ck~-8, MIP-4 and Ck~-1 are att~chP~ to a solid support and labeled Ck~-8, MIP-4 and Ck~-l and a sample derived ~rom the host are passed over the solid support and the amount of label detected, ~or example by liquid s~in~ tion chromatography, can be correlated to a quantity o~ protein in the sample.
A ~sandwich~ assay is sim; 1~ to an ELISA assay. In a "sandwich" assay Ck~-8, MIP-4 and Ck~-l is passed over a solid support and binds to ~nt;hody att~rh~ to a solid support. A second antibody is then bound to the Ck~-8, MIP-4 and Ck~-l. A third ~nt;ho~y which is labeled and specific to the second ~nt;ho~y is then passed over the solid support and binds to the second antibody and an amount can then be quanti~ied.
This invention provides a method ~or i~Pnt;fication o~
the receptors ~or the ~hPmnk;np polypeptides. The gene encoding the receptor can be identified by numerous methods known to those o~ skill in the art, for example, ligand p~nn;ng and FACS sorting tColigan, et al., Current Protocols in Immun., 1(2), Chapter 5, ~1991)). Prefera_ly, expression PCT/US95/09n58 cloning is employed wherein polyadenylated RNA is prepared ~rom a cell responsive to the polypeptides, and a cDNA
library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to the polypeptides. Transfected cells which are grown on glass slides are exposed to the labeled polypeptides. The polypeptides can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase. Following fixation and incubation, the slides are subjected to autoradiographic analysis.
Positive pools are identi_ied and sub-pools are prepared and retransfected using an iterative sub-pooling and rescreening process, eventually yielding a single clones that encodes the putative receptor.
As an alternative approach for receptor i~ntification, the labeled polypeptides can be photoaffinity linked with cell membrane or extract preparations that express the receptor molecule. Cross-linked material is resolved by PA OE
analysis and exposed to X-ray film. The labeled complex contAining the receptors of the polypeptides can be excised, resolved into peptide fra~m~nt~, and subjected to protein microseq-~ncing. The amino acid sequence obtAin~ from microseq~rnci ng would be used to design a set o~ degenerate oligonucleotide probes to screen a cDNA library to i~ntify the genes ~nco~ing the putative receptors.
This invention provides a method of screening cu,,~uuuds to identify agonists and antagonists to the rh~m~kine polypeptides of the present invention. An agonist is a compound which has sim~ 1 An biological functions o~ the polypeptides, while antagonists block such functions.
Chemotaxis may be assayed by placing cells, which are chemoattracted by either o~ the polypeptides of the present invention, on top o~ a filter with pores o~ sufficient diameter to admit the cells ~about 5 ~m). Solutions of potential agonists are placed in the bottom o~ the chamber -WO 96/34891 PCT/US9:~/090~i8 with an appropriate control medium in the upper compA~L-"e.,L, and thus a concentration gradient of the agonist is measured by counting cells that migrate into or through the porous ne over time.
When assaying ~or antagonists, the rhemnkine polypeptides of the present invention are placed in the bottom chamber and the potPnt; Al antagonist is added to determine if chemotaxis of the cells is prevented.
Alternatively, a mAmmAl;An cell or Ill~u~dne preparation expressing the receptors of the polypeptides would be incubated with a labeled rh~okine polypeptide, eg.
radioactivity, in the presence of the cul,~,d. The ability of the compound to block this interaction could then be measured. When assaying for agonists in this fashion, the chPmnkines would be absent and the ability of the agonist itself to interact with the receptor could be measured.
Bxamples of potential Ck~-8, MIP-4 and Ck~-1 antagonists include Ant; hndies, or in some cases, oligonucleotides, which bind to the polypeptides. Another example of a potpnti Al antagonist is a negative ~nm;nAnt m~ltAnt of the polypeptides.
Negative ~nmin~nt mllt~nt~ are polypeptides which bind to the receptor of the wild-type polypeptide, but fail to retain biological activity.
Antisense constructs prepared using antisense tPchnnlogy are also potential antagonists. Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both o~ which methods are based on ~; n~i ng of a polynucleotide to DNA or RNA. For example, the 5' coding portion o~ the polynucleotide seguence, which encodes ~or the mature polypeptides o~ the present invention, is used to design an antisense RNA
oligonucleotide o~ ~rom about 10 to 40 base pairs in length.
A DNA oligonucleotide is designed to be complPmentA~y to a region o~ the gene involved in transcription (triple- helix, see Lee et al., Nucl. Acids Res., 6:3073 ~1979)j Cooney et - CA 02220l23 l997-ll-04 W096/34891 PCT~S9S/09058 al, Science, 241:4~6 (1988); and Dervan et al., Science, 251:
1360 (1991)), thereby preventing transcription and the production o~ the ~hPmokine polypeptides. The antisense RNA
oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the polypeptides (antisense - Okano, J. Neurochem., 56:560 (1991);
Oligodeoxynucleotides as Antisense Tnh; h; tors of Gene Expression, CRC Press, Boca Raton, ~L (1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inh; h; t production of the ~h~mnkine polypeptides.
Another potPnt;~l chemnk; ne antagonist is a peptide derivative of the polypeptides which are naturally or synthetically modified analogs of the polypeptides that have lost biological ~unction yet still recognize and bind to the receptors o~ the polypeptides to thereby ef~ectively block the receptors. ~xamples of peptide derivatives include, but are not limited to, small peptides or peptide-like molecules.
The antagonists may be employed to treat disorders which are either MIP-induced or ~nh~nced~ for example, auto-;m~lne and chronic in~lammatory and infective diseases. ~xamples of auto-;m~ne diseases include multiple sclerosis, and insulin-dep~n~Pnt diabetes.
The antagonists may also be employed to treat in~ectious diseases including silicosis, sarcoidosis, idiopathic pnlmnn~y fibrosis by prevPnt;ng the recruitment and activation of mnnonll~lear phagocytes. They may also be employed to treat idiopathic hyper-eosinophilic syndrome by preventing eosinophil production and migration. kndotoxic shock may also be treated by the antagonists by preventing the migration o~ macrophages and their production of the ch~mnkine polypeptides of the present invention.
The antagonists may also be employed ~or treating atherosclerosis, by preventing monocyte infiltration in the artery wall.

CA 02220l23 lss7-ll-04 WO96/34891 PcT~S95/09058 The antagonists may also be employed to treat hist~mine-mediated allergic reactions and imm~ln~logical disorders including late phase allergic reactions, chronic urticaria, and atopic denmatitis by inh;h;ting chPm~k;ne-;n~nce~ mast cell and basophil degranulation and release o~ hist~m; n~, IgE-mediated allergic reactions such as allergic asthma, rhinitis, and eczema may also be treated.
The antagonists may also be employed to treat chronic and acute infl~mm~tion by preventing the attraction o~
monocytes to a wound area. They may also be employed to regulate normal plllmnn~ry macrophage populations, since chronic and acute in~lammatory pnlmrn~ry diseases are associated with se~uestration o~ mnn~nllrlear phagocytes in the lung.
Antagonists may also be employed to treat rheumatoid arthritis by prev~nt;ng the attraction of monocytes into synovial ~luid in the joints of patients. Monocyte influx and activation plays a signi~icant role in the pathogenesis of both degenerative and in~lammatory arthropAthies.
The antagonists may be employed to inter~ere with the deleterious cascades attributed primarily to IL-l and TNF, which prevents the biosynthesis o~ other in~lammatory cytokines. In this way, the antagonists may be employed to ev~llt in~lammation. The antagonists may also be employed to ;nh; h; t prostaglAn~in-indep~n~nt ~ever ~n~l~c~ by ch~mr~kines .
The antagonists may also be employed to treat cases o~
bone marrow failure, for example, aplastic Anrm;~ and myelodysplastic syndrome.
The antagonists may also be employed to treat asthma and allergy by preventing eosinophil acc-~ml~lAt;on in the lung.
The antagonists may also be employed to treat subepithPl; Al basement m~ ~le fibrosis which is a prom;n~nt feature o~
the asthmatic lung.

-The antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.
The rh~m~kine polypeptides and agonists and antagonists may be employed in romhin~tion with a suitable pharmaceutical carrier. Such compositions com~rise a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to ~1 inP~ buffered ~l;ne, dextrose, water, glycerol, ethanol, and comht nA tions thereof. The formulation should suit the mode of ~mint ~tration.
The invention also provides a pharmaceutical pack or kit comprising one or more rontAin~s filled with one or more of the ingredients of the pharmaceutical compositions of the in~ention. A~sociated with such contAin~(s) can be a notice in the form prescribed by a gov~rnm~ntAl agency regulating the manufacture, use or sale of pharm~r~l~ticals or biological products, which notice reflects a~-o~al by the agency of manufacture, use or sale for human A~mini~tration. In addition, the polypeptides and agonists and antagonists may be employed in conjunction with other therapeutic compounds.
The pharmaceutical compositions may be A~mini ~tered in a convenient m~nne~ such as by the topical, intravenous, intraperitoneal, intramuscular, intratumor, sllhr~lt~neous, intranasal or intradermal routes. The pharmaceutical compositions are ~mini~tered in an amount which is effective for treating and/or prophylaxis of the specific indication.
In ~eneral, the polypeptides will be ~mi ni tered in an amount of at least about 10 ~g/kg body weight and in most cases they will be ~mi ni ~tered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 ~g/kg to about 1 mg/kg body weight daily, taking into account the routes of A~mi ni strati~n, symptoms, ~ etc.

CA 02220l23 l997-ll-04 WO96/34891 PCT~S95/09058 The rh~m~kine polypeptides, and agonists or antagonists which are polypeptides, may be employed in accordance with the present invention by expression o~ such polypeptides i~
vivo, which is o~ten re~erred to as "gene therapy. n Thus, ~or example, cells ~rom a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
Such methods are well-known in the art. For example, cells may be engineered by procedures known in the art by use o~ a retroviral particle cont~;ning RNA ~nco~;ng a polypeptide of the present invention.
Similarly, cells may be engineered in vivo ~or expression of a polypeptide in vivo by, ~or example, procedures known in the art. As known in the art, a prn~llc~r cell ~or pro~ll~;ng a retroviral particle cnnt~;ning RNA
encoding the polypeptide o~ the present invention may be ~m; n; ~tered to a patient ~or engineering cells in vivo and expression of the polypeptide in ~ivo. These and other methods ~or ~m~n~ ~tering a polypeptide o~ the present invention by such method should be apparent to those skilled in the art from the teachings o~ the present invention. For example, the expression vehicle ~or engineering cells may be other than a retrovirus, ~or example, an adenovirus which may be used to engineer cells in vivo a~ter comh;n~t;on with a suitable delivery vehicle.
The retroviral pl ~cm~ ~ vectors may be derived ~rom retroviruses which include, but are not limited to, Moloney Murine Sarcoma Virus, Moloney Murine Leukemia Virus, spleen necrosis virus, Rous Sarcoma Virus and Harvey Sarcoma Virus.
In a pre~erred embodiment the retroviral expression vector, pMV-7, is ~lanked by the long terminal repeats (LTRs) o~ the Moloney murine sarcoma virus and cont~;n~ the selectable drug resistance gene neo under the regulation o~
the herpes simplex virus (HSV) thymidine kinase (tk) CA 02220l23 l997-ll-04 W O 96/34891 PCTrUS9~/09058 promoter. Unique BcoRI and HindIII sites ~acilitate the introduction o~ coding sequence (Kirschmeier, P.T. et al., DNA, 7:219-25 ~1988)).
The vectors include one or more suitable promoters which include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cyto~egalovirus (CMV) promoter described in Miller, et al., Biotechniaues, Vol. 7, No. 9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and ~-actin promoters). The selection of a suitable promoter will be apparent to those skilled in the art ~rom the te~rh~ngs cont~i n e~ herein.
The nucleic acid seauence encoding the polypeptide o~
the present invention is under the control o~ a suitable promoter which includes, but is not limited to, viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs, the ~-actin promoter, and the native ~lu,,,oLer which controls the gene encoding the polypeptide.
The retroviral plasmid ~ector is employed to transduce packaging cell lines to ~orm producer cell lines. Bxamples o~ packaging cells which may be trans~ected include, but are not limited to, the PE501, PA317 and GP+aml2. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use o~ liposomes, and CaPO4 precipitation.
The producer cell line generates in~ectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vi tro or in vivo . The transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide. Bukaryotic cells which may be transduced, .

096/34891 PCT~S95/090~8 include but are not limited to, fibroblasts and endot cells.
The se~uences o~ the present invention are also valuable for chromosome i~ntification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorph; ~ms) are presently av~ ~le for marking chromosomal location. The mapping of DNA to chromosomes according to the present invention is an important first step in correlating those seqll~nc~s with genes associated with diseafie .
Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) _rom the cDNA.
Computer analysis of the cDNA is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids rnnt~;ning individual human chromosomes. Only those hybrids ront~;ni ng the human gene correspon~ing to the primer will yield an amplified _ragment.
PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
Using the present invention with the same oligonucleotide primers, sublocalization can be achieved with pAn~l,c o~
fra~m~n~ from specific chromosomes or pools of large genomic clones in an analogous m~n~e~. Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescr~n;ng with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
Fluorescence in situ hybridization (FISH) o_ cDNA clones to a met~Arh~e chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can WO96/34891 PCT~S95/09058 be used with cDNA as short as 500 or 600 bases. For a review of this technique, see Verma et al., Human a~ - o",osomes: a of Basic Techniques, Pely~l,.~lL Press, New York (1988) Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, ~n~lian Inheritance in Man (aV~ le on line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region are then i~nt;fied through linkage analysis (coinheritance o~ physically adjacent genes).
Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected indiv~ 1 s but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.
With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one o~ between 50 and 500 pot~nt;~l causative genes. (This assumes l m~g~h~Qe mapping resolution and one gene per 20 kb).
The polypeptides, their fra~m~nts or other derivative~, or analogs thereof, or cells expressing them can be used as an tmmllnngen to produce ~ntihodies thereto. These ~ntihsA;es can be, for example, polyclonal or monoclonal ~nt;hodies. The present invention also includes ~h;m~ic, single chain and hnm~nized ~nt;ho~; es, as well as Fab ~ragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and ~ragments.
~ Antibodies generated against the polypeptides correspon~ing to a sequence of the present invention or its .

O 96/34891 PCT~US9~/09058 in vivo receptor can be obt~inPA by direct injection of the polypeptides into an ~nim~l or by ~mini~tering the polypeptides to an ~ntm~l, preferably a nnnhl-m~n The antibody so obt~ineA will then bind the polypeptides itsel~.
In this ~nn~r, even a seguence PnCoAing only a ~ragment o~
the polypeptides can be used to generate ~nt;hoAies hinAing the whole native polypeptides. Such ~ntihodies can then be used to isolate the polypeptides ~rom tissue expressing that polypeptide.
For preparation o~ monoclonal antibodies, any technique which provides ~ntihoA;es produced by continuous cell line cultures can be used. ~xamples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Tmmllnology Today 4:72), and the ~BV-hybridoma technique to produce human monoclonal antihoA;es (Cole, et al., 1985, in Monoclonal ~ntihoAies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
Techniques described ~or the production o~ single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to imml~nogenic polypeptides products o~ this invention. Also, transgenic mice may be used to express ~ll~~n; zed ~ntihodies to im~llnogenic polypeptide products o~ this invention.
The present invention will be ~urther described with re~erence to the ~ollowing examplesi however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise speci_ied, are by weight.
In order to _acilitate underst~nAing of the _ollowing examples certain frequently occurring methods and/or terms will be described.
"Plasmids" are desiynated by a lower case p preceded and/or _ollowed by capital letters and/or numbers. The starting plasmids herein are either co~ ~cially av~ hl e, I CA 02220l23 l997-ll-04 PCT~S95/09058 publicly available on an unrestricted basis, or can be constructed ~rom aV~ hl e plasmids in accord with published procedures. In addition, eguivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are comm~rcially av~ hl e and their reaction conditions, co~actors and other reguirPm~nts were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically l ~g o~ plasmid or DNA
~ragment is used with about 2 units o~ enzyme in about 20 ~l of bu~er solution. For the purpose o~ isolating DNA
~ragments ~or plasmid construction, typically 5 to 50 ~g of DNA are digested with 20 to 250 units of enzyme in a larger volume. A~ u~iate bu~fers and substrate amounts ~or particular restriction enzymes are speci~ied by the manu~acturer. Incubation times o~ about l hour at 37 C are ordinarily used, but may vary in accordance with the supplier's instructions. A~ter digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
Size separation o~ the cleaved ~ra~nts is per~onmed using 8 percent polyacrylamide gel described by Goeddel, D.
et al ., Nucleic Acids Res., B:4057 ~1980).
"Oligonucleotides" re~ers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without ~i ng a phosphate with an ATP in the presence o~ a kinase. A synthetic oligonucleotide will ligate to a ~ragment that has not been dephosphorylated.

-CA 02220l23 l997-ll-04 WO96/34891 PCT~S9S/09058 "Ligation" refers to the process of ~orming phosphodiester bonds between two dou~le stranded nucleic acid ~r~ nts (Maniatis, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accompli~h~ using known bu~fers and conditions with 10 units to T4 DNA ligase (~ligase") per 0.5 ~g of d~ ' u~imately equimolar amounts o~
the DNA fra~nt~ to be ligated.
Unless otherwise stated, transformation was performed as described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).

ExamDle 1 Bacterial Expression and Purification of CkB-8 The DNA sequence encoding Ck~-8, ATCC # 75676, was initially amplified using PCR oligonucleotide primers corre8pnn~ ng to the 5' and 3' end sequences of the processed Ck~-8 protein (minus the signal peptide sequence) and the vector sequences 3' to the Ck~-8 gene. Additional nucleotides correspon~i ng to Bam HI and XbaI were added to the 5' and 3' seqllYnc~s respectively. The 5' oligonucleotide primer has the sequence 5' TCAGGATCCGT~A~A~GATGCAGA 3~ (SEQ
ID No. 7) cont~n~ a BamHI restriction enzyme site followed by 18 nucleotides of Ck~-8 co~i ny sequence starting from the presumed termi~al amin~ aei~ u~ the pr~e~s~ pFUt~i~.
3~ sequence 5' CGCTCTAGAGTA~AACGACGGCC~GT 3' (SEQ ID No. 8) cont~ ns compl~t~y sequences to an XbaI site. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector PQE-9 (Qiagen, Inc., Chatsworth, CA). PQE-9 encodes ~ntihtotic resistance (Amp'), a bacterial origin of replication (ori), an IPT&-regulatable promoter operator (P/O), a ribosome hin~ing site (RBS), a 6-His tag and restriction enzyme sites. pQE-9 is then digested with BamHI and XbaI The amplified sequences are ligated into PQE-9 and are inserted in frame with the sequence encoding for the histidine tag and the RBS. The liyation CA 02220l23 l997-ll-04 WO 96/34891 PCT/US9~;/09058 mixture is then used to transform E. coli strain M15/rep4 av~ilAhle from Qiagen. M15/rep4 rnnt~tn~ multiple copies o~
the plasmid pR~P4, which expresses the lacI repressor and also confers kanamycin resi~tance (Ranr). Transformants are i~nttfied by their ability to grow on ~3 plates and ampic;llin/kanamycin resistant colonies are selected.
Plasmid DNA is isolated and confirmed by restriction analysis. Clones cont~tntng the desired constructs were grown overnight ~O/N) in liguid culture in ~3 media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml).
The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells are grown to an optical density 600 (O.D.~) of between 0.4 and 0.6. IPTG
("Isopropyl-~-D-thiogalacto pyrano~ide") is then added to a _inal concentration of 1 mM. IPTG induces by inactivating the lacI repressor, clearing the P/O lP~tng to increased gene expression. Cells are grown an extra 3 to 4 hour~.
Cells are then harvested by centrifugation. The cell pellet is solllhtli~ed in the chaotropic agent 6 Molar Gll~nt~tnp HCl.
After clarification, solubilized Ck~-8 is purified from thi~
solution by chromatography on a Nickel-~hPl~te column under conditions that allow for tight htn~tng by proteins cont~tntn~ the 6-His tag (Hochuli, E. et al., J.
Chromatography 411:177-184 (1984)). Ck~-8 (95~ pure) is eluted from the column in 6 molar gl~nt~tn~ HCl pH 5.0 and ~or the purpose o~ renaturation adjusted to 3 molar guanidine HCl, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 = olar glutathione (oxidized). After incubation in this solution for 12 hours the protein is dialyzed to 10 mmolar sodium phosphate.

ExamPle 2 Bacterial ExPression and Purification of MIP-4 The DNA seguence encoding MIP-4, ATCC # 75675, was initially amplified using PCR oligonucleotide primers CA 02220l23 l997-ll-04 PCT~S95/09058 corresp~ntting to the 5' and 3' seqllt~nr~s of the processed MIP-4 protein (minus the signal peptide sequence).
Additional nucleotides corresponding to Bam HI and XbaI were added to the 5' and 3' end sequences respectively. The 5' oligonucleotide primer has the sequence 5' TCAGGAT~-l~l~CACaA~l-l w lACC 3' ~SBQ ID No. 9) contAtns a BamXI restriction enzyme site followed by 18 nucleotides of MIP-4 coding sequence starting from the presumed terminal amino acid of the processed protein codon; The 3' sequence 5' CGCTCTAGAGTA~AACGACGGCCAGT 3' ~S~Q ID No. lO) contains compl~mentAry seqll~nres to an XbaI site. The re~triction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc., Chatsworth, CA). pQE-9 ~nco~t~ Antthtotic resistance ~Amp'), a bacterial origin of replication ~ori), an IPTG-regulatable promoter operator ~P/O), a ribosome htntltng site (~3S), a 6-His tag and restriction enzyme sites. pQE-9 was then digested with BamXI and XbaI and the amplified se~lenc~s were ligated into pQE-9 and inserted in frame with the sequence encoding for the histidine tag and the RBS. The ligation mixture was then used to transform E coli strain avAilAhle ~rom Qiagen. Ml5/rep4 contains multiple copies of the plAcmid pREP4, which expresses the lacI repressor and al~o con~ers kanamycin resistance (Kanr). Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected.
Plasmid DNA was isolated and confirmed by restriction analysis. rlOn~S cont~inlng the desired constructs were grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (lO0 ug/ml) and ~an (25 ug/ml).
The O/N culture is used to inoculate a large culture at a ratio of l:lO0 to l:250 The cells were grown to an optical density 600 (O.D.~) of between 0.4 and 0.6. IPTG
("Isopropyl-B-D-thiogalacto pyranoside") was then added to a final concentration of 1 mM. IPTG induces by inactivating CA 02220l23 Iss7-ll-04 WO96/34891 PCT~S95/09058 the lacI repressor, clearing the P/O leading to increased gene expression. Cells were grown an extra 3 to 4 hours.
Cells were then harvested ~y centri_ugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HCl. After clarification, solubilized MIP-4 was purified ~rom this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight btn~tng by proteins rontA~ning the 6-His tag (Hochuli, E. et al., J.
Chromatography 411:177-184 ~1984)). MIP-4 (95~ pure) was eluted ~rom the column in 6 molar g~lAnt~nP HCl pH S.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCl, lOOmM sodium phosphate, 10 mmolar glutathtnne treduced) and 2 mmolar glutathione (~Y;~7-ed). After incubation in this solution ~or 12 hours the protein was dialyzed to 10 mmolar sodium phosphate.

Example 3 Bacterial ExDression and Purification o~ Ck~-1 The DNA ~equence encoding CkB-1! ATCC # 75572, is initially amplified using PCR oligonucleotide primers correspon~ng to the 5' and 3' end sequences o~ the processed Ck~-1 protein (minus the signal peptide sequence) and additional nucleotides corresp~n~ing to Bam HI and XbaI were added to the 5' and 3' sequences respectively. The 5' oligonucleotide primer has the sequence 5' GCCCGCGGAl~L-l~C-l-~ACGGGGACCTTAC 3' (SBQ ID No. 11) contAin~ a BamHI restriction enzyme site ~ollowed by 15 nucleotides o~
Ck~-l coding se~uence starting ~rom the presumed tenminal amino acid of the processed protein codon; The 3~ sequence 5' GCCTGCTCTAGATCAAAGCAGGGAAGCTCCAG 3' ~SEQ ID No. 12) cont~tn~
complementary sequences to an XbaI ~ite, a tran~lation stop codon and the last 20 nucleotides of Ck~-1 co~tng sequence.
The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector PQB-g.
(Qiagen, Inc., Chatsworth, C~). PQE-9 encodes antibiotic - -CA 02220l23 l997-ll-04 WO96/34891 PCT~S95109058 resistance (Ampr), a bacterial origin o~ replic~tio~ (ori), an IPTG-re~-l~t~hle promoter operator (P/O), a ribosome hin~ing site (RBS), a 6-His tag and restriction enzyme sites. pQE-9 was then digested with BamHI and XbaI and the ampli~ied seql~nr~s were ligated into PQE-9 and were inserted in ~rame with the sequence encoding ~or the histt~ine tag and the RBS.
The ligation mixture was then used to trans~orm ~. coli strain aV~ hl e ~rom Qiagen under the tr~em~k M15/rep 4.
M15/rep4 contains multiple copies o~ the plasmid pREP4, which expresses the lacI repressor and also con~ers kanamycin resistance (Kanr). Trans~o~ Ls are iA~ntified by their ability to grow on LB plates and ampic;llin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and con~irmed by restriction analysis. Clones cnn~tningthe desired constructs were grown overnight (0/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml~. The 0/N culture is used to inoculate a large culture at a ratio o~ 1:100 to 1:250. The cells were grown to an optical density 600 (O D.~) o~ between 0.4 and 0.6. IPTG (nIsG~lu~yl-B-D-thiogalacto pyranosiden) was then added to a ~inal concentration o~ 1 mM. IPTG ;n~llr~s by inactivating the lacI repressor, clearing the P/O l~Ai ng to increased gene expression. Cells were grown an extra 3 to 4 hours. Cells were then harvested by centri~ugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Gn~ni Ai n~ HCl. A~ter clari~ication, solubilized Ck~-l was puri~ied ~rom this solution by chromatography on a Nickel-Chelate column under conditions that allow ~or tight hi n~ing by proteins cont~ining the 6-His tag (Hochuli, E. et al., J.
~h~omatoqra~hy 411:177-184 (1984)). Ck~-l (95~ pure) was eluted ~rom the column in 6 molar guanidine HCl pH 5.0 and ~or the purpose of renaturation adjusted to 3 molar guanidine HCl, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized). A~ter incubation in WO96134891 PCT~S95/09058 this solution for 12 hours the protein was dialyzed to lO
mmolar sodium phosphate.

ExamPle 4 ~xPression of Recomh;nAnt CkB-8 in COS cells The expression of plasmid, CMV-Ck~-8 HA is derived from a vector pcDNAI/AmP (Invitrogen) contA~n~ng: l) SV40 origin of replication, 2) ampic;l1~ n resistance gene, 3) E.coli replication origin, 4) CMV ~u.,.~Ler followed by a polyl;nk~r region, a SV40 intron and polyadenylation site. A DNA
fragment encoding the entire Ck~-8 precursor and a HA tag fused in frame to its 3' end is cloned into the polyiinker region of the vector, therefore, the rernmhin~nt protein expression is directed under the CMV promoter. The HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, et al., Cell, 37:767 (1984)). The infusion of HA tag to the target protein allows easy detection of the recnmh~nAnt protein with an Ant~hody that recognizes the HA epitope.
The plasmid construction strategy is described as follow:
The DNA sequence encoding for Ck~-8, ATCC # 75676, is constructed by PCR u~ing two primer~: the 5' primer 5' GGAAAGCTTATGAA w l~-l~l~CT 3' (SEQ ID No. 13) rontA~nC a HindIII site followed by 18 nucleotides of Ck~-8 coding sequence starting from the initiation codon; the 3' sequence 5' CGCTCTAGATCAAGCGTA~l~-Lw ~A~l~lAl w ~lAAl-l-~-l-l-~-l-w l~-l-l GATCC 3' (SEQ ID No. 14) cont~n~ compl~m~ntA~y sequences to an Xba I site, translation stop codon, HA tag and the last 20 nucleotides of the Ck~-8 coding sequence (not including the stoF c~d~n). The~ef~, ~he ~P~ p~d~lct ~Qnt~~ Z~
site, Ck~-8 co~ ng sequence ~ollowed by HA tag fused in frame, a translation termination stop codon next to the HA
tag, and an XbaI site. The PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested with HindIII and XbaI

W O 96/34891 PCTrUS9~/09058 restriction enzyme and ligated. The ligation mixture is trans~ormed into E. coli strain SURE (Stratagene Cloning Systems, La Jolla, C~) the transformed culture is plated on ampi~;l1; n media plates and resistant colonies are selected.
Plasmid DNA is isolated from trans_ormant~ and ~mi n~ by restriction analysis ~or the presence of the correct ~ragment. For expression of the reromhin~nt Ck~-8, COS cells are transfected with the expression vector by DBAE-DEXTRAN
method (J. Sambrook, E. ~ritsch, T. Maniatis, Molecular Cloning: A Laboratory ~nll~l, Cold Spring Laboratory Press, (1989)). The expression of the Ck~-8-HA protein is detected by radiolabPll ing and immllnsprecipitation method (B. Harlow, D. Lane, Antihodies: A Laboratory ~nll~l, Cold Spring Harbor Laboratory Press, (1988)). Cells are labelled ~or 8 hours with 35S-cysteine two days post transfection. Culture media are then collected and cells are lysed with detergent (RIPA
bu~er (150 mM NaCl, 1~ NP-40, 0.1~ SDS, 1~ NP-40, 0.5% DOC, 50mM Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)).
Both cell lysate and culture media are precipitated with a HA
speci~ic monoclonal ;~nti ht~y. Proteins precipitated are analyzed on 15~ SDS-PAGE gels.

ExamDle 5 ExPression o~ RecombinAnt ~IP-4 in COS cells The expression o~ pl ~ ~mi ~, CMV-MIP-4 HA iS derived _rom a vector pcDNAI/Amp (Invitrogen) ron~;ntng: 1) SV40 origin of replication, 2) ampic;ll; n resistance gene, 3) E.coli replication origin, 4) C~V promoter ~ollowed by a polyl~nk~
region, a SV40 intron and polyadenylation site. A DNA
_ragment encoding the entire MIP-4 precursor and a H~ tag ~used in frame to its 3' end is rl on~ into the polylinker region o~ the vector, there~ore, the recomh~n~nt protein expression is directed under the CMV promoter. The HA tag correspond to an epitope derived ~rom the influenza hemagglutinin protein as previously described (I. Wilson, et WO 96134891 PCT/US9~i/09058 al., Cell, 37:767 ~1984)). The in~usion of HA tag to the target protein allows easy detection o~ the reromh~n~nt protein with an ~nt; hoAy that recognizes the HA epitope.
The plasmid construction strategy is described as ~ollow:
The DNA sequence encoding MIP-4, ATCC # 75675, is constructed by PCR using two primers: the 5' primer 5' GGA~AGC-l-lATGAAGGGCCTTGCAGCTGCC 3' (SEQ ID No. 15) ront~;n~ a HindIII site ~ollowed by 20 nucleotides o~ MIP-4 coding sequence starting ~rom the initiation codoni the 3' sequence 5' CGCTCTAGATCAABCGTA~l~-l~A~L~lAl~lAGGCATTCAGCTTCAGGTC
3' (SEQ ID No. 16) contains compl~m~nt~Ty sequences to an Xba I site, translation stop codon, HA tag and the last 19 nucleotides o~ the MIP-4 roA; ng sequence ~not including the stop codon). There~ore, the PCR product ront~;nc a HindIII
site, MIP-4 co~; ng sequence ~ollowed by HA tag ~used in ~rame, a translation termination stop codon next to the HA
tag, and an XbaI site. The PCR ampli~ied DNA ~ragment and the vector, pcDNAI/Amp, are digested with HindIII and X_aI
restriction enzyme and ligated. The ligation mixture is trans~ormed into E. coli strain SURE (Stratagene Cloning Systems, La Jolla, CA) the trans~ormed culture is plated on ampir;ll; n media plates and resistant colonies are selected.
Plasmid DNA is isolated ~rom trans~ormants and ~m; nP~ by restriction analysis ~or the presence of the correct ~ragment. For expression o~ the recomh~n~nt MIP-4, COS cells are trans~ected with the expression vector by DEAE-DEXTRAN
method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory M~n~ , Cold Spring Laboratory Press, (1989)). The expression o~ the MIP-4-HA protein is detected by radiolabelling and ;m~noprecipitation method (E. Harlow, D. Lane, Ant;hndies: A Laboratory ~nnAl, Cold Spring ~hoT
Laboratory Press, (1988)). Cells are labelled ~or 8 hours with 35S-cysteine two days post trans~ection. Culture media are then collected and cells are lysed with detergent (RIPA

WO96/34891 PCT~S9~/09058 bu~er (150 mM NaCl, l~ NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, SOmM Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 ~1984)).
Both cell lysate and culture media are precipitated with a HA
speci~ic monoclonal ~ntihody~ Proteins precipitated are analyzed on 15% SDS-PAGE gels.

Example 6 Ex~ression o~ Recsmbinant C~-l in COS cells The expression o~ ~lA~m;d, CMV-Ck~-l HA is derived ~rom a vector pcDNAI~Amp (Invitrogen) rnnt~ining l) SV40 origin o~ replication, 2) ampic;lltn resistance gene, 3) E.coli replication origin, 4) CMV promoter ~ollowed by a polylinker region, a SV40 intron and polyadenylation site. A DNA
~ragment encodiny the entire Ck~-l precursor and a HA tag ~used in ~rame to its 3' end was cloned into the polylink~
region o~ the vector, there~ore, the r~cnmhi n~nt protein expression is directed under the CMV ~ ~",~Ler. The HA tag correspond to an epitope derived ~rom the in~luenza hemaggll~tin;n protein as previously described ~I. Wilson, et al., Cell, 37:767 (1984)). The in~usion o~ HA tag to the target protein allows easy detection of the recomhin~nt protein with an antibody that recognizes the HA epitope.
The pl ~F~i ~ construction strategy is described a~
~ollows:
The DNA sequence encoding Ck~-l, ATCC # 75572, was constructed by PCR using t~o primers: the 5' primer 5' GGAAAGCTTATGAAGAl-L~C~l~GCTGC 3' (SEQ ID No. 17) cont~ins a HindIII site ~ollowed by 20 nucleotides o~ Ck~-l coding sequence starting ~rom the initiation codon; the 3' sequence 5' CGCT~T~TC~AGCGTA~L~-l~GA~l~lAl~-lA~-l-l~-l~-l-l~Al~-l~-l-3' (SEQ ID No. 18) ront~in~ compl~m~nt~ny sequences to an XbaI site, translation stop codon, HA tag and the last 19 nucleotides o~ the Ck~-l coding sequence (not including the stop codon). There~ore, the PCR product cont~in~ a HindIII
site, Ck~-l coding sequence ~ollowed by an HA tag ~used in - PCT/US9a/09058 frame, a translation termination stop codon next to the HA
tag, and an XbaI site. The PCR amplified DNA ~ragment and the vector, pcDNAI/Amp, were digested with HindIII and XbaI
restriction enzyme and ligated. The ligation mixture was transformed into E. coli strain SURE (Stratagene Cloning Systems, La Jolla, CA) the transformed culture was plated on ampic~ll;n media plates and resistant colonies were selected.
Plasmid DNA was isolated from transformants and P~m~ nP~ by restriction analysis for the presence of the correct fragment. For expression of the re~Qmh~n~nt Ck~-l, COS cells were transfected with the expression vector by DEAE-DBXTRAN
method (J. Sambrook, E. Fritsch, T. ~n~ ~t~, Molecular Cloning: A Laboratory ~n~l~ l, Cold Spring Laboratory Press, (1989)). The expression of the Ck~-1 HA protein was detected by radiolabelling and ~m~lnoprecipitation method (E. Harlow, D. Lane, ~nt~hodies: A Laboratory M~nll~l, Cold Spring ~rho~
Laboratory Press, (1988)). Cells were labelled ~or 8 hours with 35S-cysteine two days post transfection. Culture media were then collected and cells were lysed with detergent (RIPA
buffer (150 mM NaCl, 1% NP-40, 0.1~ SDS, 1~ NP-40, 0.5% DOC, 50mM Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)).
Both cell lysate and culture media were precipitated with a HA speci~ic monoclonal ~n~; hody. Proteins precipitated were analyzed on 15% SDS-PAGE gels.

Exam~le 7 ~xPression Pattern o~ Ck~-8 in human tissue Northern blot analysis was carried out to P~m~ne the levels of expression of Ck~-8 in human tissues. Total cellular RNA samples were isolated with RNAzol~ B system (Biotecx Laboratories, Inc., Houston, TX 77033). About 10ug of total RN~ isolated ~rom each human tissue specified is separated on 1% agarose gel and blotted onto a nylon ~ilter (Sambrook, Fritsch, and Maniatis, Molecular Cloning, Cold Spring Harbor Press, (1989)). The labeling reaction is done W096/34891 PCT~S95109058 according to the Stratagene Prime-It kit with 5Ong DNA
~ragment. The labeled DNA is puri~ied with a Select-G-50 column. (5 Prime - 3 Prime, Inc. Boulder, CO). The ~ilter is then hybridized with radioactive labeled ~ull length Ck~-8 gene at l,OOO,OOO cpm/ml in 0.5 M NaPO4, pH 7.4 and 7% SDS
overnight at 65 C. A~ter wa~h twice at room temperature and twice at 60 C with 0.5 x SSC, 0.1% SDS, the ~ilter is then exposed at -70 C overnight with an intensi~ying screen.

~xample 8 Expression Pattern o~ MIP-4 in human cells Northern blot analysis wa~ carried out to ~X~mi n~ the levels o~ expression o~ MIP-4 in human cells. Total cellular RNA samples were isolated with RNAzol~ B system (Biotecx Laboratories, Inc., Houston, TX). About lOug o~ total RNA
isolated ~rom each human tissue speci~ied was separated on 1%
agarose gel and blotted onto a nylon ~ilter (Sa"~look, Fritsch, and M~niatis, Molecular Cloning, Cold Spring ~ho~
Press, (1989)). The labeling reaction was done according to the Stratagene Prime-It kit with SOng DNA ~ragment. The labeled DNA wa5 puri~ied with a Select-G-50 column. (5 Prime - 3 Prime, Inc., Boulder, CO). The ~ilter was then hybridized with radioactive labeled ~ull length MIP-4 gene at 1,OOO,OOO cpm/ml in O.5 M NaPO4, pH 7.4 and 7% SDS overnight at 65 C. A~ter wash twice at room temperature and twice at 60 C with 0.5 x SSC, 0.1% SDS~ the ~ilter was then exposed at -70 C overnight with an intensi~ying screen.

~xam~le 9 Expression Pattern o~ Ck~-l in hum n tissue Northern blot analysis was carried out to ~mi ne the levels o~ expression o~ Ck~-l in human tissues. Total cellular RNA samples were isolated with RNAzol~ B system (Biotecx ~aboratories, Inc. Houston, TX). About lOug o~
total RNA isolated ~rom each hum.an tissue speci~ied was CA 02220l23 l997-ll-04 WO96/34891 PCT~S95/09058 separated on 1~ agarose gel and blotted onto a nylon filter (Sambrook, Fritsch, and Maniatis, Molecular Cloninq, Cold Spring ~rhor Press, (1989)). The labeling reaction was done according to the Stratagene Prime-It kit with 5Ong DNA
fragment. The labeled DNA was purified with a Select-G-50 column. (5 Prime - 3 Prime, Inc., Boulder, CO). The filter was then hybridized with radioactive labeled full length Ck~-1 gene at 1,000,000 cpm/ml in 0.5 M NaPO~, pH 7.4 and 7% SDS
overnight at 65 C. After wash twice at room temperature and twice at 60 C with 0.5 x SSC, 0.1% SDS, the filter was then exposed at -70 C overnight with an intensifying screen. The message RNA for Ck~-1 is ablln~nt in spleen.

ExamPle 10 ExPression and Purification of ~hPmnkine Ck~-8 usinq a baculovirus exPression sYstem.
SF9 cells were infected with a recomhin~nt baculovirus designed to express the Ck~-8 cDNA. Cells were infected at an MOI of 2 and cultured at 28~C for 72-96 hours. Cellular debris from the infected culture was removed by low speed centri~ugation. Protease inh; hi tor cocktail was added to the supernatant at a final concentration of 20 ~g/ml Pefabloc SC, 1 ~g/ml leupeptin, 1 ~g/ml E-64 and 1 mM EDTA. The level of Ck~-8 in the supernatant was monitored by loading 20-30 ~l of supernatant only 15% SDS-PAGE gels. Ck~-8 was detected as a visible 9 Kd band, corresponding to an expression level of several mg per liter. Ck~-8 was further purified thlo~h a three-step purification procedure: Heparin ht n~ing affinity chromatography. Supernatant of baculovirus culture was mixed with 1/3 volume of buffer cont~ining 100 mM HEPES/MES/NaOAc pH 6 and filtered through 0.22 ~m membrane. The sample was then applied to a heparin binding column (HE1 poros 20, Bio-Perceptive System Inc.). Ck~-08 was eluted at ~Lu~imately 300 mM NaCl in a lin~ gradient of 50 to 500 mM NaCl in 50 mM B PES/MES/NaOAc at pH 6; Cation ~ch~nge chromatography.

CA 02220l23 l997-ll-04 The Ck~8 enriched _rom heparin chromatography was subjected to a 5-_old dilution with a buffer contAin~ng 50 MM
HEPBS/MES/NaOAc pH 6. The resultant mixture was then applied to a cation ~chAnge column (S/M poros 20, Bio-Perceptive System Inc.). Ck~-8 was eluted at 250 mM NaCl in a ltne gradient o~ 25 to 300 mM NaCl in 50 mM HEPES/MES/NaOAc at pH
6; Size exclusion chromatography. Following the cation exchange chromatography, Ck~-8 was ~urther puri~ied by applying to a size exclusion column (HM50, TOSO HAAS, 1.4 x 45 cm). Ck~-8 ~ractionated at a position close to a 13.7Kd molecular weight stAn~A~d (RNase A), corresp~n~ing to the dimeric ~orm o~ the protein.
Following the three-step puri~ication described above, the resultant Ck~-8 was judged to be greater th~n 90~ pure as determined ~rom comm~Rsie blue stAinin~ o~ an SDS-PAGE gel (Figure 9).
The puri~ied Ck~-8 was also tested ~or endotoxin/LPS
contAm~nAtion. The LPS content was less thAn 0.1 ng/ml according to LAL assays (BioWhittaker).

~xamPle 11 E~ect o~ baculovirus-exPressed Ck~-1 and Ck~-8 on M-CSF and SCF-stimulated colony formation o~ ~reshlY isolated bone marrow cells.
A low density population o~ mouse bone marrow cells were incubated in a treated tissue culture dish ~or one hour at 37~C to remove monocytes, macrophages, and other cells that adhere to the plastic sur~ace. The non-adherent population o~ cells were then plated (10,000 cells/dish) in agar cont~; ni ng growth medium ln the presence or absence o~ the factors shown in Figure 16. Cultures were inrll~Ated for 10 days at 37~C (88~ N2, 5~ CO2, and 7~ ~2) and colonies were scored under an inverted microscope. Data is expressed as mean number of colonies and was obtAine~ _rom assays performed in triplicate.

CA 02220l23 l997-ll-04 WO 96/34891 PCT/US9~/090~8 ~xam~le 12 Effect of CkB-8 and CkB-1 on IL-3 and SCF stimulated proliferation and differentiation of lin-PoPulation of bone marrow cells.
A population of mouse bone marrow cells enriched in primitive hematopoietic ~loye~Litors was obt~; n~ using a negative selection procedure, where the committed cells of most of the lineages were removed using a panel of monoclonal antibodies (anti cdllb, CD4, CD8, CD45R, and Gr-1 antigens) and magnetic beads. The resulting population of cells (Lin~
cells) were plated (5 x 10~ cells/ml) in the presence or absence of the indicated rh~m~k~n~ (50 ng/ml) in a growth medium supplemented with IL-3 (5 ng/ml) plus SCF ~100 ng/ml).
After seven days of incubation at 37~C in a humidified incubator (5% CO2, 7% ~2~ and 88~ N2 environm~nt), cells were harvested and assayed for the HPP-CFC, and immature progenitors. In addition, cells were analyzed for the expression of certain differentiation antigens by FACScan.
Colony data are expressed as mean num.ber of colonies +/- SD) and were obt~ne~ from assays performed in six ~; ~h~ for each population of cells (Figure 17).

FxamDle 13 Ck~-8 inhibits colonv ~ormation in response to IL-3, M-CSF, and GM-CSF.
Mouse bone marrow cells were ~lushed from both the femur and tibia, separated on a ficol density gradient and monocytes removed by plastic adherence. The resulting population of cells were incubated overnight in an MEM-based medium supplemented with IL-3 (5 ng/ml), GM-CSF ~5 ng/ml), M-CSF ~10 ng/ml) and G-CSF ~10 ng/ml). These cells were plated at 1,000 cells/dish in agar-based colony ~ormation assays in the presence o~ IL-3 (5ng/ml), GM-CSF (5 ng/ml) or M-CSF ~5 ng/ml) with or without Ck~-8 at 50 ng/ml. The data is presented as colony formation as a percentage of the number CA 02220l23 lss7-ll-04 WO96/34891 PCT~S95/09058 o~ colonies ~ormed with the speci~ic $actor alone. Two experi m~nt ,c are shown with the data depicted as the average o~ duplicate ~ish~s with error bars indicating the st~n~rd deviation ~or each experiment (Figure 19).
~xamDle 14 ExPression via Gene Therapy Fibroblasts are obt~ne~ ~rom a subject by skin biopsy.
The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small rhllnkc o~ the tissue are placed on a wet sur~ace of a tissue culture ~lask, approximately ten pieces are pl~ce~ in each ~lask. The ~lask is turned upside down, closed tight and le~t at room temperature over night. A~ter 24 hours at room temperature, the ~lask is inverted and the chunks o~ tissue remain ~ixed to the bottom o$ the ~lask and ~rech media (e.g., Ham's F12 media, with 10% FBS, penir-illin and streptomycin, is added.
This is then incubated at 37~C ~or a~lu~imately one week.
At this time, ~resh media is added and subsequently changed every several days. A~ter an addition~l two weeks in culture, a ~onol~yer o~ ~ibroblasts ~ . The monolayer is trypsinized and scaled into larger ~lasks.
pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988) ~lanked by the long terminal repeats o~ the Moloney murine sarcoma virus, is digested with EcoRI and HindIII and subsequently treated with cal~ intestinal phosphatace~ The 1 i n~r vector is ~ractionated on agarose gel and puri~ied, using glass beads.
The cDNA encoding a polypeptide o~ the present inv~ntion is ampli~ied using PCR primers which correspond to the 5' and 3' end sequences respectively. The 5' primer ront~i ni ng an BcoRI site and the 3' primer having contains a HindIII site.
Equal quantities o~ the Moloney murine sarcoma virus l~ne~r backbone and the EcoRI and HimdIII ~ragment are added together, in the presence o~ T4 DNA ligase. The resulting mixture is maint~ine~ under conditions a~y~u~riate ~or CA 02220l23 Iss7-ll-04 WO96t34891 PCT/US9~/09058 ligation of the two fragments. The ligation mixture is used to transform bacteria ~3101, which are then plated onto agar-contAining kanamycin ~or the purpose of confirming that the vector had the gene of interest properly inserted.
The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Fagles Medium (DM~M) with 10~ calf serum (CS), penicillin and streptomycin. The MSV vector contAi ni ng the gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles rnntAining the gene (the packaging cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of con~luent proAllrP~ cells. The spent media, rontAining the infectious viral particles, is filtered through a millipore ~ilter to remove detA rh~ producer cells and this media is then used to infect fibroblast cells. Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be in$ected and no selection is required. I$ the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.
The engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads. The fibroblasts now produce the protein product.
Numerous modifications and variations o~ the present invention are possible in light o~ the above t~rhings and, therefore, within the scope o~ the appended rl~i m~, the invention may be practiced otherwise than as particularly described.

.' CA 02220l23 lsg7-ll-04 WO96/34891 PCT~S9~/09058 S~Qu_N~ LISTING
(1) ~RNRT~L INFORMATION:
(i) APPLICANT: LI, ET AL.
(ii) TITLE OF lNv~NLlON: Human ~hPm~kine Beta-8, Che~okine Beta-1 and Macrophage In~lammatory Protein-4 (iii) NUMBER OF SEQUEN OES: 18 ( iV) CoRRR~spoN~N~_ ADDRESS:
(A) AnnRR.~.SRR~ ~RRT-T-~, BYRNE, BAIN, GILFILLAN, OE CCHI, STEWART & OLSTEIN
(B) STREET: 6 BECKER FARM ROAD
(C) CITY: ROSELAND
(D) STATE: NEW J~RSBY
(B) ~UNl~Y: USA
(F) ZIP: 07068 (V) CO~UL~K REAn~RT~R FORM:
(A) MEDIUM TYPE: 3.5 INCH DI~K~-l-(B) COh~ U l'~: IBM PS/2 (C) OPERATING SYSTEM: MS-DOS
(D) SOFTWARE: WORD PERFECT 5.1 (vi) ~uKKK~l APPLICATION DATA:
~A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 08~173,209 (B) FILING DATE: 22 DEC 93 (viii) PRIOR APPLICATION DATA:
(A) APPLICATION h~UMBER: 08/208,339 (B) FILING DATE: 08 MAR 94 (ix) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: PCT/US94/07256 (B) FILING DATE: 28 JUNE 1994 (ix) Al-lO~N~/AGENT INFORMATION:
(A) NAME: FERRARO, GREGORY D.
(B) REGISTRATION NUMBER: 36,134 (C) REFEREN OE ~DOCKET NUMBER: 325800-289 (x) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 201-994-1700 (B) TELEFAX: 201-994-1744 W O96/34891 PCT~US9a/09058 ~2) INFORMATION FOR SEQ ID NO:1:
(i) SEQu KN~ CHARACTERISTICS
(A) LENGTH: 363 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STR~N~ lKI ~..K.~S: SINGLB
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: cDNA
(xi) SE~u~ DESCRIPTION: SBQ ID NO:l:
ATGAAGGTCT CCGTGGCTGC C~-1~L~1GC CTCATGCTTG TTA~ C~l TGGATCCCAG 60 GCCCGG~l~A CAAAAGATGC AC~r~r-~G TTCATGATGT CAAAGCTTCC ATTGGAAAAT lZ0 CCAGTACTTC TGGACAGATT CCATGCTACT A~~ ~ACT GCTGCATCTC CTACACCCCA 180 CGAAGCATCC ~l~ll~ACT CCTGGAGAGT TACTTTGAAA CGAACAGCGA GTGCTCCAAG 240 C~1~A l~-l-l~L-l~AC CAAoAAGGGG CGA~Il-l~-l GTGCr~rCC CAGTGATAAG 300 (2) INFORMATION FOR SBQ ID NO:2:
(i) SEQu~ CHARACTERISTICS
(A) LENGTH: 120 AMINO ACIDS
(B) TYPE: AMINO ACID
(C) ST~ J.~ ~S:
(D) TOPOLOGY: LINEAR
~ii) MOLECULE TYPE: PROTEIN
(xi) SE~u~N~ DESCRIPTION: SEQ ID NO:2:
Met Lys Val Ser Val Ala Ala Leu Ser Cys Leu Met Lys Val Thr Ala Leu Gly Ser Gln Ala Arg Val Thr Lys Asp Ala Glu Thr Glu Phe Met Met Ser Lys Leu Pro Leu Glu Asn Pro Val Leu Leu Asp Arg Phe His Ala Thr Ser Ala Asp Cys Cys Ile Ser Tyr Thr Pro Arg Ser Ile Pro Cys Ser Leu Leu Glu Ser Tyr Phe Glu Thr Asn Ser Glu Cys Ser Lys Pro Gly Val Ile Phe Leu Thr Lys Lys Gly Arg Arg Phe Cys Ala Asn Pro Ser Asp Lys Gln Val Gln Val Cys Met Arg Met Leu Lys Leu Asp Thr Arg Ile Lys Thr Arg Lys Asn (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUEN OE CH~RACTERISTICS
(A) LENGTH: 282 BASE PAIRS

WO96/34891 PCT~S95/09OS8 (B) TYPE: NUCLEIC ACID
(C) STR~N~K~NK-S~: SINGLE
(D) TOPOLOGY: TT ~ DT~
(ii) MOLBCULE TYPE: cDNA
(Xl) SEQu~L_ DESCRIPTION: SEQ ID NO:3:
ATGAAGATCT CCGTGGCTGC AAl-~CC~-l-lC l-l~-l~-l~A TCACCATCGC CCTAGGGACC 60 AAGACTGAAT C~-l~l~ACG GGr~rCTTAC CACCC~-L~AG AGTGCTGCTT CACCTACACT 120 AAGCCCGGAA l-l~l~-l-l~AT CACCAAAAGG GGCCATTCCG TCTGTACCAA CCCCAGTGAC 240 A~l~G~'~C ~rG~rT~TAT CAAGGACATG A~G ~r~rT GA 282 (2) lN~O~MATION FOR SEQ ID NO:4:
(i) ~_QU~N~ CHARACTERISTICS
(A) LENGTH: 93 AMINO ACIDS
(B) TYPE: AMINO ACID
(C) ST~2~Nl)Kl)NKss (D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: PROTEIN
(xi) SE~u~N~ DESCRIPTION: S8Q ID NO:4:
Met Lys Ile Ser Val Ala Ala Ile Pro Phe Phe Leu Leu Ile Thr Ile Ala Leu Gly Thr Lys Thr Glu Ser Ser Ser Arg Gly Pro Tyr His Pro Ser Glu Cys Cys Phe Thr Tyr Thr Thr Tyr Lys Ile Pro Arg Gln Arg Ile Met Asp Tyr Tyr Glu Thr Asn Ser Gln Cys Ser Lys Pro Gly Ile Val Phe Ile Thr Lys Arg Gly His Ser Val Cys Thr Asn Pro Ser Asp Lys Trp Val Gln Asp Tyr Ile Lys Asp Met Lys Glu Asn (3) INFORMATION FOR SEQ ID NO:5:
(i) SE~u~N~_ CHARACTERISTICS
(A) LENGTH: 270 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STR~ )KI )~Kcs: SINGLE
(D) TOPOLOGY: TT ~ P~R
(ii) MOLECULE TYPE: cDNA
(xi) SEQ~ DESCRIPTION: SEQ ID NO:5:
ATGAAGGGCC TTGCAGCTGC C--l~---l~lC ~-lC~l~lGCA CCATGGCCCT ~-~-l~-l~l 60 CA 02220l23 l997-ll-04 W O96/34891 PCTAU$95/09058 GCACAAGTTG GTACCAACAA AGAGCTCTGC TGcL-lLL~ ATA~L-l~L-L~ GCAGATTCCA 120 CAAAAGTTCA TAGTTGACTA TTCTGAAACC AGCCCCCAGT GCC~A5CC AG~lL-~LATC 180 CTCCTAACCA AGAGAGGCCG GCAGATCTGT GCTC~GCCr~ ATAAGAAGTG GGTCr~A~ 240 TACATCA~CG ACCTGAAGCT GAATGCCTGA 270 (4) INFORMATION FOR SEQ ID NO:6:
(i) SBQu~N~ CHARACTBRISTICS
(A) LENGTH: 89 AMINO ACIDS
~B) TYPE: AMINO ACID
(C) STRP~v_vN~SS:
(D) TOPOLOGY: T.TNRA~!
(ii) MOLECULB TYPE: PRCTBIN
(xi) SEQu~N~ DESCRIPTION: SEQ ID NO:6:
Met Lys Gly Leu Ala Ala Ala Leu Leu Val Leu Val Cy8 Thr Met Ala Leu Cys Ser Cys Ala Gln Val Gly Thr Asn Lys Glu Leu Cys Cys Leu Val Tyr Thr Ser Trp Gln Ile Pro Gln Lys Phe Ile Val 25~sp Tyr Ser Glu Thr Ser Pro Gln Cys Pro Lys Pro Gly Val Ile Leu Leu Thr Lys Arg Gly Arg Gln Ile Cys Ala Asp Pro Asn Lys Lys Trp Val Gln Lys Tyr Ile Ser Asp Leu Lys Leu Asn Ala (2) lN~O~IATION FOR SEQ ID NO:7:
(i) SBQu_N~_ CHARACT~RISTICS
(A) LENGTH: 26 BASE PAIRS
(B) TYPE: NUCLEIC ACID
( C ) Sl~ N I ~ K I J~l K~ : SINGLE
(D) TOPOLOGY: LINBAR
(ii) MOLECULB TYPE: Oliyonucleotide (xi) SEQu~N~ DESCRIPTION: SBQ ID NO:7:
TCAGGATCCG Tr~rAA~AGA TGCAGA 26 (2) INFORMATION FOR SEQ ID NO:8:
(i) SEQu~_ CHARACTERISTICS
(A) LENGTH: 26 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANv~vN_SS: SINGLB
(D) TOPOLOGY: LINEAR

-WO96/34891 PCT~S95/09058 (ii) MOLECULE TYPE: Oliyonucleotide (xi) SEQUEN OE DESCRIPTION: SEQ ID NO:8:
CGCTCTAGAG TAAAA~r~r7 GCCAGT 26 (2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUEN OE CHARACTERISTICS
~A) LENGTH: 27 BASE PAIRS
~B) TYPE: NUCLEIC ACID
~C) STRPNl)Kl)hK-~S: SINGLE
~D) TOPOLOGY: LINBAR
(ii) MOLECULE TYPE: Oligonucleotide ~xi) SEQUEN OE DESCRIPTION: SEQ ID NO:9:

~2) INFORMATION FOR SEQ ID NO:l0:
~i) SEQUEN OE CHARACTERISTICS
(A) LENGTH: 26 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) ST~AN~K~ KCS: SINGLB
tD) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oliyonucleotide (xi) SEQUBN OE DESCRIPTION: SEQ ID NO:l0:

(2) INFORMATION FOR SEQ ID NO:ll:
(i) SEQUEN OE CHARACTERISTICS
(A) LENGTH: 30 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANv~vN~SS: SINGLE
(D) TOPOLOGY: T.TNR~T~
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUEN OE DESCRIPTION: SEQ ID NO:ll:

CA 02220l23 l997-ll-04 PCT~S95/09058 (2) INFORMATION FOR SBQ ID NO:12:
(i) SEQu_N~ CHARACThRISTICS
(A) LENGTH: 32 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRAN~)K~NK~S: SINGLE
(D) TOPOLOGY: T.TNRAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQu_N~ DESCRIPTION: SBQ ID NO:12:

(2) INFORMATION FOR SEQ ID NO:13:
(i) SE~u_N~ CHARACTERISTICS
(A) LBNGTH: 27 BASE PAIRS
(B) TYPE: NU T-RIC ACID
(C) STRAh~K~NK~S: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLBCULE TYPE: Oligonucleotide (xi) SEQuh~ DESCRIPTION: SEQ ID NO:13:
GGAAAGCTTA TGAA~~ -C CGTGGCT 27 ~2) INFORMATION FOR SEQ ID NO:14:
(i) SEQu~_ CHARACTERISTICS
(A) LBNGTH: 59 BASE PAIRS
(E) TYPE: NUCLEIC ACID
(C) STR~N~N~SS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQu~N~_ DESCRIPTION: SEQ ID NO:14:
CGCTCTAGAT r r-CGTAGT CTGGGACGTC GTATGGGTA~ lC~-l~G TCTTGATCC 59 (2) lN~O~IATION FOR SEQ ID NO:15:
(i) SEQulsNc~ CHARACTERISTICS
(A) LENGTH: 30 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDBDNESS: SINGLE
(D) TOPOLOGY: LINEAR

CA 02220l23 lss7-ll-04 WO96/348sl PCT~S95/09OS8 ~ii) MOLECULE TYPE: Oligonucleotide (xi) SBQu~ DBSCRIPTION: SEQ ID NO:15:

(2) INFORMATION FOR SEQ ID NO:16:
(i) SE~u~ CHARACTERISTICS
(A) LENGTH: 57 BASE PAIRS
(B) TYPE: NU T~T~IC ACID
(C) STR~NI )~ N~:.C.C:: SINGLE
(D) TOPOLOGY: T.TNRAT~
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQu~ DESCRIPTION: SEQ ID NO:16:
CGCTCTAGAT CAABCGTAGT ~-L~ACGTC GTAl~lAG GCATTCAGCT TCAGGTC

(2) lN~O~-IATION FOR SEQ ID NO:17:
(i) SEQUEN OE CHARAC-l~RISTICS
(A) LENGTH: 28 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) ST}2Z~NI)~ SSS: SINGLE
(D) TOPOLOGY: T.TN~A~
(ii) MOLECULE TYPE: Oligonucleotide (xi) SE~u~ DESCRIPTION: SEQ ID NO:17:

(2) INFORMATION FOR SEQ ID NO:18:
(i) SEQu~N~ CHARACTERISTICS
tA) LENGTH: 58 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRAN~N~SS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SB~u~N~ DESCRIPTION: SEQ ID NO:18:
CGCTCTAGAT CAAGCGTAGT CTGGGACGTC GTATGGGTAG ~-~ ~-L~:~ -J.-l~:.A '~1~;~-1 lG 58

Claims (22)

WHAT IS CLAIMED IS:

1. An isolated polynucleotide comprising a member selected from the group consisting of:
(a) a polynucleotide encoding the polypeptide comprising amino acids -21 to amino acid 99 of SEQ ID No. 2;
(b) a polynucleotide encoding the polypeptide comprising amino acids 1 to amino acid 99 of SEQ ID No. 2;
(c) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a) or (b); and (d) a polynucleotide fragment of the polynucleotide of (a) or (b).

2. The polynucleotide of Claim 1 wherein the polynucleotide is DNA.

3. The polynucleotide of Claim 1 wherein the polynucleotide is RNA.

4. The polynucleotide of Claim 1 wherein the polynucleotide is genomic DNA.

5. The polynucleotide of Claim 2 which encodes the polypeptide comprising amino acid -21 to 99 of SEQ ID No. 2.

6. The polynucleotide of Claim 2 which encodes the polypeptide comprising amino acid 1 to 99 of SEQ ID No. 2.

7. An isolated polynucleotide comprising a member selected from the group consisting of:
(a) a polynucleotide which encodes a polypeptide having the amino acid sequence expressed by the DNA contained in ATCC
Deposit No. 75676;
(b) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a);

(c) a polynucleotide fragment of the polynucleotide of (a) or (b).

8. The polynucleotide of claim 1 comprising the sequence as set forth in SEQ ID No. 1 from nucleotide 1 to nucleotide 363.

9. A vector containing the DNA of Claim 2.

10. A host cell genetically engineered with the vector of Claim 9.

11. A process for producing a polypeptide comprising:
expressing from the host cell of Claim 10 the polypeptide encoded by said DNA.

12. A process for producing cells capable of expressing a polypeptide comprising genetically engineering cells with the vector of Claim 9.

13. A polypeptide selected from the group consisting of (i) a polypeptide having the deduced amino acid sequence of SEQ ID No.
2 and fragments, analogs and derivatives thereof; and (ii) a polypeptide encoded by the cDNA of ATCC Deposit No. 75676 and fragments, analogs and derivatives of said polypeptide.

14. The polypeptide of Claim 13 wherein the polypeptide has the deduced amino acid sequence of SEQ ID No. 2.

15. An agonist for the polypeptide of claim 13.

16. An antagonist against the polypeptide of claim 13.

17. A method for the treatment of a patient having need of Ck.beta.-8 comprising: administering to the patient a therapeutically effective amount of the polypeptide of claim 13.

18. The method of Claim 17 wherein said therapeutically effective amount of the polypeptide is administered by providing to the patient DNA encoding said polypeptide and expressing said polypeptide in vivo.

19. A method for the treatment of a patient having need to inhibit a Ck.beta.-8 polypeptide comprising: administering to the patient a therapeutically effective amount of the antagonist of Claim 16.

20. A process for diagnosing a disease or a susceptibility to a disease related to an under-expression of the polypeptide of claim 13 comprising:
determining a mutation in the nucleic acid sequence encoding said polypeptide.

21. A diagnostic process comprising:
analyzing for the presence of the polypeptide of claim 13 in a sample derived from a host.

22. A process for identifying antagonists and agonists to the polypeptide of claim 13 comprising:
combining cells, a compound to be screened and said polypeptide wherein the cells are separated from said polypeptide by a porous filter; and determining the extent of migration of the cells to determine if the compound is an effective antagonist or agonist.